ID: 1185357430

View in Genome Browser
Species Human (GRCh38)
Location 22:50382301-50382323
Sequence CTGGATAAAAAAGTCAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 359}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185357427_1185357430 15 Left 1185357427 22:50382263-50382285 CCAAACAGCTTTAAAGTCAATAA 0: 1
1: 0
2: 0
3: 23
4: 241
Right 1185357430 22:50382301-50382323 CTGGATAAAAAAGTCAAACAGGG 0: 1
1: 0
2: 2
3: 28
4: 359
1185357426_1185357430 16 Left 1185357426 22:50382262-50382284 CCCAAACAGCTTTAAAGTCAATA 0: 1
1: 0
2: 0
3: 17
4: 274
Right 1185357430 22:50382301-50382323 CTGGATAAAAAAGTCAAACAGGG 0: 1
1: 0
2: 2
3: 28
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185357430 Original CRISPR CTGGATAAAAAAGTCAAACA GGG Intronic
902114924 1:14113548-14113570 CAGGATAATCAACTCAAACATGG - Intergenic
903807377 1:26015206-26015228 AGGGAGTAAAAAGTCAAACAAGG + Intergenic
904910519 1:33930978-33931000 CTAGATAAAACAGACACACACGG + Intronic
905088491 1:35406705-35406727 TAGGGTGAAAAAGTCAAACATGG + Intronic
907868965 1:58425770-58425792 CTGGTCAACACAGTCAAACATGG + Intronic
907977756 1:59448711-59448733 CTGGATGAAAAAGGCAGATATGG + Intronic
908366496 1:63429088-63429110 CTGGAAAGAAATGTAAAACATGG - Exonic
908873188 1:68638177-68638199 ATGGATTAAGAAGTCCAACAGGG - Intergenic
909369337 1:74865696-74865718 CTGGATAAAAAAGCAAGACCCGG - Intergenic
909585700 1:77285157-77285179 GGGGATAATAAAGTCACACAGGG + Intronic
909661072 1:78082909-78082931 CAGAACAAAAAACTCAAACATGG - Intronic
910483631 1:87685693-87685715 CTACATTAAAAAGTCAACCACGG + Intergenic
911752893 1:101518538-101518560 CTGTAAAAAAAAGACAAAGAAGG - Intergenic
911754957 1:101543467-101543489 AAGAATCAAAAAGTCAAACATGG + Intergenic
911948708 1:104144153-104144175 TTTGAGAAAAAAGTCAATCATGG + Intergenic
912148449 1:106823879-106823901 CTGGAAGAAAAAATAAAACAAGG - Intergenic
912448642 1:109756534-109756556 CTGGACAAAAAAACCTAACAGGG - Intronic
913386523 1:118263715-118263737 CTGGAGAGAAAATTCTAACAAGG + Intergenic
915384830 1:155480888-155480910 CTGGATTCAGAAGTCAAACTTGG + Exonic
916355722 1:163905070-163905092 CTTGATAACAAAACCAAACAAGG - Intergenic
916553275 1:165870816-165870838 CTCGAAAAAAAAGACTAACAAGG - Intronic
917784558 1:178439950-178439972 ATGGATAAATAAGAAAAACATGG - Intronic
919614596 1:199790056-199790078 GTGGATAAAAAATTAAAAAATGG - Intergenic
922145247 1:222937647-222937669 CTGGCTAAAAATGTAAAATAGGG + Intronic
924598439 1:245467036-245467058 CTAGATAATAAAGTCACTCAAGG + Intronic
1063949927 10:11212847-11212869 CTAGTTAGAAAAGACAAACATGG - Intronic
1064036061 10:11914281-11914303 CTGGCTAAAACAGTGAAACCCGG - Intergenic
1064773075 10:18745240-18745262 ATGGATCATAAAGTCAAACTAGG - Intergenic
1065298070 10:24295624-24295646 GTGGATAAAATGGTGAAACAGGG - Intronic
1065848384 10:29765397-29765419 TTGGAGAAAAAAATCCAACAGGG + Intergenic
1066028639 10:31393325-31393347 CTGGATAAAAAAGCAAAATCTGG - Intronic
1066140954 10:32503599-32503621 CCTGATAACAAAGTCAGACATGG - Intronic
1066670944 10:37838315-37838337 CTGGTGAAAACAGACAAACATGG + Intronic
1067720563 10:48724764-48724786 AAGGATGAAGAAGTCAAACAAGG + Intronic
1067758321 10:49023952-49023974 CTGGATATAAATGTAAAACTCGG - Intronic
1068554451 10:58443407-58443429 CTAGACAAAACAGTAAAACAAGG - Intergenic
1068613791 10:59089423-59089445 CTGGAGGAAAAAGTCACGCATGG + Intergenic
1068624406 10:59225570-59225592 CTGGAAGAAAAAGTCAGACCAGG + Intronic
1069129380 10:64680172-64680194 CTGTTTAAAAAAGACAAAGAGGG - Intergenic
1069408091 10:68123482-68123504 CTGGCTAAAAAGGTGAAACCCGG + Intronic
1070077229 10:73148848-73148870 ATGGCTAAATAATTCAAACAGGG + Intronic
1070359970 10:75678540-75678562 CTTCATAAAAAATGCAAACAAGG - Intronic
1071749631 10:88459971-88459993 CTGGAAAAAGAAGGCAAAAAGGG + Intronic
1072298244 10:94033722-94033744 CAGGATAAAAAAATCCAAGATGG - Intronic
1076076294 10:127536483-127536505 CTAAATAAAAAATTCAAAAATGG + Intergenic
1076854134 10:133107056-133107078 CTGGGAAAAAAATTCAACCAAGG - Intronic
1078717323 11:13852533-13852555 CTGGAGAACAAAGGCAAACAGGG - Intergenic
1079656341 11:22990533-22990555 CTGGATACAAAAGACAAGAAAGG + Intergenic
1079914777 11:26355309-26355331 CTGGATAAAGAATTCTAAGATGG + Intronic
1080149855 11:29038773-29038795 CTGGAAAAAAAAGTTTAAGATGG - Intergenic
1080413509 11:32048549-32048571 GTGGCTAAACAAATCAAACATGG - Intronic
1080769494 11:35327136-35327158 CTGGATTAAAAAGGAAAAAAAGG - Intronic
1081524158 11:43913002-43913024 ATGGTTCAAAAAGTCAACCATGG + Intronic
1081700972 11:45152462-45152484 CAAAATAAAAAAGTAAAACATGG - Intronic
1081938298 11:46919296-46919318 CAGGATCAGAAAGTCAAAGAAGG - Intergenic
1082061861 11:47867745-47867767 GGGGACAAAAAGGTCAAACAAGG + Intergenic
1082907869 11:58331443-58331465 CTGGATACTAAAACCAAACAAGG - Intergenic
1082930138 11:58594165-58594187 AGGCATAAAAAAGTCTAACAAGG - Intronic
1083767012 11:64846338-64846360 CTCTATAAAAAATACAAACATGG - Intergenic
1084869645 11:72089394-72089416 CTGCTTAAAAAAAACAAACAGGG - Intronic
1090349758 11:126100477-126100499 CAGGATAAAGCAGGCAAACATGG + Intergenic
1091084200 11:132704873-132704895 CTAAATAATAAAGTAAAACATGG + Intronic
1093947518 12:25126532-25126554 CTGGATATAAAAGTAAAGCAAGG + Intronic
1095070791 12:37842653-37842675 TTGGATAAAAAATACAAAGAAGG - Intergenic
1096947002 12:55418088-55418110 CAAGATAAAAAAGTAAAAGAAGG - Intergenic
1097042018 12:56161450-56161472 CTAGATACAAAATTCACACAGGG - Exonic
1097650243 12:62289065-62289087 CCGGATACCAAAGCCAAACAAGG - Intronic
1097918994 12:65051553-65051575 CTGGATTGAAAAGGCAAAAATGG - Intronic
1099060131 12:77897619-77897641 ATGGAGAAATAAGTCAAAGAGGG - Intronic
1099174122 12:79401125-79401147 TAGAATAAAAATGTCAAACAAGG + Intronic
1099472373 12:83067155-83067177 CTGTAAAAAAAAGAAAAACAAGG + Intronic
1099709301 12:86200669-86200691 ATACATAAAAAAGTCAAACCTGG - Intronic
1099768237 12:87018707-87018729 CTGCATTAAAAAATCAAATAAGG + Intergenic
1100203386 12:92323477-92323499 GTGGTTAAAAAAGACAAAGAGGG - Intergenic
1101471639 12:105002339-105002361 CTGAATAAAAAACACAAACCAGG - Intronic
1101760203 12:107652089-107652111 CTTGTTAGAAAAGCCAAACAGGG - Intronic
1102611681 12:114117856-114117878 CTGACCAATAAAGTCAAACAGGG + Intergenic
1103418564 12:120761372-120761394 CTGGATTAAAAAGTCTTACCTGG + Intergenic
1104432821 12:128730570-128730592 CTGTATTAAAAAGTAAAAAAGGG + Intergenic
1104627563 12:130371172-130371194 CACGATAAAAAAGTCATACCTGG - Exonic
1106635724 13:31526543-31526565 CTGGAAAGAAAAGTTGAACAAGG + Intergenic
1106854810 13:33839331-33839353 CTGGATAAAAATGGCAGACTTGG - Intronic
1108370076 13:49760485-49760507 GTGCATAAAAAAGACAAAGATGG + Intronic
1110053264 13:70932561-70932583 TGGGAGAAAAAAGTCAAATAAGG + Intergenic
1110085607 13:71375308-71375330 CTAGAGAAGAAAGTAAAACAAGG + Intergenic
1110159061 13:72353361-72353383 CTGGAAAAAAAAAAAAAACAAGG - Intergenic
1111137133 13:84062599-84062621 CTGGATATGAAATGCAAACAAGG - Intergenic
1112360248 13:98710842-98710864 CTGTATGAAGAACTCAAACAGGG - Intronic
1113038071 13:106073086-106073108 CTACATAGAAAAGTCAATCAAGG - Intergenic
1113164702 13:107426233-107426255 CTTGATTCAAAAGTCAAAGAAGG - Intronic
1113309362 13:109115679-109115701 CAGGAAAAAAAAATCAAAAATGG + Intronic
1113974821 13:114219727-114219749 CTGGACAAAAACGGGAAACATGG + Intergenic
1114261661 14:21041293-21041315 CTGAACAAAAAAGGCAAAAATGG - Intronic
1117295013 14:54371096-54371118 CTAGATAGAAAAGTCAGAGAAGG - Intergenic
1117459260 14:55928215-55928237 GGGGATAAAAAAGTGTAACATGG + Intergenic
1118172049 14:63396866-63396888 CATGATAAACAAGTCAGACAAGG + Intronic
1119043165 14:71293818-71293840 CTGGAAAAAAATTTAAAACATGG - Intergenic
1119116665 14:72028352-72028374 CAGGAAATAAAAGACAAACAAGG + Intronic
1119152157 14:72371329-72371351 CAGGAGAAAAAAATCAAACAAGG - Intronic
1119978510 14:79053111-79053133 ATGGATGAAGAAGACAAACAAGG + Intronic
1120490293 14:85170053-85170075 CTGGAAAAAATGGTCAAGCATGG + Intergenic
1120633357 14:86919828-86919850 CTGGCTATAAAAGGGAAACAAGG - Intronic
1121400577 14:93673626-93673648 CTGGCTAAAAAAGTCCAAGAAGG + Intronic
1126606635 15:50484387-50484409 CTGGAAAAAAAAGCCAAACATGG + Intronic
1126905275 15:53358524-53358546 CTGGAGAATAAAGCCAAAAAGGG - Intergenic
1129009783 15:72405098-72405120 CTGGAGAACAAAATGAAACAAGG + Intronic
1131762002 15:95634606-95634628 CTGGATAAAAATGCGAAGCAAGG - Intergenic
1131888316 15:96944503-96944525 CTGGTTGAAACAGTAAAACATGG + Intergenic
1133085959 16:3363852-3363874 CTGGACAAAACACACAAACAAGG + Intergenic
1135353985 16:21754354-21754376 CTGGATAAAACACACAAACCAGG + Intronic
1135452474 16:22570493-22570515 CTGGATAAAACACACAAACCAGG + Intergenic
1137591823 16:49698468-49698490 CTGGCAAAGAAAGTTAAACACGG - Intronic
1137782831 16:51112375-51112397 ATGGTTAAAAAAATAAAACAAGG - Intergenic
1138840310 16:60494232-60494254 TTGAATATAAAATTCAAACATGG + Intergenic
1138880110 16:61002981-61003003 ATGGAGAAAAAAGTCTAACTTGG - Intergenic
1140109071 16:71987673-71987695 CTGTCTAAAAAAGTGAAAAAAGG - Intronic
1143603321 17:7964176-7964198 CAGGATAAAAAAGGGATACATGG - Intergenic
1144423690 17:15121140-15121162 CTGTATCAAAATGTCAACCATGG - Intergenic
1144693525 17:17285408-17285430 CTGTATAAAAAAACAAAACAAGG - Intergenic
1145095232 17:20019674-20019696 CTGAATAAAAAATCCACACATGG + Intronic
1145360318 17:22206734-22206756 CTGAAAAAAAAAATTAAACAGGG - Intergenic
1146423461 17:32712196-32712218 CTGGATGAAAAAAAGAAACAGGG + Intronic
1146618759 17:34379282-34379304 TTGGAAAAAAAAATCAAAAAAGG - Intergenic
1149053098 17:52329976-52329998 CTTGATAAAAGAATCTAACATGG + Intergenic
1149735244 17:58987786-58987808 CTAGATAAAAAAATTAAAAATGG + Intronic
1150026308 17:61677992-61678014 CAGGAAAAAAAAGAAAAACAGGG + Intergenic
1150498490 17:65627716-65627738 CTGGAATTAAAAGGCAAACAAGG - Intronic
1151221017 17:72613240-72613262 CTGGAGTCAAAAGTCACACAGGG - Intergenic
1155333505 18:24741567-24741589 CTGTATACAAAAGGCAAGCATGG + Intergenic
1156074158 18:33252359-33252381 TTGGAAAAAAAAGTCTAAAATGG + Intronic
1156223603 18:35079723-35079745 CTGGATACAGAAATCTAACAGGG - Intronic
1156563573 18:38157795-38157817 ATGGATAACAAACTTAAACATGG - Intergenic
1157237586 18:45979005-45979027 CAGGAAAAAAAAGTCTAAAAAGG - Intergenic
1157387900 18:47274982-47275004 TTTGAAAAAAAAGACAAACATGG + Intergenic
1159253448 18:65912545-65912567 CTTTATATGAAAGTCAAACAAGG - Intergenic
1159313208 18:66737101-66737123 CTGGCTAACAAAGTGAAACCCGG - Intergenic
1159374894 18:67580508-67580530 ATGAATAAAAGAATCAAACAGGG + Intergenic
1160545541 18:79650854-79650876 CTGCATAAAATAGGCCAACAGGG - Intergenic
1161045199 19:2130805-2130827 CTGGAGAGGAAAGTCACACAGGG + Intronic
1162244072 19:9384205-9384227 CAGGATAACAAACTCAGACAAGG + Intergenic
1164913734 19:32032946-32032968 TTGGGTAAAAAAGTTAAAAATGG - Intergenic
1165025792 19:32960507-32960529 CTGCCTAAAAAAGTAAAACAAGG + Intronic
1165180603 19:33964121-33964143 ATGGATAAAGATGTCCAACAAGG + Intergenic
1165698992 19:37922826-37922848 CAAGATAAAGAAGTAAAACACGG + Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
1168451892 19:56473038-56473060 CTGGATTAAAGAGTACAACAGGG - Intronic
925127256 2:1467943-1467965 GTGGTTAAAAAAGACAAAGAGGG - Intronic
926047908 2:9723631-9723653 GTGGATTAAAAAGTCAATGAAGG - Intergenic
926600387 2:14837402-14837424 CTGGATAGCAAAATCAGACAAGG - Intergenic
927280976 2:21306127-21306149 CTGGATAATAAAGTGAACCTGGG + Intergenic
927344883 2:22026617-22026639 CAGGTCAAAAAAGTCAAAAATGG - Intergenic
927475696 2:23412688-23412710 CTGGACAAAAAAGTTCCACAGGG + Intronic
928163101 2:28947668-28947690 TTGGAAAAAAAATTCCAACAAGG - Exonic
928289431 2:30024642-30024664 CGGAATAAATAAGTCAAACCTGG + Intergenic
928812837 2:35249712-35249734 CTGGATAACAAAAGGAAACATGG - Intergenic
930222691 2:48761186-48761208 TGGGTTAAAAAAGTTAAACAAGG + Intronic
930495100 2:52131429-52131451 CTACAGAAAAAAGTCAAACTGGG + Intergenic
930647312 2:53925124-53925146 CTGTTTAAAAATGTCAAAAATGG - Intronic
930883662 2:56299857-56299879 CTGTATGAAAAAGTCTGACATGG + Intronic
932029373 2:68167617-68167639 CTGGAAAAAAATGTCACAAAGGG - Intronic
932997684 2:76876486-76876508 TTGGATAAAAATGTAAAAAAAGG + Intronic
933818689 2:86090091-86090113 CTGTTGAAAAAAATCAAACAAGG + Intronic
934528578 2:95069623-95069645 CTGGAGGAAGAAGTCAAGCAAGG + Intergenic
936469305 2:112784632-112784654 CTGGCTAAAATAGTGAAAGATGG + Intergenic
936639640 2:114297737-114297759 AAGGATAAAAAAGGGAAACAGGG + Intergenic
936750606 2:115636802-115636824 GTGGATAAATAACTTAAACAGGG + Intronic
937390012 2:121477334-121477356 TTGGATAATAAATTCAAACAAGG + Intronic
937561769 2:123232487-123232509 CCCGATAACAAAATCAAACAAGG - Intergenic
938362922 2:130706321-130706343 CTGGGTAAAAAAATTAAACTTGG - Intergenic
938736382 2:134190311-134190333 CTTGCTACAAAAATCAAACATGG - Intronic
938963853 2:136368517-136368539 CTTGATACAAAAGCCAAACAAGG + Intergenic
938990006 2:136618065-136618087 CTGGAGAAAATACCCAAACAAGG + Intergenic
939519304 2:143209590-143209612 CTGGATTAAGTAGTCACACATGG + Intronic
939834757 2:147115294-147115316 CTGGATAAAATACTCAAAATAGG - Intergenic
940837539 2:158540309-158540331 CTGGATCACACATTCAAACATGG + Intronic
943218691 2:185075547-185075569 CTGTTTAAGAAAGTCAAACAGGG + Intergenic
944171686 2:196786403-196786425 CTTGGTAAAAATGTCAAGCAAGG - Intronic
944294894 2:198050871-198050893 CTGGATAACAAATTCAATCCAGG - Intronic
944565456 2:200985693-200985715 CTGGATTAAAAGGTAAAATAAGG + Intronic
946799999 2:223404387-223404409 CTGGATTAGAAGGACAAACAGGG + Intergenic
947725588 2:232397633-232397655 CTGCATAAAAAATAAAAACATGG - Intergenic
948536072 2:238648436-238648458 TTGGTTTAAAAACTCAAACAAGG + Intergenic
948536137 2:238649094-238649116 TTGGTTTAAAAAGTCAAACAAGG + Intergenic
1170991979 20:21311049-21311071 CTGTATAAAAAAGCCAGACCCGG - Intronic
1171378448 20:24712907-24712929 GTGGTTAAAAAAGACAAAGAAGG - Intergenic
1172176431 20:32975067-32975089 GTGTATAGAGAAGTCAAACATGG + Intergenic
1172405210 20:34683458-34683480 CTCTATAAAAAAGTAAAACATGG + Intergenic
1172801747 20:37580974-37580996 CTGGACACAAAAGCCACACAAGG - Intergenic
1172948953 20:38709868-38709890 CTGGATACAAAAGGCAAAGGAGG + Intergenic
1173571186 20:44077357-44077379 CTGCCTTAAAAAGTCAAACCAGG + Intergenic
1175127523 20:56763553-56763575 CTAGTTAGAAAAGACAAACATGG + Intergenic
1175366370 20:58459070-58459092 CTGGTTATTAAAGTCAACCAAGG - Intergenic
1176920578 21:14683376-14683398 CTTGGTAAAACAGCCAAACAGGG - Intergenic
1178871941 21:36384707-36384729 CTGGATAAAAGAAACACACAGGG - Intronic
1179023388 21:37659171-37659193 CTGGAAAAAAAAGAAAAACAGGG - Intronic
1179194074 21:39149328-39149350 CTTGATAACAAAGTCAGACAAGG - Intergenic
1183042017 22:35188653-35188675 GTGGAGAAAAAAGTGAAATAAGG + Intergenic
1183231124 22:36582758-36582780 ATGGGGAAAAAAGTCAAGCAGGG - Intronic
1183888476 22:40905270-40905292 CTGGCTAACACAGTGAAACACGG - Intronic
1185357430 22:50382301-50382323 CTGGATAAAAAAGTCAAACAGGG + Intronic
949550305 3:5107081-5107103 CTCTACAAAAAAGTCAAAAAAGG + Intergenic
950060452 3:10067137-10067159 CTGGATAAATAATATAAACAAGG + Intronic
950301863 3:11886702-11886724 CTGGATAAATAATACAAACAAGG + Intergenic
951378531 3:21953986-21954008 CTGGACAAAAGAGAAAAACAAGG + Intronic
951629583 3:24705081-24705103 CTGGAAAAATCAGTCAAAAAAGG - Intergenic
953534368 3:43766068-43766090 CTGGACAACAAAGTCAGGCATGG - Intergenic
954056344 3:48028974-48028996 CTCGATAAAAAATACAAAAAAGG + Intronic
954486950 3:50861680-50861702 CAGGAAAAAAAAGACAAAGAAGG - Intronic
955059976 3:55485799-55485821 AGGGATTAGAAAGTCAAACAGGG + Intronic
955670847 3:61401078-61401100 AAGGAAAAAAAAGTGAAACACGG - Intergenic
957489987 3:80911144-80911166 CTGGAGAAAAAAGACAACAAAGG + Intergenic
957593580 3:82231699-82231721 CTGCAGCAGAAAGTCAAACATGG - Intergenic
959349652 3:105245836-105245858 CTGGAAAAAAAAGTGAACAAAGG + Intergenic
959675962 3:109036532-109036554 TTGGACAAAACAGTCAAACATGG - Intronic
960516741 3:118610204-118610226 GTGGTTAAAAAAGACAAAGAGGG + Intergenic
962442314 3:135432934-135432956 CTTGATAACAAAGTCAGACAAGG + Intergenic
963569914 3:146980624-146980646 CTGGGGAAAAAAGTCAACCATGG + Intergenic
964467667 3:157015066-157015088 CTGGAAACAGAAGTCAAACAAGG + Intronic
965444659 3:168759966-168759988 CCTGATAGAAAAGTCAGACAAGG - Intergenic
966399469 3:179534113-179534135 CTGGAAAGAAAATTAAAACAAGG + Intergenic
967741374 3:193006492-193006514 GTGGTTAAAAGAGACAAACAGGG - Intergenic
968253194 3:197242181-197242203 CTGTAAAAAAAAGACAAAGAAGG + Intronic
969856618 4:10004964-10004986 CTGAATGAAAAAGTAAAACAAGG - Intronic
970234809 4:13947794-13947816 CTGGATAAATAAGCTGAACATGG - Intergenic
970658419 4:18258283-18258305 GTGGTTAAAAAAGACAAAGAGGG - Intergenic
970760626 4:19481423-19481445 CTGCAGACAAATGTCAAACATGG + Intergenic
972000005 4:34019438-34019460 CTGGCTAACACAGTGAAACACGG - Intergenic
972118510 4:35669416-35669438 CTGCTTAAAAAAGGCAAACCTGG + Intergenic
972192078 4:36606209-36606231 TTGGATAAAAAAGACTAATAAGG + Intergenic
972638209 4:40902948-40902970 CTGGGTAACAAAGTGAGACATGG + Intronic
972728062 4:41763826-41763848 CTACATTAAAGAGTCAAACAGGG + Intergenic
973076721 4:45937403-45937425 CTGGTTAAAGAAGTTAAACCTGG - Intergenic
973287332 4:48433081-48433103 CATGATAAAGAATTCAAACAGGG - Intergenic
974760452 4:66266978-66267000 CTGGATGAGACAGTCCAACAGGG + Intergenic
975088157 4:70367832-70367854 CTGAAGAAAAAAGTCAAACATGG - Intergenic
975681457 4:76880582-76880604 TTTAATAAAAAAGTGAAACAGGG - Intergenic
975946395 4:79710668-79710690 ATGGATAATAAATTGAAACATGG - Intergenic
976329371 4:83811744-83811766 TTGGATAAAAAACTCAACCCTGG + Intergenic
976422228 4:84859027-84859049 CAGGATAAAAAAGACAGACAGGG + Intronic
977763923 4:100775469-100775491 CTAGAGAAAAAGGTCACACAAGG - Intronic
977935418 4:102797333-102797355 CCGGATAAGAAAATCAAAAAAGG + Intronic
978280235 4:107003273-107003295 CTGGGTAAAAGAGTGAAAGACGG - Intronic
978313495 4:107411637-107411659 CAAGATAAAAAAGACAAAGAAGG + Intergenic
978870535 4:113571571-113571593 CAGTTTAAAAAAGTCAAACTCGG + Intronic
978903329 4:113979147-113979169 CTGGAGAAAAAAACCAAGCAAGG + Exonic
979114810 4:116810023-116810045 ATAGATAAAGAAGTCCAACATGG + Intergenic
979355073 4:119693785-119693807 CTGAATAAAAAACTAAAACTTGG - Intergenic
980248277 4:130276809-130276831 CTGAAAAAATAAGTCAAGCATGG - Intergenic
982092565 4:151893011-151893033 CTGAAGAAAAAAGAGAAACAGGG + Intergenic
982832164 4:160076041-160076063 CTGGATAAAGGAGTCAACAAAGG + Intergenic
982929651 4:161388030-161388052 AGTGATAAAAAAGTGAAACAGGG + Intronic
983617677 4:169725793-169725815 CTGGAGAAAAAACACAACCATGG - Intergenic
984463648 4:180069903-180069925 CTGGATTTAAAACACAAACAAGG - Intergenic
984463678 4:180070319-180070341 CTGGAAAAAAAAGAAAAAGAGGG - Intergenic
984492256 4:180449763-180449785 GTGGATAAATAAGTGAAACTTGG - Intergenic
984511839 4:180688446-180688468 CAGGATAAAATTTTCAAACATGG + Intergenic
984926990 4:184815589-184815611 CTGGATAAGAAGGTTAAAAAGGG + Intronic
985249414 4:188008329-188008351 CTGGAAAAATAAACCAAACATGG - Intergenic
986404510 5:7412297-7412319 CTGGAAAAAAAAGTCATACTAGG + Intronic
986568469 5:9139684-9139706 CAAGAAAAAAATGTCAAACAGGG - Intronic
986970228 5:13326020-13326042 CTGGAATAACAAGTCAAACATGG + Intergenic
987828119 5:23060249-23060271 CTGGAGAAAAATCTCAAAAACGG - Intergenic
988232600 5:28500176-28500198 ATGGAGAAAAAAATAAAACAGGG - Intergenic
988986680 5:36626289-36626311 CTAGAAGCAAAAGTCAAACAAGG - Intronic
989713668 5:44432513-44432535 CTGCCTATAAAAGTCATACATGG + Intergenic
989818826 5:45769004-45769026 CAGGATAAAGAAGTCCATCATGG + Intergenic
990255265 5:53961869-53961891 CAGGATAAAATAGTCAAAAAAGG - Intronic
990787256 5:59435664-59435686 CTGGATTACAAGGTCAAAGAAGG - Intronic
991260207 5:64659228-64659250 CTGGATAAAAGGTACAAACAAGG - Intergenic
992178391 5:74173101-74173123 ATGGAGAAAAGAGTCACACAAGG + Intergenic
992461566 5:76965572-76965594 CTGGGTTAAAAAGTAAGACAAGG + Intronic
993594000 5:89829938-89829960 CTGGATTGAAAAGCCAAATAAGG - Intergenic
994242024 5:97434430-97434452 CCTAATACAAAAGTCAAACATGG + Intergenic
995877957 5:116810991-116811013 CTGATTAAAAAAGTCAAAAGGGG + Intergenic
995980508 5:118097164-118097186 CTGGATCAAAAATTCAGGCATGG - Intergenic
997042260 5:130271428-130271450 TTGGAAAAAAAATTGAAACAAGG + Intergenic
998177350 5:139910043-139910065 CTGGATAAAAAGGGCAAGCTTGG + Intronic
998475788 5:142420416-142420438 CTAGAAAAAAAAAACAAACAGGG - Intergenic
998997718 5:147883932-147883954 CTTCCTAAAGAAGTCAAACATGG - Intronic
999487576 5:152013884-152013906 CTGGATAAAAAAGCAAGACCTGG - Intergenic
1000883469 5:166723371-166723393 AAGGAAAAAAAAGTCAAAAAGGG + Intergenic
1000957163 5:167557155-167557177 CTTGATAAGAAATTCAAATATGG - Intronic
1001214777 5:169845425-169845447 GAGGATAAAAGAGTAAAACAGGG - Intronic
1001219798 5:169890782-169890804 TTGTGCAAAAAAGTCAAACATGG - Intronic
1003600367 6:7511362-7511384 TTGGATGAGAAAGTGAAACATGG + Intergenic
1004871754 6:19912294-19912316 CTGAATACCAAAGTCAAACCAGG - Intergenic
1006883114 6:37356452-37356474 GTGGATAAAATAATAAAACAGGG + Intronic
1007456530 6:41981967-41981989 CTCTTTAAAAAAGTCAATCATGG + Intronic
1007892441 6:45307643-45307665 GTAGATAAAAAAGACAAAGATGG + Intronic
1008289244 6:49693462-49693484 GTGGATAAAAGTGTAAAACAAGG + Intronic
1009538488 6:64922896-64922918 CTGGATAAAGAATTCAAAGTAGG - Intronic
1011206198 6:84901887-84901909 CAGGATAAAAAAGGGAGACAGGG - Intergenic
1011922504 6:92597621-92597643 CTAGAAAAAAAAGTGAAATAAGG + Intergenic
1012339874 6:98107368-98107390 CTTAATAAAAAAGAAAAACAAGG + Intergenic
1012480278 6:99659623-99659645 GTGGACAAAAGAGTAAAACAAGG + Intergenic
1013016625 6:106165709-106165731 ATGGATGAAAAATTCAAAAATGG + Intergenic
1013108838 6:107048973-107048995 CTGGATATAAAACTCACAGAGGG - Intronic
1013192347 6:107814249-107814271 ATGGATAAAAAAGTTAACCGTGG + Intronic
1013587951 6:111596146-111596168 CTGGATAAGAAGGTAAAGCAGGG - Intronic
1014523808 6:122477513-122477535 CTGGAAAATAAAGTCAAATCTGG - Intronic
1016583751 6:145660453-145660475 TTGGAGTAAAAAGTTAAACAAGG - Intronic
1017357270 6:153524364-153524386 CTATCTAAAAAAGTCAAACAGGG + Intergenic
1017516626 6:155161876-155161898 GTGGATTAAAAAGACAAAAAAGG - Intronic
1017631771 6:156402956-156402978 CAGGAAAAAAAAGGCCAACAGGG - Intergenic
1018663343 6:166109914-166109936 TTGGACAAAAAAGCCAAAGAAGG - Intergenic
1018787517 6:167119755-167119777 CTTCATAAAAAAGTTAAAAAAGG - Intergenic
1021295297 7:18898048-18898070 CTGGACCATAAAGTCATACATGG + Intronic
1022607134 7:31826485-31826507 CAGGAAAAAAAAGGCAAAAATGG - Intronic
1022891147 7:34701018-34701040 CTGAATAAAAGAGCAAAACAAGG - Intronic
1023739885 7:43269930-43269952 CTGGCTCAAAATGTAAAACAAGG + Intronic
1025711438 7:63914009-63914031 CTGGAAAAAAAAAAAAAACAAGG - Intergenic
1026015677 7:66669116-66669138 CTGGAAAACCAAGTCACACAAGG - Intronic
1028221775 7:88205260-88205282 CTTGATAAAAAAGGCAAACCAGG + Exonic
1028307768 7:89287674-89287696 CTAGATAAAACAGTCAGACTAGG + Intronic
1028982121 7:96978922-96978944 CTTGAGAAGAAAGTAAAACAAGG - Intergenic
1030500568 7:110354531-110354553 AAAGATAAAAAAGTCAAAGAAGG - Intergenic
1030747045 7:113179150-113179172 CTGGATAAATAAGCCAGAAAGGG - Intergenic
1031752397 7:125592764-125592786 CTGAATAATAAAATCAATCAAGG + Intergenic
1032896190 7:136253248-136253270 GTGGTTAAAAAAGACAAAGAGGG + Intergenic
1034069197 7:148166131-148166153 ATGGAGAAAAAAGTCAAGCAGGG - Intronic
1034247625 7:149660400-149660422 ATGGTTAAAAAAGACAAAGAAGG - Intergenic
1034355850 7:150450353-150450375 CTTCATAAGGAAGTCAAACACGG - Intergenic
1034954544 7:155326539-155326561 TTGGATAAATCTGTCAAACAGGG + Intergenic
1035973305 8:4277509-4277531 CTAGATATAAAAGAAAAACATGG - Intronic
1036450783 8:8865407-8865429 CTGGATACAAAAATCAGAAATGG + Intronic
1036927821 8:12924365-12924387 ATAGATAAAAATGTTAAACAAGG - Intergenic
1036955817 8:13187142-13187164 ATGGAAAAAAAAGTAAAGCAGGG - Intronic
1039280339 8:35977523-35977545 CTGGGTAAAAAATGTAAACATGG + Intergenic
1040960632 8:53028333-53028355 CTGGCTATAAATGACAAACACGG + Intergenic
1041193874 8:55380870-55380892 TTTGATAAAAGAGTCAAACTAGG + Intronic
1042791957 8:72617705-72617727 CTGGATGAGTAAGACAAACAGGG - Intronic
1043153577 8:76748820-76748842 GTGGATAAAAATGTTCAACATGG - Intronic
1043384586 8:79735633-79735655 GTGAAAAAAAAAGTCAAAGAAGG + Intergenic
1043436412 8:80240008-80240030 CTGGTCAAAAAAGTCAAAAGTGG - Intergenic
1044374315 8:91451324-91451346 CTGGAACTTAAAGTCAAACATGG - Intergenic
1044467119 8:92520438-92520460 CTGGATAGAAAATTTAGACAGGG - Intergenic
1044688352 8:94850820-94850842 ATGGAAAAAAAAATCAAACAAGG - Intronic
1046040795 8:108901586-108901608 CTAGAAAAAAAAGGCAAACTAGG + Intergenic
1046049629 8:109007637-109007659 CTGGATCAAAAATTAAAATAGGG - Intergenic
1046062871 8:109159839-109159861 CTGGATAGAAAAGGCAAGTAAGG - Intergenic
1046902060 8:119534371-119534393 CGTGAAAAAAAAGGCAAACAAGG + Intergenic
1047375687 8:124294046-124294068 GGGGAAATAAAAGTCAAACACGG - Intergenic
1047886122 8:129251808-129251830 TTGGAGAAAAAAGTCAAAAGAGG + Intergenic
1048480207 8:134783113-134783135 CTGGAGAAAAAAGTAACAGAAGG - Intergenic
1048730959 8:137440598-137440620 CTGGATGAAACAGTGAAAAAAGG - Intergenic
1049938567 9:523109-523131 CTGGAGAAAAAAGTCAGAGCTGG - Intronic
1050615663 9:7399291-7399313 GTGCAGAAAATAGTCAAACAAGG - Intergenic
1051560401 9:18435043-18435065 ATGCATAAAAGAGTCAAAGAGGG + Intergenic
1052099315 9:24424853-24424875 TTGGATAAAAATGTCAAGAATGG - Intergenic
1052144600 9:25033105-25033127 CAGGATAAAAATGTAAAACTTGG + Intergenic
1052810453 9:33053980-33054002 CTGGATATCAAAACCAAACAGGG + Intronic
1053281752 9:36825009-36825031 CCAGTTAAAAAATTCAAACAGGG - Intergenic
1054896233 9:70314626-70314648 ATGGATAAGAAACTCGAACACGG - Intronic
1055244766 9:74226387-74226409 ATGGTTAAAAAAGACAAAGAGGG + Intergenic
1055492168 9:76816449-76816471 CAGGATAAAAGAGTGAAACATGG - Intronic
1055905591 9:81290516-81290538 GTGGATAAAAGAGACAAAGAGGG - Intergenic
1056025732 9:82493000-82493022 CTGGATATAAAAGTGAAAATAGG + Intergenic
1056551515 9:87656877-87656899 ATGGACAAAAATGTTAAACAGGG + Intronic
1056935272 9:90911408-90911430 CTGGATAAAAAAGAAGAAAAGGG - Intergenic
1057712542 9:97460201-97460223 CTGGATAAAGAAGTAAATCTTGG - Exonic
1058061297 9:100499398-100499420 TTGTCTAAAAAAGTAAAACAAGG + Intronic
1058189567 9:101896411-101896433 ATGGATAAAAAAGTCACGTAAGG + Intergenic
1058215934 9:102233526-102233548 TGGGATAAAAAAACCAAACATGG + Intergenic
1058712854 9:107696085-107696107 ATGGATAGAAAATTCAGACAAGG - Intergenic
1059376159 9:113883238-113883260 CTGGAATAATAAGTCCAACAGGG + Intronic
1061546448 9:131307628-131307650 CTGTATGAAAAAATTAAACAAGG + Intronic
1185974342 X:4702658-4702680 CTGGACAATCATGTCAAACAGGG - Intergenic
1185984004 X:4810450-4810472 ATGGCTAAATAAGGCAAACACGG - Intergenic
1186089508 X:6029433-6029455 CTGGAAAAAAAAGCCAAGTAAGG + Intronic
1189715759 X:43864480-43864502 CTGGAAAATAATGTGAAACAAGG - Intronic
1190449147 X:50560110-50560132 GTGGTTAAAAGAGACAAACAGGG + Intergenic
1191265100 X:58380913-58380935 CAGGATAAAAAAGACAAGGACGG - Intergenic
1191982230 X:66938975-66938997 ATGGATAAAGAAGACAAACATGG + Intergenic
1193103867 X:77646148-77646170 CTGGATCAAAAAGACATAGATGG + Intronic
1193237029 X:79119963-79119985 CTTGATACCAAAATCAAACAAGG - Intergenic
1194381343 X:93195173-93195195 CTGCATCAAAAAGTCTAAAAGGG + Intergenic
1196153084 X:112395848-112395870 CCCAATACAAAAGTCAAACATGG + Intergenic
1196288424 X:113910659-113910681 CTGAGTTAAAAAGTTAAACAAGG - Intergenic
1196368718 X:114951844-114951866 CTGGATATAATATTCAAACCAGG - Intergenic
1197019776 X:121672977-121672999 CTGAATAAAAAAGGAAAAAAAGG - Intergenic
1197797503 X:130313473-130313495 CTAGGTAAAGAAGTCACACACGG - Intergenic
1197841602 X:130753635-130753657 CTGGAAATAAAAGTCAGGCATGG - Intronic
1198222790 X:134618106-134618128 CTGGGTTTAATAGTCAAACATGG + Intronic
1198541904 X:137648814-137648836 CTGCATTCAAAAGTCAAACTCGG - Intergenic
1199530699 X:148844285-148844307 CTGTATATTAAAGACAAACAAGG + Intronic
1200316749 X:155141384-155141406 CTGGATAAAAGTGTCATAGAAGG + Intronic
1200798751 Y:7365735-7365757 CTGGGCAACAAAGTCAAACTTGG - Intergenic
1202259234 Y:22952410-22952432 CTTCATAAAAAAATCAAAAAAGG + Intergenic
1202412220 Y:24586154-24586176 CTTCATAAAAAAATCAAAAAAGG + Intergenic
1202458560 Y:25083914-25083936 CTTCATAAAAAAATCAAAAAAGG - Intergenic