ID: 1185351820

View in Genome Browser
Species Human (GRCh38)
Location 22:50343488-50343510
Sequence CCGTGTGGAGGCCCGAGCGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 100}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185351820_1185351829 13 Left 1185351820 22:50343488-50343510 CCTCCGCTCGGGCCTCCACACGG 0: 1
1: 0
2: 0
3: 6
4: 100
Right 1185351829 22:50343524-50343546 TGCCGCGACGCCCGGCCCGCAGG 0: 1
1: 0
2: 0
3: 9
4: 130
1185351820_1185351832 18 Left 1185351820 22:50343488-50343510 CCTCCGCTCGGGCCTCCACACGG 0: 1
1: 0
2: 0
3: 6
4: 100
Right 1185351832 22:50343529-50343551 CGACGCCCGGCCCGCAGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 150
1185351820_1185351828 5 Left 1185351820 22:50343488-50343510 CCTCCGCTCGGGCCTCCACACGG 0: 1
1: 0
2: 0
3: 6
4: 100
Right 1185351828 22:50343516-50343538 CGAAGAGCTGCCGCGACGCCCGG 0: 1
1: 0
2: 0
3: 3
4: 45
1185351820_1185351835 27 Left 1185351820 22:50343488-50343510 CCTCCGCTCGGGCCTCCACACGG 0: 1
1: 0
2: 0
3: 6
4: 100
Right 1185351835 22:50343538-50343560 GCCCGCAGGGCAGGTGAGTGCGG 0: 1
1: 0
2: 2
3: 26
4: 325
1185351820_1185351830 14 Left 1185351820 22:50343488-50343510 CCTCCGCTCGGGCCTCCACACGG 0: 1
1: 0
2: 0
3: 6
4: 100
Right 1185351830 22:50343525-50343547 GCCGCGACGCCCGGCCCGCAGGG 0: 1
1: 0
2: 0
3: 23
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185351820 Original CRISPR CCGTGTGGAGGCCCGAGCGG AGG (reversed) Exonic
900299052 1:1967636-1967658 CCCTGTGGAGGCCAAAGCTGAGG + Intronic
914755941 1:150561665-150561687 GCTTGTGGAGTCGCGAGCGGGGG - Intergenic
916576316 1:166070271-166070293 TCATGTGGAGGCCCAAGCGGGGG - Exonic
916994835 1:170285236-170285258 CCGTTTGCAGTCCTGAGCGGTGG - Intergenic
920013738 1:202888827-202888849 CCGAGCTGAGGCCCGAGGGGCGG + Intronic
923171699 1:231422373-231422395 CCGGGGGGAGGGCCGAGGGGCGG + Exonic
1063352312 10:5366823-5366845 CCGTGTGCAGGCTAGAGCTGAGG + Intronic
1063393657 10:5666533-5666555 CCGCATGGAGCCCCGGGCGGCGG - Exonic
1064231055 10:13529240-13529262 GCGAGCGGAGGCCCGGGCGGCGG - Intergenic
1068710691 10:60130219-60130241 ACATGTGGAGGCCAGAGCTGGGG - Intronic
1068763008 10:60733375-60733397 ACGTTTGGAGGCCCGAGGAGCGG - Intronic
1074188729 10:111117660-111117682 CAGTGTGGAGGCCCCAGAGAGGG + Intergenic
1075129371 10:119725684-119725706 CGGAGGGGAGGCCCCAGCGGTGG + Intergenic
1075664783 10:124222528-124222550 CAGTGGGGAGGCCTGAGCGTAGG + Intergenic
1076846402 10:133071510-133071532 CAGTGGGGAGGCCCGAGGAGGGG - Intronic
1081876380 11:46411174-46411196 CCCTGGGGCGGCCTGAGCGGAGG + Intronic
1083625393 11:64069560-64069582 CCGTGTGGTGCCCCTAGCTGTGG + Intronic
1083661221 11:64252507-64252529 CCGGGTGGAGGCCCTAGGGAAGG - Intronic
1084309125 11:68305980-68306002 CCGTCTGGAGGCTCTAGGGGAGG + Intergenic
1084396169 11:68911920-68911942 CCGTGTGCACGCCCGTGCAGGGG + Intronic
1084935506 11:72584526-72584548 GCGCGTGGCGGCCCGGGCGGAGG - Intronic
1088648440 11:111937114-111937136 CCGTGCTGCGGCCCGGGCGGGGG + Intronic
1089955699 11:122569130-122569152 CCGTGGGGAGGCAGGAGGGGAGG + Intergenic
1091558631 12:1594296-1594318 CCGTGCGGAGCCCGGGGCGGGGG - Intronic
1115664553 14:35533783-35533805 CCGGGTCCCGGCCCGAGCGGAGG + Intergenic
1118443912 14:65835120-65835142 CCGTGTGGAGGAGGGAGCGCTGG + Intergenic
1119740260 14:77009457-77009479 CCCTCTGGAGGCCTGAGCAGGGG - Intergenic
1128345751 15:66851418-66851440 CCGTGAGGAGCCCAGAGCGCTGG + Intergenic
1128758148 15:70196997-70197019 CCGTCTGTAGGCCCCAGCAGAGG + Intergenic
1131267972 15:90929869-90929891 CCAAGTGAAGGCCCCAGCGGAGG - Intergenic
1132887580 16:2189401-2189423 ATGTGGTGAGGCCCGAGCGGGGG - Exonic
1133173615 16:3997609-3997631 CCCTCAGGAGGCCCGAGCGTGGG - Intronic
1133336927 16:5012312-5012334 GCATGTGGAGGCCAGAGGGGTGG + Intronic
1136129769 16:28212145-28212167 CCGCGTGGACGCACGGGCGGTGG - Intergenic
1136575016 16:31118114-31118136 CCTGGTGAAGGCCTGAGCGGTGG - Intronic
1138089029 16:54159162-54159184 CCGTAGGGAGGCCCTAGTGGTGG - Intergenic
1141663654 16:85454644-85454666 CCTTGTGGAGGCCCTGGCGGAGG + Intergenic
1142157109 16:88537624-88537646 CAGGGTGGAGGCCCAGGCGGTGG - Intergenic
1142671034 17:1487494-1487516 CCCTGGGGACCCCCGAGCGGGGG + Intronic
1144645407 17:16970391-16970413 CCGTGAGGAGGCACAAGCAGAGG - Intronic
1145203973 17:20970856-20970878 ACGTGTGGAGGCACAAGCAGAGG + Intergenic
1146901550 17:36592377-36592399 CCCTGGGGAGACCCGAGGGGCGG - Intronic
1148053790 17:44781726-44781748 CTGTGTGGAGGCCCAGGCAGAGG - Exonic
1148892437 17:50817743-50817765 CCGTGTGGAGTCCCAAGCCTGGG - Intergenic
1160658591 19:287809-287831 CCTTGGGGAGGCCCGTGCGGAGG - Intronic
1161029414 19:2050893-2050915 CCGGGGGGAGGCCCGAGGGCGGG + Exonic
1165928637 19:39342531-39342553 GCCTGAGGAGGCCCGAGCGGCGG + Exonic
1166183340 19:41123809-41123831 GCGGGTGGAGGCAGGAGCGGTGG - Intronic
1167793746 19:51695804-51695826 CAGAGCGGAGGCCCGAGTGGGGG + Intergenic
926225929 2:10966851-10966873 CCGTGTGGAAGCCTGTGGGGAGG + Intergenic
934563018 2:95323023-95323045 GTGGGTGGAGGCCAGAGCGGGGG - Intronic
937164268 2:119796170-119796192 CAGTGGGGAGGCCAGAGCAGTGG - Intronic
946333738 2:219024288-219024310 CAGGGTGGAGGTCTGAGCGGGGG - Intronic
947623327 2:231604586-231604608 CCGTGTCGGGGCCGGAGCTGGGG + Intergenic
947853551 2:233307697-233307719 CCGTATGGAGACCGGGGCGGGGG + Intergenic
948488532 2:238296765-238296787 CGGTGTGGCGGCCCCAGGGGGGG + Intergenic
1169367300 20:5001600-5001622 CCGGGGGGAGGCCCGAGGGCAGG - Intronic
1171175759 20:23049941-23049963 ACGCGTGGGGGCCCGAGTGGTGG - Intergenic
1172649362 20:36492097-36492119 ATGTGTGAAGGCCCCAGCGGGGG + Intronic
1175863927 20:62164478-62164500 CCGCGTGGAGGCCAGTGCAGCGG - Intronic
1179177847 21:39021705-39021727 CCCTGTGGAGGGCTGAGCTGGGG + Intergenic
1183931383 22:41237915-41237937 CCGCGCGGAGGGCCGCGCGGAGG + Exonic
1184473648 22:44709494-44709516 CCTTCTGGAGGCTCGGGCGGGGG - Intronic
1185351820 22:50343488-50343510 CCGTGTGGAGGCCCGAGCGGAGG - Exonic
954152078 3:48662695-48662717 CCGGGAGGGGGCCCGAGCGGCGG - Exonic
954631611 3:52050762-52050784 CCCTGTGGAGAGCCGAGCAGGGG + Exonic
962919897 3:139941210-139941232 CCATGGGGAGGCCTGAGCTGGGG + Intronic
965534702 3:169812447-169812469 CTGAGTGGAGGCCCAAGCCGGGG + Exonic
968199381 3:196739745-196739767 CCATGGGCAGGCCCGCGCGGGGG - Intergenic
968701459 4:2059940-2059962 CCGCGTGGACGCCGGGGCGGGGG - Intronic
968760895 4:2442421-2442443 GGGCGTGGAGGCCCGAGGGGAGG + Intronic
976225019 4:82789074-82789096 CAGTGGGGAGGCCTGAGGGGAGG - Intronic
980930013 4:139176536-139176558 CCGCGGGGAGGCCAGGGCGGGGG - Intronic
984964549 4:185128626-185128648 CGGGGAGGAGGCGCGAGCGGAGG + Intergenic
992473217 5:77077626-77077648 CCGCGTGGAAGCCCGGGCCGCGG + Exonic
1002477335 5:179475415-179475437 CTGTGAGGAGGCCCCAGCCGAGG - Intergenic
1006910228 6:37558771-37558793 CGGTGTGCCGGCCCGAGCTGGGG - Intergenic
1007600122 6:43076234-43076256 CCGTGCGGGGGCCGGAGGGGAGG + Intergenic
1008777798 6:55062137-55062159 CCGTTTGGAGGCCCGAGGATAGG - Intergenic
1017455537 6:154597769-154597791 CCGTGTGTAGGACAGAGCAGGGG + Intergenic
1017877414 6:158536463-158536485 CCGTGAAGAGGCCTGAGTGGGGG - Exonic
1023686714 7:42743293-42743315 GCATGTGGAGGCCCCAGCTGAGG - Intergenic
1023845619 7:44118403-44118425 CCTTCTGAAGGCCCGAGGGGAGG - Intronic
1024963811 7:55004629-55004651 CCTGGTTGAGGCCCGCGCGGAGG + Intergenic
1032079965 7:128853900-128853922 CAGGGTGGAGGCCCGACAGGTGG - Intronic
1032262832 7:130350613-130350635 CCGTGCGGAGAGCCAAGCGGTGG - Intronic
1036731814 8:11272270-11272292 CCGTGTGAAGGCAAGAGCTGGGG - Intergenic
1036789684 8:11709338-11709360 CCCTGCGGAGGCCCGAGGGCGGG - Intronic
1037273672 8:17156335-17156357 CCGCGAGGTGGCCCGAGCGAGGG + Exonic
1040025163 8:42775122-42775144 CCCTGTGGAGGCTCTAGGGGAGG + Intronic
1047591464 8:126331559-126331581 CAGTGTGGAGGGCAGAGAGGAGG - Intergenic
1047951531 8:129939608-129939630 GCGCCTGGAGGCTCGAGCGGAGG - Exonic
1049755997 8:144311580-144311602 CCGAGTAGGGGCCCGAGCCGTGG - Exonic
1049766554 8:144357955-144357977 CCGAGCGGTGGCCCGGGCGGGGG - Intronic
1053877498 9:42558834-42558856 CAGTGTGGAGGCACAAGTGGTGG - Intergenic
1054234197 9:62542888-62542910 CAGTGTGGAGGCACAAGTGGTGG + Intergenic
1060824438 9:126679929-126679951 CCGGGTGGAGGGCAGAGTGGTGG - Intronic
1061095910 9:128456660-128456682 CCATGTGGAGGCCCGAGGAGAGG - Intronic
1185530480 X:814486-814508 CCTTCTGGAGGCCCCAGGGGAGG - Intergenic
1185530541 X:814825-814847 CCTTCTGGAGGCCCCAGGGGAGG - Intergenic
1185616854 X:1427244-1427266 CCTTCTGGAGGCCCCAGGGGAGG - Intronic
1185630516 X:1513403-1513425 CCCTGTGGAGGCTCTAGGGGAGG + Intronic
1185653566 X:1666728-1666750 CCCTGTGGAGGCTCTAGGGGAGG + Intergenic
1189037284 X:37505900-37505922 CCGCGTGGTGGCGCGAGCAGGGG - Intronic
1198270431 X:135051685-135051707 GCCTGTGGAGACCCTAGCGGTGG + Exonic
1198839045 X:140836541-140836563 ACGTGTGGAGGCCCCAGTAGTGG - Intergenic
1199979851 X:152914946-152914968 CCATGTGGAGGGCAGAGCGTGGG + Intronic