ID: 1185357730

View in Genome Browser
Species Human (GRCh38)
Location 22:50384637-50384659
Sequence CAGTGTCCCCAGCAGCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1478
Summary {0: 2, 1: 4, 2: 100, 3: 310, 4: 1062}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185357730_1185357741 16 Left 1185357730 22:50384637-50384659 CCTTCTTGCTGCTGGGGACACTG 0: 2
1: 4
2: 100
3: 310
4: 1062
Right 1185357741 22:50384676-50384698 CGTGGGACATCACGTGGCAAGGG 0: 1
1: 0
2: 1
3: 4
4: 82
1185357730_1185357736 -1 Left 1185357730 22:50384637-50384659 CCTTCTTGCTGCTGGGGACACTG 0: 2
1: 4
2: 100
3: 310
4: 1062
Right 1185357736 22:50384659-50384681 GTGGTGGCCCAAGGTGGCGTGGG 0: 1
1: 0
2: 1
3: 18
4: 202
1185357730_1185357739 10 Left 1185357730 22:50384637-50384659 CCTTCTTGCTGCTGGGGACACTG 0: 2
1: 4
2: 100
3: 310
4: 1062
Right 1185357739 22:50384670-50384692 AGGTGGCGTGGGACATCACGTGG 0: 1
1: 0
2: 2
3: 3
4: 106
1185357730_1185357734 -7 Left 1185357730 22:50384637-50384659 CCTTCTTGCTGCTGGGGACACTG 0: 2
1: 4
2: 100
3: 310
4: 1062
Right 1185357734 22:50384653-50384675 GACACTGTGGTGGCCCAAGGTGG 0: 1
1: 1
2: 3
3: 32
4: 595
1185357730_1185357740 15 Left 1185357730 22:50384637-50384659 CCTTCTTGCTGCTGGGGACACTG 0: 2
1: 4
2: 100
3: 310
4: 1062
Right 1185357740 22:50384675-50384697 GCGTGGGACATCACGTGGCAAGG 0: 1
1: 0
2: 0
3: 8
4: 60
1185357730_1185357733 -10 Left 1185357730 22:50384637-50384659 CCTTCTTGCTGCTGGGGACACTG 0: 2
1: 4
2: 100
3: 310
4: 1062
Right 1185357733 22:50384650-50384672 GGGGACACTGTGGTGGCCCAAGG No data
1185357730_1185357735 -2 Left 1185357730 22:50384637-50384659 CCTTCTTGCTGCTGGGGACACTG 0: 2
1: 4
2: 100
3: 310
4: 1062
Right 1185357735 22:50384658-50384680 TGTGGTGGCCCAAGGTGGCGTGG 0: 1
1: 0
2: 4
3: 19
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185357730 Original CRISPR CAGTGTCCCCAGCAGCAAGA AGG (reversed) Intronic
900000357 1:11410-11432 CAGTGTCCCCAGCTGCCAGCAGG - Intergenic
900020071 1:181929-181951 CAGTGTCCCCAGCTGCCAGCAGG - Intergenic
901054936 1:6444685-6444707 GAGTGTGCCCAGGAGGAAGACGG + Intronic
901232703 1:7650073-7650095 CAGTCTTACCAGGAGCAAGATGG + Intronic
901627277 1:10631409-10631431 CTGTGTTCCCAGCATTAAGAAGG - Intergenic
901649812 1:10737103-10737125 CTGTGGCCCCAGCAGCTGGATGG - Intronic
901882076 1:12199804-12199826 AAGTGTCCCAGGCAGAAAGAAGG - Intronic
902376384 1:16031992-16032014 CAGTTTCCTCATCAGCAAAATGG + Intronic
902479419 1:16703918-16703940 GAGTGTGCCCAGGAGGAAGAGGG - Intergenic
902535007 1:17114468-17114490 CAGTTTCCCCAGCTGCGAAAAGG + Intronic
902539126 1:17140073-17140095 GAGAGTCATCAGCAGCAAGAAGG - Intergenic
902745776 1:18473395-18473417 CAGTGTCCTCATCTGTAAGATGG + Intergenic
902753386 1:18533040-18533062 CAGTTTCCCCAACAGCAAGATGG - Intergenic
902824428 1:18963193-18963215 CAGTTTCCCCATCAGTAAGAAGG - Intergenic
903016314 1:20364403-20364425 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
903049125 1:20587920-20587942 CAGTGTCCTCATCTGCAAAATGG - Intergenic
903341204 1:22655619-22655641 CAGTTTCCTCATCTGCAAGATGG + Intronic
903564841 1:24257446-24257468 CAGTGGCCACATCTGCAAGATGG - Intergenic
903765278 1:25730098-25730120 CACTGTCCCCACCAGCACCAAGG + Intronic
903797589 1:25941502-25941524 GAGGGTCCCCACTAGCAAGAAGG - Intergenic
904478821 1:30781767-30781789 CAGAGTCCCCACCAGCAAGGAGG + Intergenic
904774964 1:32901041-32901063 CAGTTTCCCCAGCAGTGAAATGG - Intronic
904812923 1:33175510-33175532 CAGTTTCCCCATCTGCAAAATGG + Intronic
904937138 1:34139358-34139380 GAGAGTCCCCACTAGCAAGAAGG + Intronic
904947737 1:34211991-34212013 CAGTTTCCCCATCTGCAAAATGG - Intronic
904960842 1:34331714-34331736 CAGTGTTTCCATCAGCAAAATGG + Intergenic
905044574 1:34985464-34985486 AAGTGTCCCCACCTGTAAGATGG - Intronic
905282112 1:36855890-36855912 CAGTGTCCACATCTGCAAAATGG - Intronic
905288695 1:36906343-36906365 CAGTTTCTCCACCTGCAAGATGG + Intronic
905353720 1:37366129-37366151 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
905850989 1:41274768-41274790 GAGAGTCCGCAGCAGCCAGATGG - Intergenic
905882598 1:41474434-41474456 CAGTTTCCTCATCTGCAAGATGG + Intergenic
905969098 1:42127403-42127425 CAGTGCTCCCAGCAGCAAGCAGG - Intergenic
906063821 1:42965768-42965790 CAGTTTCCCCAACTGTAAGATGG + Intergenic
906341460 1:44984553-44984575 CAGTGTCCTCAGCTTCTAGAAGG + Intronic
906418688 1:45643953-45643975 CACTGTGCCCAGCAGGAAAATGG + Intronic
906617728 1:47246031-47246053 CAGAGTCCCTGACAGCAAGAAGG - Intergenic
906867724 1:49440856-49440878 CAGTGTCCCCAGCTTCATCAGGG - Intronic
906879341 1:49573831-49573853 CAGTGTCCCCAGCTTCATCAGGG - Intronic
907373173 1:54016066-54016088 CAGTGTCCTCAGAAGCAGAATGG + Intronic
907553344 1:55323454-55323476 CAGAGTCTCAAGCAGGAAGAAGG - Intergenic
907779985 1:57558127-57558149 CAGTGTCCCCAGCTTCATCAGGG - Intronic
907847533 1:58222881-58222903 CAGTGTCCTCAGCTGTAAAATGG - Intronic
908075689 1:60515260-60515282 CAGAGTTCCCACGAGCAAGAAGG + Intergenic
908148752 1:61277619-61277641 CAGAGTCCACAGCAGCCAGCAGG + Intronic
908303925 1:62791538-62791560 CAGAATCCCCACCAGCAAGAAGG - Intronic
908528361 1:65009737-65009759 CAGTTTCCTCATCAGTAAGATGG - Intergenic
908700647 1:66896729-66896751 CAGAGTCCCCACTAGCAACAAGG + Intronic
909172964 1:72318100-72318122 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
910561506 1:88597037-88597059 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
910587857 1:88899081-88899103 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
910619357 1:89236091-89236113 CAGTCTCCCCAGCACCAGCAGGG + Intergenic
910831515 1:91466361-91466383 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
911504824 1:98735914-98735936 CACTGTCACCTGCAGAAAGAAGG - Intronic
911883219 1:103267825-103267847 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
911899145 1:103478881-103478903 CAGTATTCACAGCAGCATGATGG + Intergenic
912051019 1:105527593-105527615 CAGTGTCCCCAGCTTCAACAAGG + Intergenic
912107784 1:106302926-106302948 GGGAGTCCCCAGCAGCAAGAAGG - Intergenic
912733678 1:112131469-112131491 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
913320289 1:117583175-117583197 CAGTTTCCTCACCTGCAAGATGG + Intergenic
913552951 1:119934860-119934882 CAATGTCCACAGCAGAATGATGG + Intronic
913682810 1:121202940-121202962 GAGAGTTCCCATCAGCAAGAAGG - Intronic
914034652 1:143990565-143990587 GAGAGTTCCCATCAGCAAGAAGG - Intergenic
914154800 1:145077403-145077425 GAGAGTTCCCATCAGCAAGAAGG + Intronic
914347197 1:146809962-146809984 CAGTGTCCTCATCTGCAAAATGG + Intergenic
914444461 1:147738265-147738287 AAGTGTCCCCAGCAGCAAGGAGG - Intergenic
914985173 1:152450090-152450112 CAGTGGCACCACCAGCAAGAAGG - Intergenic
915155608 1:153873568-153873590 CAAGGTCCCCACCAGCAAGAAGG + Intronic
915262347 1:154686134-154686156 CAGTATCCCCATCTGCAAAAGGG - Intergenic
915274692 1:154780083-154780105 CAGTGCCTCCAGCAGCCACATGG + Intronic
915658749 1:157383360-157383382 CAGAATCCCCACCAGCAAGAAGG + Intergenic
915668016 1:157462301-157462323 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
915743620 1:158139440-158139462 CTGTGTCCCTAGTAGCATGAAGG + Intergenic
915827026 1:159088811-159088833 CAGAGTCCCCACAAGCAAGAAGG + Intronic
916379241 1:164189927-164189949 GAGAGTCTCCATCAGCAAGAAGG - Intergenic
916731015 1:167566913-167566935 CAGTTTCCTCAGCTGTAAGATGG - Intergenic
916788915 1:168107526-168107548 CAGCGTCCCCACCAACAAGAAGG + Intronic
917075218 1:171197859-171197881 CAGAGTCCAAACCAGCAAGAAGG + Intronic
917253268 1:173086451-173086473 CTGTGTCCTCACAAGCAAGAAGG + Intergenic
917462378 1:175243568-175243590 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
917598103 1:176550215-176550237 CAGTGTCCTCATCTGTAAGATGG + Intronic
917953142 1:180062634-180062656 GAGAGTCCCTACCAGCAAGAAGG - Intronic
918072098 1:181140670-181140692 CAGTGTTCTCAGCTGGAAGATGG + Intergenic
918200740 1:182264194-182264216 GAGAGTGCCCAGCAGCAACAAGG + Intergenic
918545904 1:185683644-185683666 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
919102143 1:193108091-193108113 CAGAGTTCCCACCAGCAAGAAGG + Intergenic
919211459 1:194492517-194492539 AAGAGTCCTCACCAGCAAGAAGG - Intergenic
919230361 1:194765207-194765229 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
919510480 1:198457278-198457300 CAGAATCCCCACCAGCAAGAAGG - Intergenic
919784346 1:201249881-201249903 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
919865882 1:201782612-201782634 CAGTCTCCTCAGCACCAAGCAGG + Exonic
920115565 1:203618359-203618381 CAGTTTCCCCAACTGTAAGATGG + Intergenic
920125882 1:203693370-203693392 CAGTATGCCCTGCAGCAAGGCGG - Intronic
920341212 1:205276268-205276290 CAGTTTCCCCAGCTGAAACATGG + Intergenic
920956483 1:210624243-210624265 GAGAGTTCCCACCAGCAAGAAGG + Intronic
920995874 1:210990545-210990567 CAGGCTCCCCATCAGTAAGATGG + Intronic
921039589 1:211416840-211416862 CAGGGTCCCCAGCAGGAAGGTGG - Intergenic
921165538 1:212504223-212504245 AAGGGGTCCCAGCAGCAAGAGGG - Intergenic
921257349 1:213354613-213354635 CAGAGTCCTCACCAGCAAGAAGG - Intergenic
921815351 1:219557247-219557269 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
921945753 1:220884855-220884877 CAGTGTCCGCTGCAGCCAGTCGG - Exonic
922173933 1:223180112-223180134 CAGTGTCCACTGCAGCCACATGG + Intergenic
922737527 1:227995652-227995674 GAGAGTTCCCACCAGCAAGAAGG - Intergenic
922745413 1:228040262-228040284 AAGTGGCCCCAACAGGAAGATGG - Intronic
922760884 1:228129801-228129823 GGGAGTCCCCACCAGCAAGAAGG + Intergenic
922761134 1:228131511-228131533 GGGAGTCCCCACCAGCAAGAAGG - Intergenic
923005878 1:230049295-230049317 CTATTTCCCCAGCAGCAAGAGGG + Intergenic
923103191 1:230833827-230833849 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
923219477 1:231880231-231880253 CAGTGTCCCCAACAGCAAGAAGG + Intronic
923262192 1:232278138-232278160 GACAGTCCCCACCAGCAAGAAGG - Intergenic
923268980 1:232337712-232337734 CAGGATCCCCACTAGCAAGAAGG + Intergenic
923441456 1:234024551-234024573 CAGAGTCCCCAACAGCAAAAGGG - Intronic
923544239 1:234912774-234912796 GAGAGTTCCCAGCAGCAAGAAGG + Intergenic
923556349 1:235003666-235003688 CAGAGTCCCCAACAGCAAGAAGG - Intergenic
923615152 1:235531167-235531189 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
923718056 1:236443115-236443137 TAGAGTCCCCACCGGCAAGAAGG + Intronic
923774934 1:236969693-236969715 GAGAGTCCCCATCAGCAAGAAGG + Intergenic
923774959 1:236969827-236969849 GAGAGTCCCCACCAGCAAGAAGG - Intergenic
924118120 1:240767715-240767737 GAGAGTCCCCACCGGCAAGAAGG - Intergenic
924498560 1:244614040-244614062 CAGAGTCCCCACCAGGAAGATGG + Intronic
924749636 1:246873994-246874016 CAGTGTCAGAAGCAGCAAGCGGG - Intronic
924791780 1:247257281-247257303 CAGAATTCCCACCAGCAAGAAGG + Intergenic
924952519 1:248897889-248897911 CAGTCTCCCCAGCATTAGGAGGG - Intergenic
1062818593 10:517690-517712 ACGTGTCACCAGCAGAAAGATGG + Intronic
1063960862 10:11304510-11304532 CAGAGTCCCCACCAGCAAGAAGG - Intronic
1064472474 10:15650538-15650560 GAGGGTCCCCACCAGCAAGAAGG + Intronic
1065492267 10:26293882-26293904 CAGTTTCTCCATCAGCAAGATGG - Intronic
1065771783 10:29084808-29084830 CAGACTCCCTACCAGCAAGAAGG + Intergenic
1065971582 10:30810128-30810150 CCGTCACCCCAGCAGGAAGATGG - Intergenic
1066347047 10:34597816-34597838 CACTGTCTCCAGAAGCAGGAGGG + Intronic
1067029651 10:42871613-42871635 CGGTGTCTCCAGCAGCAGGGAGG + Intergenic
1067332792 10:45337567-45337589 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1067441702 10:46312365-46312387 CAGGGTTCCCCTCAGCAAGATGG - Intronic
1067492757 10:46727578-46727600 GAGAGTCCCCACAAGCAAGAAGG - Intergenic
1067601908 10:47612817-47612839 GAGAGTCCCCACAAGCAAGAAGG + Intergenic
1067733804 10:48833504-48833526 CAGTGTCACCTCCATCAAGATGG + Intronic
1067741430 10:48898554-48898576 CAGTGACCCCTCCTGCAAGAGGG + Intronic
1067939909 10:50646553-50646575 CAGAGTCCTCACCAGCAAGAAGG + Intergenic
1068249951 10:54425402-54425424 GAGAGTCCCCACAAGCAAGAAGG + Intronic
1068279340 10:54848536-54848558 AAGAGACCCCACCAGCAAGAAGG + Intronic
1068343683 10:55742395-55742417 CAGAGTTCTCATCAGCAAGAAGG - Intergenic
1068489424 10:57704180-57704202 TAGTGTCCCTAAAAGCAAGAAGG + Intergenic
1068543329 10:58320390-58320412 GAGTGTCCCCACCAGCAAGAAGG - Intergenic
1068711661 10:60141518-60141540 CAGTGTACCCAGATGGAAGATGG - Intronic
1068837596 10:61571243-61571265 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
1068924423 10:62520525-62520547 CAGAGTCCCCAACAGCAAGAAGG + Intronic
1069022341 10:63503020-63503042 CAGTTTCCCCATCTGCAAAATGG - Intergenic
1069171667 10:65238600-65238622 TAGAGTCCTCACCAGCAAGAAGG - Intergenic
1069370921 10:67746935-67746957 CAGTTTCCCCAGCACCAGCAGGG - Intergenic
1069887444 10:71632958-71632980 GAGAGCCCCCACCAGCAAGAGGG - Intronic
1070029879 10:72666720-72666742 GAGAGTCCCCACCAGCAGGAAGG - Intergenic
1070081572 10:73193918-73193940 GAGAATCCCCACCAGCAAGAAGG - Intronic
1070657349 10:78280548-78280570 CTGTGTCCCTAGCAGCAACTGGG - Intergenic
1070757352 10:79001641-79001663 CAGTGTCCCCAGCAGGCAGGAGG + Intergenic
1070775952 10:79109897-79109919 CAGTCTCCCCATCTGTAAGATGG + Intronic
1070834065 10:79436901-79436923 CAGTGACCCCAGCAGGTAGCAGG + Intronic
1071230795 10:83582283-83582305 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
1071339911 10:84636112-84636134 CAGAGTCATCAGCAGCAAGAAGG + Intergenic
1071653434 10:87420405-87420427 GAGAGTCCCCACAAGCAAGAAGG + Intergenic
1071943140 10:90610424-90610446 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
1071957817 10:90778447-90778469 CAGAGTCCCTACCAGCAAGAAGG + Intronic
1072159048 10:92749427-92749449 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
1072207803 10:93220570-93220592 CAGGGTCCCCACCAGCAGGAAGG + Intergenic
1072341645 10:94458326-94458348 GAGCGTCCCCATCAGCAAGAGGG + Intronic
1072469336 10:95697693-95697715 GAGAGTTGCCAGCAGCAAGAAGG + Intergenic
1072483291 10:95830011-95830033 GAGAGTCCCCACCAGCAAGAAGG + Intronic
1072610410 10:97014018-97014040 CAGTGCCCCCTGCAGTATGAGGG - Exonic
1072624373 10:97101570-97101592 CATTGCTCCCAGCAGCAAGGTGG - Intronic
1072626872 10:97118208-97118230 CAATTTCCCCATCAGCAAAATGG - Intronic
1072652152 10:97304077-97304099 CAGAGTCTCCATCAGCAAGAAGG + Intergenic
1072735252 10:97874725-97874747 CAGTTTTCCCATCTGCAAGATGG - Intronic
1072762093 10:98065064-98065086 CAGTGTCTCCAGCAGCTATGTGG + Intergenic
1072784183 10:98268844-98268866 CAGTGTTCCCAGCTGCACAATGG - Intergenic
1073327509 10:102651150-102651172 CAGTGGCCTCAGCAGCAGGAGGG + Intronic
1073879325 10:107961444-107961466 CAGTGTTCTCAGCAGTTAGAGGG - Intergenic
1074106013 10:110390179-110390201 CAGGTCCCCCAGCAGCAGGAGGG - Intergenic
1074136494 10:110631776-110631798 GAGAGTCCTCACCAGCAAGAAGG + Intergenic
1074141450 10:110677095-110677117 CAGAGTTCCCACCAGCAAGAAGG - Intronic
1074153959 10:110782356-110782378 CAGCTTCCCCATCAGCAAAATGG + Intronic
1074244587 10:111676216-111676238 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1074447829 10:113534785-113534807 CAGTGTCCCCATCTGTAAAATGG + Intergenic
1074480944 10:113820136-113820158 CTGTGTTCCAAACAGCAAGACGG + Intergenic
1074667566 10:115747400-115747422 CAGTTTTCCCACCTGCAAGATGG - Intronic
1075228786 10:120653668-120653690 CAGACTCACCAGCAGCAAGGAGG + Intergenic
1075282384 10:121150712-121150734 GTGAGTCCCCAACAGCAAGAAGG + Intergenic
1075398775 10:122146609-122146631 CAGAGTCCCCACCAGCAAGAAGG + Intronic
1075485934 10:122822141-122822163 CTGTGTCCCCAGCACCTAGAAGG - Intergenic
1075606513 10:123815467-123815489 CAGTGTCCCCAGCTTCATCAGGG - Intronic
1075720719 10:124585715-124585737 CAGCCTCCCGAGCAGCAAGCAGG + Intronic
1076229708 10:128809850-128809872 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
1076468873 10:130704644-130704666 CAGAGTCCCCGCCAGCAGGAAGG + Intergenic
1076469170 10:130706718-130706740 GAGAGTCCTCACCAGCAAGAAGG + Intergenic
1076517636 10:131057126-131057148 CACCCTCCCCAGCAGCAGGAGGG + Intergenic
1076594479 10:131617426-131617448 CAGTTTCCATAGCAACAAGAAGG + Intergenic
1076650274 10:131982355-131982377 CAGTTTCCCCACTAGCAGGATGG - Intergenic
1076729400 10:132430977-132430999 CAGGGTCCCGAGAAGGAAGATGG + Intergenic
1076803265 10:132842756-132842778 CAGAGGCCCCACCTGCAAGAAGG - Intronic
1076837382 10:133028092-133028114 CAGTGTACCCAGGAGTCAGAGGG + Intergenic
1076963407 10:133785926-133785948 CAGTGTGCCCAGCTGCCAGCAGG + Intergenic
1076978008 11:189943-189965 CAGTGTCCCCATCTGCCAGCAGG - Intronic
1076978043 11:190125-190147 CAGTGTCCTCAGCTGCCAGCAGG - Intronic
1076978055 11:190186-190208 CAGTGTCCCCAGCTGCCAGCAGG - Intronic
1077424049 11:2466215-2466237 CAGTTTCCCCAGCTACAAAATGG - Intronic
1077521047 11:3034922-3034944 AAAAGTCCCCACCAGCAAGAAGG - Intronic
1077542388 11:3153183-3153205 CAGTGTCCCCACCTGTAAAATGG + Intronic
1077583134 11:3430299-3430321 CAGTTTCCCCAGCTGTAAAATGG - Intergenic
1078521730 11:12069126-12069148 CACTGTGCCCAGCTGGAAGAGGG - Intergenic
1078605392 11:12770617-12770639 CACTTTCCTCAGCAGCAAAATGG - Intronic
1079459072 11:20663966-20663988 TAGAGTCCCCACTAGCAAGAAGG - Intergenic
1079685766 11:23357683-23357705 CAGAGTTCCCACCAGCAAGAAGG - Intergenic
1079960111 11:26913598-26913620 CAGAGTCCCCATCAGCAAGAAGG + Intergenic
1079996138 11:27297026-27297048 GAGAGTCCCCACCAGCAAGAAGG - Intergenic
1080044093 11:27790180-27790202 CAGAGTCCCTTGCAGCAATATGG + Intergenic
1080836312 11:35944097-35944119 CAGCGGCCCCAGCAGCCACATGG - Exonic
1081412964 11:42781772-42781794 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
1081654001 11:44845286-44845308 CAGTGTCCTCATCTGTAAGATGG + Intronic
1081730901 11:45371117-45371139 CAGTTTCCCCATCATCAAGATGG + Intergenic
1081792193 11:45796015-45796037 CAGTTTTCCCATCAGTAAGATGG - Intergenic
1082000265 11:47390320-47390342 CAGTGTCCTCATCTGCAAAATGG + Intergenic
1082872779 11:57958895-57958917 GAGTGTCCCCATCAGCAAGAAGG + Intergenic
1082914023 11:58411378-58411400 GGGAGTCCCCACCAGCAAGAAGG + Intergenic
1082999271 11:59276890-59276912 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1083092661 11:60217368-60217390 CAGTGTCCCCAGCTTCATCAAGG - Intronic
1083144677 11:60749361-60749383 CAGTTTCCCCATCTGCCAGATGG - Intergenic
1083181119 11:60986307-60986329 CAGTCTCACCAGCAGGAAGGTGG + Intronic
1083236865 11:61356666-61356688 CAGGGACCCCAGCAGCAGGCAGG + Exonic
1083362248 11:62118583-62118605 GATAGTCCCCATCAGCAAGAAGG - Intergenic
1083486591 11:62986743-62986765 CAGTGTCCTCATTTGCAAGATGG + Intergenic
1083549101 11:63572569-63572591 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
1083553598 11:63608889-63608911 CAGTTTCCTCAGCTGCAAAATGG + Intronic
1083758250 11:64802704-64802726 CAGTGCCCCCATCTGCAAAATGG + Intronic
1084005631 11:66322046-66322068 CAGTTTCCCCATCTGCAAAAAGG - Intergenic
1084008098 11:66333780-66333802 CAGTTTCGCCATCTGCAAGAGGG + Intronic
1084025755 11:66448225-66448247 GAGAGTCCTCATCAGCAAGAGGG - Intronic
1084240050 11:67813102-67813124 CAGTTTCCCCAGCTGTAAAATGG - Intergenic
1084266351 11:68007324-68007346 CAGTTTCCCCAGCTGTAAAATGG - Intergenic
1084428184 11:69096974-69096996 CAGTCTCCTCACCTGCAAGATGG - Intergenic
1084497974 11:69516342-69516364 GAGAGTCCCCAGCAGCAAGAAGG + Intergenic
1084509371 11:69593649-69593671 AGGGGACCCCAGCAGCAAGAAGG - Intergenic
1084540168 11:69781612-69781634 CAGTTTCCCCTGCAGCAAAATGG + Intergenic
1084832396 11:71779739-71779761 CAGTTTCCCCAGCTGTAAAATGG + Intergenic
1085299427 11:75449713-75449735 CAGTGTCCCCAGTTGGCAGATGG - Intronic
1085309963 11:75510385-75510407 CAGTGTCCCCAGCACCTGGCTGG - Intronic
1085326416 11:75610108-75610130 CAGGGTCCCCACCAACAAAAAGG + Intronic
1085621637 11:78042125-78042147 CTGTGACACCAGAAGCAAGATGG - Intronic
1085800039 11:79580831-79580853 GAGAGTCCCCATCAGCAAGAAGG + Intergenic
1085896389 11:80644565-80644587 GAGTGTCCCCACTGGCAAGAAGG + Intergenic
1086033967 11:82394587-82394609 CAGGGTTCCCAGAAGAAAGATGG + Intergenic
1086833772 11:91597723-91597745 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1087285555 11:96261277-96261299 CAGAATCCCCACCACCAAGAAGG + Intronic
1088052606 11:105536207-105536229 TAGAGTCCCCTTCAGCAAGAAGG - Intergenic
1088177401 11:107069296-107069318 GAGAGTCCTCACCAGCAAGAAGG + Intergenic
1088264785 11:107978883-107978905 CAGTGTCCCCAGCTTCACCATGG - Intergenic
1088505634 11:110524371-110524393 TAGTGTTCCCATGAGCAAGAGGG - Intergenic
1088737552 11:112740257-112740279 GAGTGGCCCCAGCATCTAGAAGG - Intergenic
1089304913 11:117520593-117520615 CAGTTTCCTCAACAGCAAAATGG + Intronic
1089608080 11:119653416-119653438 CAGTGTCCCCTGCAGGAGGGTGG + Intronic
1089903265 11:122010905-122010927 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1089904820 11:122027804-122027826 CAGGGTCCCCCCCAGCAAGAAGG - Intergenic
1090033009 11:123223459-123223481 CAGGGTCCCCATCAGCAAGAGGG + Intergenic
1090283384 11:125477781-125477803 CAGTGTCCCCTGGAGGCAGAAGG - Intronic
1090535465 11:127636440-127636462 CAGAGTCCCCACCCTCAAGAAGG + Intergenic
1090544075 11:127743404-127743426 TAGAGTCCCCACCAGCAAGAAGG - Intergenic
1091111051 11:132968361-132968383 CAGAGGCCCCACCAGCAAGAAGG - Intronic
1091372908 11:135075928-135075950 TAGTGACCCCAGCGGCCAGAAGG + Intergenic
1091373447 12:11541-11563 CAGTGTCCCCAGCTGCCAGCAGG - Intergenic
1091704449 12:2684289-2684311 TCGTGTCCCCATCAGCAAAATGG + Intronic
1091757358 12:3062913-3062935 CTGTGAGGCCAGCAGCAAGATGG - Intergenic
1091810155 12:3390171-3390193 CAGTGTACTGAGCAGCAAGTGGG - Intronic
1091974081 12:4810826-4810848 CAGCGTCTCCACCAGAAAGAAGG - Exonic
1092083228 12:5735309-5735331 CAGTCTCCCCAGGAGCCAGCTGG + Intronic
1092186129 12:6479810-6479832 CAGATTCCTCAGCAGCAAGTTGG - Intergenic
1092273831 12:7044210-7044232 CAGTGTGCACAGCAGCAGGGAGG - Intronic
1092410287 12:8247645-8247667 CAGTTTCCCCAGCTGTAAAATGG - Intergenic
1092443331 12:8528347-8528369 GAGAGTCCCTACCAGCAAGAAGG + Intergenic
1092745053 12:11665389-11665411 CACTGTGCCCAGCAGCAACAGGG - Intronic
1092826361 12:12403486-12403508 CAGTTTCCTCAGAAGCAGGAAGG - Intronic
1093050003 12:14493621-14493643 CAGTGTCCCCAGCTTCATCAGGG + Intronic
1093163790 12:15781787-15781809 GAGAGTCCCCACCAGCAAGGAGG - Intronic
1094102183 12:26776601-26776623 CAGTGTCCCCAGCTTCATCAGGG - Intronic
1094649268 12:32359384-32359406 CAGAGTCCCCACCAGCAAGAAGG - Intronic
1094694308 12:32802434-32802456 CAGATTCCTCAGCAGCGAGATGG + Exonic
1094741515 12:33294912-33294934 GAGAGTCTCCAACAGCAAGAAGG + Intergenic
1095222181 12:39628864-39628886 CAGTTTCCCCATCAGTAAAATGG - Intronic
1095326120 12:40895443-40895465 CGGAGTCCCCACCAGCAAGGAGG - Intronic
1095598210 12:43983255-43983277 AAGAGTTCCCAGCACCAAGAGGG + Intronic
1095748609 12:45686927-45686949 CAGAGTCCTCATCAGCAAGAAGG - Intergenic
1095844830 12:46733154-46733176 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
1095958085 12:47818071-47818093 CAGTTTCCCCATCAGTAAAATGG - Intronic
1096457888 12:51802376-51802398 CAGTGTCCCCAGCTTCATCAGGG + Intronic
1097285026 12:57870456-57870478 CAGTTTCCCCACCAGTAAAATGG + Intergenic
1097381941 12:58905799-58905821 CAGAGTCCCCACCAGCAAAAAGG + Intronic
1097498457 12:60373368-60373390 CAGTCTCCCCAGCACCGACAGGG - Intergenic
1098673824 12:73264767-73264789 GAGAGTCCCCTCCAGCAAGAAGG - Intergenic
1098805098 12:75013409-75013431 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1098833102 12:75387659-75387681 CAGAGTCCCCAGTAGCAAGAAGG - Intronic
1099859750 12:88211271-88211293 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
1100024711 12:90113907-90113929 GAGAGTCCCCACAAGCAAGAAGG - Intergenic
1100965082 12:100004346-100004368 CTGAGTCCCCACCAGTAAGAAGG + Intergenic
1100981629 12:100166852-100166874 CAGTGTCCCCATCAGCAAAGAGG - Intergenic
1101104849 12:101429586-101429608 GAGAGTCCTCACCAGCAAGAAGG + Intergenic
1101263769 12:103063445-103063467 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1101404001 12:104412359-104412381 CCCTGTCCCCACCAGCCAGACGG - Intergenic
1101603486 12:106230783-106230805 CAGTTTCCCCATCAGTAAAATGG + Intergenic
1101811269 12:108110074-108110096 CAGTTTCCCCATCTGCAACATGG - Intergenic
1101940292 12:109094833-109094855 CAGAGTCCCCACCAGCAAGAGGG + Intergenic
1102053304 12:109879048-109879070 CAGTGTCCCCAGCTGTGAAACGG - Intronic
1102259707 12:111436576-111436598 CAGAGTCCCCAGCAGCAACATGG - Intronic
1102301316 12:111773552-111773574 CAGTTTCCTCACCCGCAAGACGG - Intronic
1102401509 12:112633577-112633599 GAGAGTCCCCACCAGCAAGAAGG + Intronic
1102556707 12:113731512-113731534 CAGTCTCCCCAACTGCAAAATGG - Intergenic
1102561305 12:113764208-113764230 CAGTTTCTCCAGCTGCAAAATGG - Intergenic
1102732631 12:115126364-115126386 CAGAGTCCCCCACAGCAAGAAGG - Intergenic
1102765214 12:115426975-115426997 CAGTGAGGTCAGCAGCAAGAAGG + Intergenic
1102773584 12:115499597-115499619 CAGTGGAGGCAGCAGCAAGAGGG - Intergenic
1103213064 12:119180495-119180517 CAGCCTCCTCAGCTGCAAGATGG - Intronic
1103245287 12:119451475-119451497 CAGTTTCCCCATCTGCAAAATGG + Intronic
1103572740 12:121856045-121856067 CAGTTTCCACAGCTGCCAGATGG - Intronic
1103671031 12:122615580-122615602 CAGTGTCCCCAGCAGTCACAAGG - Intronic
1103917801 12:124384976-124384998 CAGTTTCCCCAGCTCCAAAAAGG + Intronic
1104093791 12:125537875-125537897 CAGTGTCCCCACTTGCAACATGG + Intronic
1104512159 12:129390692-129390714 CAGAGTCACCAGCAAGAAGAAGG - Intronic
1104553047 12:129774893-129774915 CGGTTTCCCCAGCTGCAAAATGG + Intronic
1104615517 12:130264997-130265019 CAGTGTGCCCAGCAGAGAGTAGG + Intergenic
1104648955 12:130517293-130517315 CAGAGTCCTCATCAGCAAGAAGG + Intronic
1104772910 12:131375446-131375468 CACTGTGCCCAGAAGGAAGATGG - Intergenic
1105280768 13:18961399-18961421 GAGTCTGCCCAGCAGCATGAGGG - Intergenic
1105352066 13:19624928-19624950 GAGAGTCCCCACCAGCAAGAAGG - Intergenic
1105788155 13:23769985-23770007 CGGCGTCCCCACCAGCAGGAGGG + Intronic
1105793969 13:23832281-23832303 CAGAGTCCCCACCAGTAGGAAGG + Intronic
1106698091 13:32199978-32200000 GAGAGTCCCCATCAGCAAGAAGG - Intronic
1106841279 13:33687479-33687501 CAGTGTCCTCATCAGTAAAATGG - Intergenic
1106994094 13:35460896-35460918 GAGAGTCCCTACCAGCAAGAAGG - Intronic
1107161450 13:37233534-37233556 CAGAGTCTCCACCATCAAGAAGG + Intergenic
1107193686 13:37621602-37621624 CAGAATCCCCACCAGCAAAAAGG + Intergenic
1107424768 13:40281861-40281883 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
1107474306 13:40720552-40720574 GAGAGTCCCCACCAGCAAGGAGG - Intergenic
1108185711 13:47886647-47886669 CAGTGGACACAGCAGCAAGCAGG - Intergenic
1108268382 13:48734496-48734518 CAGTGTCTTCACCAGTAAGATGG - Intergenic
1108455318 13:50607727-50607749 CAGTGGCCCCAGCACCACCATGG - Intronic
1108458731 13:50643725-50643747 GAGAGTCCCCACCAGCAGGAAGG - Intronic
1108516463 13:51207753-51207775 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
1109135499 13:58644835-58644857 GAGTGACACCAGAAGCAAGAAGG + Intergenic
1109292911 13:60497733-60497755 CAGTGTCCCCAGCTTCATCAGGG - Intronic
1109582703 13:64363469-64363491 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1109892377 13:68632002-68632024 CAGAGTCCCCACCAAGAAGAAGG - Intergenic
1110317288 13:74124896-74124918 CTGTAACCCCAGCAGCAAGGCGG + Intronic
1110354342 13:74549836-74549858 CAGCGTCTCCCCCAGCAAGAAGG + Intergenic
1110870798 13:80450547-80450569 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
1111016534 13:82388493-82388515 CAGTGTCCCCAGCTTCATAAGGG + Intergenic
1111283978 13:86064223-86064245 AAGAGTCCCCACCAGCAAGAAGG + Intergenic
1111576099 13:90155427-90155449 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
1111679133 13:91422715-91422737 CAGAGTCCCCACCAGCAGGAAGG - Intronic
1112250285 13:97772881-97772903 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
1112266799 13:97931874-97931896 CAGAGTCCTCACCAGCAAGAAGG - Intergenic
1112425134 13:99291127-99291149 TAGTTTCCTCATCAGCAAGATGG + Intronic
1112607164 13:100917839-100917861 TGCTGTCCCCAGCAGCAAGAGGG + Intergenic
1112759877 13:102682639-102682661 CAGTATACACAGCAGCAACAGGG - Intergenic
1113087416 13:106582440-106582462 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
1113320066 13:109224343-109224365 CAGTGTCCCCAGCTTCATCATGG + Intergenic
1113484813 13:110646071-110646093 CAGGCTCTCCAGCACCAAGAGGG - Exonic
1113572615 13:111369613-111369635 GAGAGTCCCTACCAGCAAGAAGG + Intergenic
1113762532 13:112859574-112859596 CAGGGTGCCCAGCAGCAGGCGGG + Intronic
1113916786 13:113878759-113878781 CAGTGGCCCCAGGTGCAACACGG - Intergenic
1113989836 13:114352762-114352784 CAGTGTGCCCAGCTGCCAGCAGG + Intergenic
1114205554 14:20568437-20568459 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1114655008 14:24310738-24310760 CAGCGCCGCCAGCAGCAGGAAGG - Exonic
1114929159 14:27445797-27445819 GAGAATCCCCACCAGCAAGAAGG + Intergenic
1116270590 14:42760201-42760223 CAGTGTCTCCAGCTTCATGAGGG + Intergenic
1117001768 14:51377493-51377515 CAGTGTCCCCAGCTTCATCATGG + Intergenic
1117216463 14:53557439-53557461 CAGTGTCCCCAGCTTCACCAGGG - Intergenic
1118595792 14:67434856-67434878 GAGAGTTCCCACCAGCAAGAAGG - Intergenic
1118926209 14:70191973-70191995 CAGTGTCCTCACCAGTAAAATGG + Intergenic
1118950908 14:70435752-70435774 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
1119093350 14:71805410-71805432 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
1119350604 14:73961626-73961648 CAGGGCCCACAGTAGCAAGAGGG + Intronic
1119536433 14:75406562-75406584 CAGAGTCCCCAACAGCAAGAAGG - Intergenic
1119770920 14:77220252-77220274 CAGTTTCCCCACCTGAAAGATGG + Intronic
1120225236 14:81783800-81783822 CAGTGTCTCTAGCACAAAGAGGG - Intergenic
1120552787 14:85891774-85891796 GAGACTCCCCACCAGCAAGAAGG - Intergenic
1120556352 14:85933093-85933115 CAGTGTCCCCAGCTTCATTAGGG + Intergenic
1120690604 14:87588579-87588601 GAGAGTCCTCACCAGCAAGAAGG + Intergenic
1120887392 14:89462571-89462593 CAGAGTCCCCATCAGGAAGAAGG - Intronic
1120973302 14:90227789-90227811 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1121142389 14:91554946-91554968 CAGTCTCCCCAGCACCAGCAGGG - Intergenic
1121182211 14:91937702-91937724 GAGAGCCCCCACCAGCAAGAAGG + Intronic
1121372852 14:93376005-93376027 GAAAGTCCCCACCAGCAAGAAGG + Intronic
1121571181 14:94947614-94947636 AAGAGTCCTCACCAGCAAGAAGG + Intergenic
1121714955 14:96067216-96067238 CAGTCGCGCCAGCAGCAAGGTGG + Intronic
1121753116 14:96375799-96375821 CAGAGTCCCCACCGCCAAGAAGG - Intronic
1121786479 14:96665277-96665299 GAGGGTCCCCAGCAGCATGAAGG + Intergenic
1121798554 14:96755060-96755082 CAGAGTCCTCAGCAGCCAGGGGG + Intergenic
1121814702 14:96920382-96920404 CAGTGAGGCCACCAGCAAGAGGG + Intronic
1121900136 14:97686409-97686431 CAGAGTTCCCAGCAGCAAGAAGG - Intergenic
1122074124 14:99224730-99224752 CAGTGTCCCCACCTGTAAAATGG - Intronic
1122274105 14:100582463-100582485 CAGTGTCCTCAACTGCAAAAGGG - Intronic
1122816619 14:104317126-104317148 CAGGGGCCCCAGCTGCAGGATGG - Intergenic
1122863104 14:104591377-104591399 CTGTGTCCCCAGCAGAAGGTGGG - Intronic
1123042822 14:105497349-105497371 CAGAGTCCGCAGCAGCTGGAAGG - Exonic
1123223981 14:106883193-106883215 CAGTGTCCGCAGCTGCCAGCAGG + Intergenic
1123472988 15:20568609-20568631 CAGTGTCCCCATCAGCAAAGAGG + Intergenic
1123645018 15:22431744-22431766 CAGTGTCCCCATCAGCAAAGAGG - Intergenic
1123666309 15:22611520-22611542 CAGTGTCCCCATCAGCAAAGAGG - Intergenic
1123733289 15:23163600-23163622 CAGTGTCCCCATCAGCAAAGAGG + Intergenic
1123751423 15:23360975-23360997 CAGTGTCCCCATCAGCAAAGAGG + Intronic
1124013898 15:25860775-25860797 CAGTTTCCTCATCGGCAAGATGG + Intronic
1124283793 15:28384893-28384915 CAGTGTCCCCATCAGCAAAGAGG + Intronic
1124298904 15:28526720-28526742 CAGTGTCCCCATCAGCAAAGAGG - Intronic
1124320130 15:28705926-28705948 CAGTGTCCCCATCAGCAAAGAGG - Intronic
1124355059 15:28989322-28989344 CAGTGTCCTCATCTGCAAAATGG + Intronic
1124482382 15:30089491-30089513 CAGTGTCCCCATCAGCAAAGAGG + Intronic
1124488841 15:30141593-30141615 CAGTGTCCCCATCAGGAAAGAGG + Intronic
1124521195 15:30407718-30407740 CAGTGTCCCCATCAGCAAAGAGG - Intronic
1124537465 15:30558502-30558524 CAGTGTCCCCATCAGCAAAGAGG + Intronic
1124543924 15:30610557-30610579 CAGTGTCCCCATCAGGAAAGAGG + Intronic
1124615593 15:31239566-31239588 ACGGGTCCCCACCAGCAAGAAGG - Intergenic
1124686360 15:31786128-31786150 CAGAGTCCCCACCAGCAAGAAGG + Intronic
1124754690 15:32396730-32396752 CAGTGTCCCCATCAGCAAAGAGG - Intronic
1124761191 15:32449085-32449107 CAGTGTCCCCATCAGCAAAGAGG - Intronic
1124777443 15:32599978-32600000 CAGTGTCCCCATCAGCAAAGAGG + Intronic
1124959372 15:34383262-34383284 CAGTGTCCCCATGAGCAAAGAGG - Intronic
1124975998 15:34529483-34529505 CAGTGTCCCCATGAGCAAAGAGG - Intronic
1125548645 15:40527774-40527796 GAGAGTTCCCACCAGCAAGAAGG + Intergenic
1125564784 15:40668298-40668320 CAGAGTCCCTATCAGCAAGAAGG + Intergenic
1125795898 15:42403690-42403712 CAGTGTCACCAGAAGCAAGCAGG - Intronic
1125909677 15:43425078-43425100 CAGAGTCCCCTCCAGCAAGAAGG + Intronic
1125975082 15:43944191-43944213 TAGAGTTCCCACCAGCAAGAAGG - Intronic
1126846369 15:52764434-52764456 TAGTGTCCCCAGCTGCAAAATGG - Intronic
1127387244 15:58476497-58476519 CAGTTTCCCCAGCTGCATGCAGG - Intronic
1127495365 15:59506270-59506292 CAGCCTCCCAAGCAGCAGGAGGG + Intronic
1127533063 15:59864072-59864094 CAGTGTCCTGAGAAACAAGATGG - Intergenic
1127622133 15:60744560-60744582 CAGTGTCCTCACCAGCAAACTGG + Intronic
1127626812 15:60787920-60787942 CAGTATCCCCAGCAGCCACAAGG - Intronic
1127691269 15:61399706-61399728 CAGTGTCCTCATCTGTAAGATGG + Intergenic
1127765103 15:62178112-62178134 GAGAATCCCCACCAGCAAGAAGG + Intergenic
1127773234 15:62246845-62246867 CAATGTCCCCATCAGCAAAGAGG - Intergenic
1127774549 15:62254857-62254879 CAATGTCCCCATCAGCAAAGAGG - Intergenic
1127973634 15:63981280-63981302 GAGAGTCCCCATTAGCAAGAAGG + Intronic
1128086854 15:64892704-64892726 CAGAGTCCCCACCACCAAGAAGG + Intronic
1128225112 15:65996054-65996076 CAGTGTCCACAGCTCCCAGATGG - Intronic
1128431909 15:67604569-67604591 CAGTTTTCCCATCTGCAAGATGG + Intronic
1128443034 15:67731259-67731281 CTGTGTCACCAGCAGGAAGAGGG - Intronic
1128475738 15:67995615-67995637 CAGTGTCACTACCAGCAAGGAGG - Intergenic
1128657911 15:69476029-69476051 TTGTGTCCCCAGCATCCAGAAGG - Intergenic
1128879530 15:71230572-71230594 CCCTGTCTCCAGCAGCAAAATGG - Intronic
1129035794 15:72647706-72647728 CCCTTTCCCCAGCAGCCAGAAGG + Intergenic
1129037893 15:72662006-72662028 CAGGGTCCCCATCAGCAAAGAGG + Intronic
1129190373 15:73933973-73933995 CTGGGTGCCCATCAGCAAGAGGG - Intronic
1129211996 15:74075221-74075243 CAGGGTCCCCATCAGCAAAGAGG - Intronic
1129214091 15:74089510-74089532 CCCTTTCCCCAGCAGCCAGAAGG - Intergenic
1129391332 15:75222421-75222443 CCCTTTCCCCAGCAGCCAGACGG + Intergenic
1129398407 15:75265864-75265886 CAGGGTCCCCATCAGCAAAGAGG + Intronic
1129402015 15:75290139-75290161 CAGGGTCCCCATCAGCAAAGAGG + Intronic
1129461240 15:75701039-75701061 CAGTGTCCCCATCTGTAAAAGGG + Intronic
1129519236 15:76175702-76175724 CAGTGTCCCCAGCAAGACCACGG - Intronic
1129582570 15:76828124-76828146 GAGAGTCCCCACCAGCAAGAAGG + Intronic
1129723586 15:77890699-77890721 CAGTGTCCCCATCTGTAAAAGGG - Intergenic
1129729122 15:77919542-77919564 CAGGGTCCCCATCAGCAAAGAGG - Intergenic
1129731227 15:77933853-77933875 CCCTTTCCCCAGCAGCCAGAAGG - Intergenic
1129876999 15:78982116-78982138 CAGTGTCCCCATCTGGAAAATGG + Intronic
1129949964 15:79577018-79577040 AAGAGTCCCCATGAGCAAGAAGG - Intergenic
1129990235 15:79955570-79955592 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
1130259716 15:82345627-82345649 CAGTGTCCCCATCAGTAAAGAGG - Intronic
1130269003 15:82433809-82433831 CAGTGTCCCCATCAGTAAAGAGG + Intronic
1130281517 15:82523382-82523404 CAGTGTCCCCATCAGTAAAGAGG + Intergenic
1130312837 15:82770168-82770190 AAGCATCCCCAGCAGCAAGAGGG - Intronic
1130472890 15:84239565-84239587 CAGTGTCCCCATCAGTAAAGAGG + Intronic
1130480381 15:84354136-84354158 CAGTGTCCCCATCAGTAAAGAGG + Intergenic
1130491388 15:84433993-84434015 CAGTGTCCCCATCAGTAAAGAGG - Intergenic
1130503004 15:84513033-84513055 CAGTGTCCCCATCAGTAAAGAGG - Intergenic
1130557570 15:84933555-84933577 CAGAATCCCCAGCAGCAAGAAGG - Intronic
1130595183 15:85244199-85244221 CAGTGTCCCCATCAGTAAAGAGG + Intergenic
1130829682 15:87586671-87586693 CAGTGCTCCCAGCAGCAAGAAGG + Intergenic
1130929063 15:88408650-88408672 GAGAGTCCCCACCAGCAAGAAGG - Intergenic
1130937609 15:88483469-88483491 CAGTTTCCCCTGCACCATGATGG + Intergenic
1130949413 15:88573687-88573709 CAGTGCCCTCAGCAGCAGCATGG + Intergenic
1131030431 15:89181804-89181826 CAGTTACCCCAGCAGCATAATGG + Intronic
1131086481 15:89579806-89579828 CAGAGTCCCCACCAGCAAGAAGG + Intronic
1131105826 15:89733709-89733731 GAGAGTCCCCACCAGCAAGAAGG + Intronic
1131282807 15:91034504-91034526 CAGTGTCCCCATCAGCAAAGAGG - Intergenic
1131885863 15:96912024-96912046 GAGGATCCCCAGCAGCAAGAAGG + Intergenic
1131919531 15:97309029-97309051 TTGTGTCCCCATCAGCAAGAAGG + Intergenic
1132024255 15:98391592-98391614 CAGTGTCCTCATCTGCCAGATGG + Intergenic
1132024753 15:98395581-98395603 GAGGGTCCCCACCAGCAAGAAGG + Intergenic
1132065020 15:98723915-98723937 TAGTGTGCCCAGAAGCCAGAAGG + Intronic
1132142840 15:99409271-99409293 CCGTGTCCCCAGCTGCCAGAGGG + Intergenic
1132207141 15:99993927-99993949 CAGGATTCCCAGCAGCAAGAAGG + Intronic
1132269861 15:100514117-100514139 CAGTTTCCCCATCTACAAGATGG + Intronic
1132433015 15:101775713-101775735 CAGTGTCCCCATCAGCAAAGAGG - Intergenic
1132453150 15:101979535-101979557 CAGTGTCCCCAGCTGCCAGCAGG + Intergenic
1132453744 16:11091-11113 CAGTGTCCCCAGCTGCCAGCAGG - Intergenic
1132476706 16:142877-142899 CAGTTTCCCCACCAGTAACAGGG + Intergenic
1132578168 16:673412-673434 GAGGGTGCCCAGCAGCAAGCTGG + Intronic
1132590251 16:723413-723435 CAGTGACTCCAGCATCAACAGGG + Intronic
1132609379 16:807636-807658 CAGTTTCCCCACCTGTAAGAGGG - Exonic
1133006431 16:2883978-2884000 CAGTGACCCCTGCCCCAAGAAGG - Intronic
1133077100 16:3288521-3288543 CAGTGTCCAGAGCTGCAAGGAGG + Exonic
1133326705 16:4946299-4946321 CAGTTTCCCCATCTGCAAAATGG + Intronic
1133423737 16:5669295-5669317 CAGCCTACCCAGCAGCAGGAGGG + Intergenic
1133809405 16:9149501-9149523 GAGAGACCCCACCAGCAAGAAGG - Intergenic
1133826980 16:9286875-9286897 CAGTGTCCTCAGCTGTAAAATGG - Intergenic
1133872111 16:9698660-9698682 CAGAGTTCCCATCAGCAAGAAGG - Intergenic
1133899291 16:9958315-9958337 CATTGCCCACATCAGCAAGAGGG - Intronic
1134021029 16:10921843-10921865 CAGTGTCCCCTGCAGCCTGGAGG - Intronic
1134059858 16:11192688-11192710 CAGTTTCCCCTCCTGCAAGATGG + Intergenic
1134067683 16:11239710-11239732 CTGAGTCCCCACCAGCAAGAAGG - Intergenic
1134189341 16:12109227-12109249 GAGAGTCCCCACCAGCAAGAAGG - Intronic
1134208130 16:12254037-12254059 CATTGTCCTGAGCAGCCAGAAGG + Intronic
1134275829 16:12775209-12775231 GAGAGTCCCCACCAGCAAGAAGG + Intronic
1134446593 16:14335948-14335970 CAGTTTCCCCAGGTGCAAAATGG - Intergenic
1134593319 16:15475064-15475086 AAGTGGCCCCAGCACCAAGGGGG - Intronic
1134809058 16:17151519-17151541 CAGTGTCCCCATCTGGAAAATGG + Intronic
1134892078 16:17850161-17850183 CAGTTTACTCAGCAGCAAAATGG - Intergenic
1135037879 16:19093406-19093428 GAGGGTCCCCACCAGCAAGAAGG + Intergenic
1135145823 16:19961951-19961973 GAGAGTCCCTACCAGCAAGAAGG + Intergenic
1135158040 16:20071154-20071176 CAGTTTCCACAGCAGTAAAATGG - Intronic
1135204810 16:20474450-20474472 CGGAGTCCCCAACAGCAAGAAGG + Intronic
1135214087 16:20549363-20549385 CAGAGTCCCCATCAGCAAGAAGG - Intronic
1135490909 16:22908547-22908569 GAGAGCCCCCAACAGCAAGAAGG - Intronic
1135494772 16:22941795-22941817 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
1135527300 16:23223608-23223630 CATTGTGCCCAGCTGCAAGCTGG + Intergenic
1135621503 16:23959867-23959889 CAGTGTCCCCATCTGCAAAGTGG - Intronic
1136055162 16:27682955-27682977 CAGAGTCCCCACCAGCAAGAAGG + Intronic
1137768800 16:50998026-50998048 CAGTTTCCCCAACTGCAAAATGG - Intergenic
1138154259 16:54687922-54687944 CAGTTTCCCCATCTGCAATATGG - Intergenic
1138301121 16:55930558-55930580 GAGAGTCCCCACCAGCAAGAAGG + Intronic
1138301337 16:55932236-55932258 GAGAGTCTCCACCAGCAAGAAGG + Intronic
1138323650 16:56142033-56142055 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
1138334695 16:56243926-56243948 CAGTTTCCTCAGCTGCAAAATGG - Intronic
1138445170 16:57059004-57059026 CAGTGTCTCCAGCAGGTACAGGG - Exonic
1138493312 16:57390882-57390904 CAGAGGCCCCATCAGCAAGATGG + Intergenic
1138745186 16:59355025-59355047 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
1138855837 16:60690188-60690210 TAGAGTCCGCATCAGCAAGAAGG - Intergenic
1139012572 16:62650190-62650212 GAGAGTCACCAACAGCAAGAAGG - Intergenic
1139345388 16:66299867-66299889 GAGGGTCCCCACCAGCAAGAAGG - Intergenic
1139440888 16:66966295-66966317 CAGTGCCTTCAGCAGAAAGAAGG + Exonic
1139986793 16:70905306-70905328 CAGTGTCCTCATCTGCAAAATGG - Intronic
1140218582 16:73027660-73027682 CACTGCCCCCACCACCAAGAAGG + Intronic
1140469557 16:75206543-75206565 CAGTGTCCCCATCAGCAAAGTGG + Intronic
1140597773 16:76436306-76436328 CAGTGTCCCCAGCTTCATCAGGG + Intronic
1140642873 16:76997502-76997524 TAGTGTCCTCTGAAGCAAGAAGG - Intergenic
1140840474 16:78833749-78833771 CAGTTTCCTCATCAGCAAAATGG - Intronic
1141117834 16:81325647-81325669 CAGTGTCCTAGGCATCAAGATGG + Intronic
1141134212 16:81455348-81455370 CAGTGTCCCCATCGGTAAAATGG - Intronic
1141366145 16:83445199-83445221 CAGTTTCCTCAGCTGCAAAATGG - Intronic
1141394584 16:83693221-83693243 CAGTGTCCCCACCTGAAACATGG + Intronic
1141437132 16:84006429-84006451 CAGTTTCCCTAGCGGCAAAATGG - Intergenic
1141676176 16:85518592-85518614 CAGTTTCCCCAGCTGTAAAATGG + Intergenic
1141766351 16:86062357-86062379 CAGTTTCCTCAGCTGCAAAATGG - Intergenic
1141863763 16:86735820-86735842 GAGAGTCCCCACCAGCAGGAAGG - Intergenic
1141863786 16:86735929-86735951 CAGAGTCCCCACCAACAGGAAGG - Intergenic
1142113329 16:88343605-88343627 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
1142204084 16:88774518-88774540 CAGAGTCCCCAGCAGCAGCCTGG + Intronic
1142215882 16:88829603-88829625 CTGTGTCCCCAGCAGCCAGTGGG - Intronic
1142465433 17:134408-134430 CAGTGTCCCCATCTGCCAGCAGG - Intergenic
1142465468 17:134590-134612 CAGTGTCCTCAGCTGCCAGCAGG - Intergenic
1142465480 17:134651-134673 CAGTGTCCCCAGCTGCCAGCAGG - Intergenic
1142599518 17:1046809-1046831 CAGTGTCCTCATCTGTAAGATGG + Intronic
1143405868 17:6676922-6676944 CAGAGTCCTCAGCAGCCAAAGGG + Intergenic
1143946149 17:10594196-10594218 CAGTGTCCCTAAGTGCAAGAAGG + Intergenic
1144160266 17:12551096-12551118 CAGTTTCCCCACCTGCAACATGG + Intergenic
1144328715 17:14205894-14205916 CAGTCTCCCCAGCACCCACATGG - Intronic
1144344393 17:14336935-14336957 CAGAGTCCCCACCAGCAAGAAGG - Intronic
1144711644 17:17405209-17405231 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
1145092318 17:19996113-19996135 GAGAGTCCCCACCAACAAGAAGG - Intergenic
1146125881 17:30231134-30231156 CAGTTTCCCCAGCATGAAAATGG + Intronic
1146461665 17:33050776-33050798 CAGTCTCCCCACCACCAAGCAGG - Intronic
1146659068 17:34652604-34652626 CAGTTTCCCCATCTGTAAGATGG - Intergenic
1146670965 17:34737340-34737362 CACAGTCCCTACCAGCAAGAAGG - Intergenic
1146696106 17:34910033-34910055 CACTGCCAACAGCAGCAAGAAGG + Intergenic
1146758472 17:35454495-35454517 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1146769666 17:35556963-35556985 CATTGTCCCCATCAGCAGGGAGG - Intronic
1146884008 17:36458993-36459015 CAGTGTCCCCAGCTAGAAAAAGG - Intergenic
1146917910 17:36689978-36690000 CAGGGTACCCAGCACCAACAGGG + Intergenic
1146956515 17:36939143-36939165 AAGTCTCCCCACCAGCAAGCTGG - Intronic
1147125130 17:38362301-38362323 CTGTGTTCCCTGCTGCAAGAGGG - Intronic
1148207533 17:45788536-45788558 CAGTGTCCCCAGCTATAAAATGG + Intronic
1148598770 17:48878262-48878284 CAGAGCCCTCAGCAGGAAGAGGG + Intergenic
1148663647 17:49358125-49358147 CAGTTTCCTCAGCAGCAGAATGG - Intronic
1148741028 17:49892723-49892745 CAGTTTCCCCATCTGCAAAATGG - Intergenic
1148752181 17:49951690-49951712 CAGTTTCCCCATCTGCAAAATGG - Intergenic
1149423786 17:56535349-56535371 CAGTGTCCTCATCTGCAAAATGG - Intergenic
1149632647 17:58139638-58139660 CAGAGTCCCCAACAGCAAGAAGG - Intergenic
1150032384 17:61753177-61753199 GAGAGTTCCCACCAGCAAGAAGG + Intronic
1150849300 17:68689209-68689231 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
1151043692 17:70894664-70894686 CAGTCTCCTCATCAGTAAGATGG - Intergenic
1151286367 17:73114455-73114477 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
1151376402 17:73691724-73691746 CAGTGACCCCAGCGGCAGAAGGG + Intergenic
1151729754 17:75904422-75904444 CAGCGTCCCCAGCATCCACAAGG + Intronic
1151827169 17:76529944-76529966 CAGTGTGGTCAGCAGCAGGAAGG + Intronic
1152400639 17:80064534-80064556 CAGTGTCCCCAGCTGTGACATGG - Intronic
1152724924 17:81940455-81940477 CCATGTCCCCAGCTGCAAAATGG + Exonic
1152963939 18:97512-97534 CAGTGTCTCCAGCCGCCAGCAGG - Intergenic
1153185086 18:2477499-2477521 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
1153725041 18:7945485-7945507 CAGAGTCCCCACCAGCAAGAAGG + Intronic
1153831826 18:8930506-8930528 CTGTGAGGCCAGCAGCAAGATGG + Intergenic
1153832234 18:8934050-8934072 CTGTGAGGCCAGCAGCAAGATGG + Intergenic
1153916853 18:9753439-9753461 CAGAGTCCTCACCAGCAGGAAGG + Intronic
1154091993 18:11373759-11373781 GAGAGTCCCCACCAGCAAGAAGG - Intergenic
1154094847 18:11403403-11403425 CAGAGTCCTCACCAGCAAAAAGG + Intergenic
1155046020 18:22103840-22103862 CAGTTTCCTCATCTGCAAGATGG - Intergenic
1155473903 18:26218900-26218922 CATTGTGCCCAGCTGCAAGTAGG + Intergenic
1155493370 18:26420872-26420894 CAGCATCCCCACTAGCAAGAGGG + Intergenic
1155573491 18:27220541-27220563 CAGTGTCCCCAGCTTCAATAGGG - Intergenic
1155853044 18:30796536-30796558 GAGAGTCCCCACCAGGAAGAAGG - Intergenic
1156037259 18:32778930-32778952 CAATGTCCCCAGCGGGAAAAGGG - Intergenic
1156164891 18:34406581-34406603 GAGAGTCCCCAACAGCAAGAAGG + Intergenic
1156253163 18:35371518-35371540 GAGGGTCTCCACCAGCAAGAAGG - Intronic
1156537428 18:37877860-37877882 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1156941617 18:42774060-42774082 CAGTGTCACCAGGAGCCAGTAGG + Intronic
1157023724 18:43817448-43817470 CAGAGTCCCCATCAGCAAGAAGG + Intergenic
1157158605 18:45291561-45291583 CAGTGTCCTCAGAGGCAAGAGGG + Intronic
1157235880 18:45965135-45965157 TCGTGTCCCCTGCAGCAACATGG + Intronic
1157248682 18:46074661-46074683 CAGAGTCCCTACCAGCAAGAAGG + Intergenic
1157289490 18:46399636-46399658 TGGTGGCCCCAGCAGTAAGAGGG - Intronic
1157341049 18:46778911-46778933 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1157401864 18:47395453-47395475 CTGTGTTCCCAGCAGGAGGAAGG + Intergenic
1157562209 18:48656359-48656381 CAGTCTCCCCATCAGTAAAATGG + Intronic
1157664554 18:49474902-49474924 CAGAGTCCTTACCAGCAAGAGGG - Intergenic
1157872907 18:51246801-51246823 CAGAGTCCTCATCAGCAGGAAGG + Intergenic
1158057595 18:53300481-53300503 CAGTGTTCCTAAGAGCAAGAAGG + Intronic
1158564492 18:58543189-58543211 GAGAGTCCCCAGCAGCAATAAGG + Intronic
1158809757 18:61018742-61018764 CAGTGCCCCCAACAGCAACGGGG - Intergenic
1159287438 18:66372797-66372819 CAGTGTCCCCAGCTCCATCAGGG - Intergenic
1159402971 18:67961006-67961028 CATTGTCCCCTGCAGCGAAAGGG + Intergenic
1160128228 18:76199167-76199189 GAGACTCCCCGGCAGCAAGAAGG + Intergenic
1160178232 18:76613096-76613118 TTGAGTCCCCAGTAGCAAGAAGG - Intergenic
1160653541 19:247087-247109 CAGTGTCCCCAGCTGCCAGCAGG - Intergenic
1160653589 19:247330-247352 CAGTGTCCCTAGCTGCCAGCAGG - Intergenic
1160738845 19:676807-676829 CAGTTTCCCCATCTGGAAGACGG - Intronic
1160755961 19:757318-757340 CAGCGTCCCCAGCATCCAGGCGG - Exonic
1160763262 19:796334-796356 CAGTTTCCCCAGCTGTAAGCGGG + Intergenic
1160768167 19:817887-817909 CAGTCTCACCAGCTGCAAAATGG + Intronic
1160875603 19:1295055-1295077 CAGTGTCCCCAACAGCCCCACGG - Intronic
1160970888 19:1767328-1767350 CAGTTTCCCCAACTGTAAGATGG - Intronic
1161129912 19:2581639-2581661 CAGTGTCCTCACCCTCAAGAAGG - Intronic
1161168543 19:2801717-2801739 CAGAGTCCCCACCAGGAAGAAGG - Intronic
1161314046 19:3609584-3609606 CAGTTTCCCGAGCAGCCAAATGG + Intergenic
1161331580 19:3690959-3690981 GAGTGTCCCCACCAGGGAGACGG - Intronic
1161377352 19:3946773-3946795 CAGTTTCCCCATCTGCAAAAAGG - Intergenic
1161394059 19:4035363-4035385 CAGTCTCCCCACCCGCAGGAAGG - Intronic
1161496373 19:4588337-4588359 CCGTGTTCACAGCAGCAAAAGGG + Intergenic
1161838241 19:6662395-6662417 CAGTTTCCCCATCGGCAAGATGG - Intronic
1161914885 19:7221060-7221082 CAGAGTCCCCACCGGCAAGAAGG + Intronic
1162195789 19:8983576-8983598 CAGAGTCCCCACCAGCAACAGGG + Intergenic
1162495208 19:11019589-11019611 AGGGATCCCCAGCAGCAAGACGG + Exonic
1162529245 19:11226297-11226319 CAGTTTCCCCATCAGTAAAATGG + Intronic
1162544717 19:11321814-11321836 TTCTCTCCCCAGCAGCAAGAGGG - Intronic
1162608030 19:11726646-11726668 CAGAGTCCCCACCAGCAAGGAGG + Intronic
1162678903 19:12323552-12323574 CAGAGTCCCCACCAGCAAGAAGG + Intronic
1162682188 19:12353954-12353976 CAGAGTCTCCACCAGCAAGGAGG + Intronic
1162685991 19:12384816-12384838 TAGAGTCCCCACCAGCAGGAAGG + Intronic
1162686883 19:12394258-12394280 CAGAGTCCCCACCAGCAAGAAGG + Intronic
1162691230 19:12434040-12434062 CAGAGTCCCCATCAGCAAGAAGG + Intronic
1163023193 19:14494921-14494943 CAGTGTGGCCAGCAGGAGGAGGG + Intronic
1163287378 19:16357216-16357238 CAGTGTCCCCAGCTGTCAGAGGG - Intronic
1163316607 19:16544728-16544750 CAGAGTCCCCACCAGCAAGAAGG + Intronic
1163352466 19:16786533-16786555 AAGTGTCCCCAACATAAAGATGG - Intronic
1163469803 19:17489512-17489534 TAGTTTCCCCAGCTGCAAAATGG - Intronic
1163581533 19:18142215-18142237 AAGTGTGCCTAGCAGCATGATGG - Intronic
1163758270 19:19119828-19119850 CCGTGTCCCCAGCTGCAAGGTGG - Exonic
1164399043 19:27890333-27890355 CTGTGTCCCCAGCAGGAATGAGG + Intergenic
1164549931 19:29201437-29201459 GAGAGTCCCCAGCAGCAAGAAGG + Intergenic
1164630013 19:29755913-29755935 ATGTGTCCTCAGCAGCAGGAGGG - Intergenic
1164876778 19:31696421-31696443 GAGAGTCCCCACCAGCAAGAAGG - Intergenic
1164934596 19:32201135-32201157 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
1165176790 19:33936280-33936302 CAGTTTCCCCATCAGTAATAGGG - Intergenic
1165526420 19:36359015-36359037 CAGAGTCCCCACCAGCAAGAAGG + Intronic
1165705812 19:37975494-37975516 CAGGGTCCCCATCTGTAAGATGG + Intronic
1165912130 19:39236102-39236124 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
1166007373 19:39916678-39916700 CAGTTTCCCCATCAGTAAGATGG + Intronic
1166213498 19:41321741-41321763 CAGAGCCCCCAGCAGCACCAAGG + Intronic
1166313982 19:41978412-41978434 CCATCTCCCCATCAGCAAGACGG + Intronic
1166554095 19:43686641-43686663 CAGTGCTCCCAGGAGCAACAGGG - Intergenic
1166653079 19:44589975-44589997 GAGAGTCCACACCAGCAAGAAGG + Intergenic
1166785051 19:45362675-45362697 CTGTGTCCCCAGCATGAAGCAGG + Intronic
1168091348 19:54087044-54087066 GAGAGTCCCCAACAGCAAGAAGG + Intergenic
1168336746 19:55601272-55601294 CAGTTTCCCCATCTGCAAAATGG + Intronic
1168351426 19:55678340-55678362 CAGGGGCCCCAGCAGGAAGGAGG + Intronic
1168539750 19:57200283-57200305 CAGTGTCCCCAGCTTCATCAGGG - Intronic
1168728542 19:58606375-58606397 CAGTGTGCCCAGCTGCCAGCAGG + Intergenic
1202713458 1_KI270714v1_random:29824-29846 GAGTGTGCCCAGGAGGAAGAGGG - Intergenic
924958499 2:11790-11812 CAGTGTCCCCAGCTGCCAGCGGG - Intergenic
925224249 2:2169080-2169102 CAGTTTCCCCATCAGTAAAATGG - Intronic
925575845 2:5358930-5358952 CAGTATCCCCAGCTTCATGAAGG + Intergenic
925608595 2:5684115-5684137 CTGGTTCCCCAGCAGCCAGAAGG + Intergenic
925909461 2:8564140-8564162 GAGTGTCCCCACCAGGCAGAGGG - Intergenic
926000192 2:9324498-9324520 CAGAGCGCCCACCAGCAAGAAGG - Intronic
926124136 2:10261356-10261378 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
926172195 2:10559350-10559372 CACTGTCCCGGGCAGCAGGATGG - Intergenic
926186550 2:10695343-10695365 CAGAGTCCCCATCAGCAAGAAGG + Intergenic
926233182 2:11020201-11020223 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
926421136 2:12700691-12700713 CAGTGACCCCACAAGAAAGATGG + Intergenic
926442292 2:12902580-12902602 TAGAGTCCCCGTCAGCAAGAAGG - Intergenic
926712813 2:15896249-15896271 CAGTTTCCCCAGCTGCAGGTTGG - Intergenic
926810752 2:16753345-16753367 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
927066638 2:19478295-19478317 GAGGGTCCCCACCAGCAAGGAGG - Intergenic
927264515 2:21129910-21129932 CAGAGTCCCCACTAGCAAGGTGG - Intronic
927446096 2:23162750-23162772 CCGCATCCCCACCAGCAAGAAGG + Intergenic
927467236 2:23346653-23346675 CTGTGTCCCCAGCACCCAGTGGG - Intergenic
927747031 2:25632668-25632690 GAGAGTCCCCAGCAGCAAGATGG + Intronic
928054083 2:28033437-28033459 CAGAGTCCCCAATATCAAGAAGG - Intronic
929080728 2:38119588-38119610 CAGTATCACCAGGAGCCAGAAGG - Intergenic
929207813 2:39318081-39318103 TAGTGTCCTCTGCAGCAACAAGG + Intronic
929601801 2:43209189-43209211 CAGTTTCCTCACCTGCAAGATGG - Intergenic
930000740 2:46859983-46860005 CAGTGACCCCAGAAGGAGGAAGG + Intergenic
930171330 2:48254759-48254781 GAGAGTTCCCATCAGCAAGAAGG - Intergenic
930256725 2:49101835-49101857 CAGAGTCCCCACCAGCAAGAAGG - Intronic
930536950 2:52654930-52654952 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
930576190 2:53151992-53152014 CAGTGTTCCCACCACAAAGAAGG - Intergenic
930909801 2:56618165-56618187 CAATGTCCCCAGCTTCAACAGGG - Intergenic
931134227 2:59378186-59378208 CACTGTCCCCATCAGCAGCAGGG + Intergenic
931794280 2:65694398-65694420 CAGTGTCCTCATCTGCAAAATGG - Intergenic
931832275 2:66065169-66065191 GAGAGTCCCCACCAGCATGAAGG - Intergenic
932127353 2:69156081-69156103 CAGTGGCCCCATCAGCAAGCTGG - Intronic
932136212 2:69231309-69231331 CAAGGTCCCCAGGAGAAAGATGG - Intronic
932166610 2:69513610-69513632 CACTGTGCCCAGCAGAAAGATGG + Intronic
932335173 2:70926858-70926880 CAGTTTCCCCACCAGTAAAATGG - Intronic
932637731 2:73407116-73407138 CAGAGTCCCCATCAGCAAGAAGG - Intronic
934673055 2:96228887-96228909 TAGAGTCCCCATCAACAAGAAGG - Intergenic
934692958 2:96375928-96375950 AAAGGTCCCCACCAGCAAGAAGG + Intergenic
934915744 2:98299720-98299742 CAGTGTCCTCATCTGCCAGAAGG - Intronic
935026959 2:99286144-99286166 AAGAGTCCCCACCAGCAAGAAGG + Intronic
935071828 2:99701092-99701114 CAGTGGCCGGAGCAGCAAGCTGG + Intronic
935331105 2:101978716-101978738 CAGTGCCCACAGCAGAAAGAGGG - Intergenic
935504994 2:103889447-103889469 CAGAGTCCCTACCAGCAAGAAGG + Intergenic
935536563 2:104301139-104301161 GAGCTTCCCCATCAGCAAGAAGG + Intergenic
935714391 2:105927209-105927231 CAGTTTCCCAAGCAGCAACTTGG - Intergenic
935743370 2:106170308-106170330 CAGTGTCTCCTGGAGCAGGAGGG - Intronic
936012801 2:108935994-108936016 CAGTGCCCACTGCAGGAAGAAGG + Intronic
936078361 2:109416029-109416051 CAGAGTCCCCACCAGCAAGAAGG + Intronic
936532125 2:113283704-113283726 CAGTTTCCTCATCTGCAAGATGG - Intergenic
936569367 2:113602006-113602028 CAGTGTCCCCAGCTGCCAGCAGG + Intergenic
936569962 2:113604324-113604346 CAGTGTGCCCAGCTGCCAGCAGG - Intergenic
937055984 2:118937228-118937250 CAGTGTTCCCAGAACCAAGCTGG + Intergenic
937091136 2:119206942-119206964 CACTGTGCCCAGCCCCAAGAAGG - Intergenic
937852910 2:126651362-126651384 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
937881809 2:126873045-126873067 GAGAGTCCTCATCAGCAAGAAGG + Intergenic
937909856 2:127070213-127070235 CAGTTTCCCCATCTGTAAGATGG + Intronic
937921742 2:127136299-127136321 GAGAGTCCCCAGCAGCATGAAGG + Intergenic
938078271 2:128353696-128353718 TAGAGTCCCCACCAGCAAGAAGG + Intergenic
938816369 2:134908678-134908700 CAGAGTCCCCACCAGTAAGAAGG - Intergenic
938918424 2:135968459-135968481 CAGAGTCCCCACCAGCAAGAAGG - Intronic
939231051 2:139426752-139426774 AAGAGTCCTCACCAGCAAGAAGG - Intergenic
939739285 2:145886030-145886052 ATGTGGCCCAAGCAGCAAGATGG + Intergenic
939844200 2:147223344-147223366 CACAGTCACCACCAGCAAGAAGG + Intergenic
940121562 2:150273648-150273670 GAGATTCCCCACCAGCAAGAGGG - Intergenic
940504736 2:154538868-154538890 CATAGTCCACAACAGCAAGAAGG + Intergenic
940879510 2:158932690-158932712 CAGTTTCCTCATCAGTAAGATGG + Intergenic
940890040 2:159026608-159026630 GAGAGTCCCTACCAGCAAGAAGG - Intronic
941034318 2:160551122-160551144 CAGTTTCCTCACCAGCAACATGG + Intergenic
941043515 2:160648643-160648665 CTGGGTCCCCAGCAGCAACTTGG - Intergenic
941125628 2:161580221-161580243 CAGTGTCCCCAGAAGCTGGTGGG - Intronic
941635006 2:167927013-167927035 GAGGGTCCCCATCAGCAAGAAGG - Intergenic
941667597 2:168258155-168258177 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
942341822 2:174957152-174957174 CAGTGTTCCTAAGAGCAAGAAGG - Intronic
942659968 2:178254021-178254043 GAGAGTCCCCACCAGCAAGAAGG + Intronic
943051032 2:182913532-182913554 CAGAGACCCCACTAGCAAGAAGG + Intronic
943212591 2:184987408-184987430 GAGAGTCCTCACCAGCAAGAAGG + Intergenic
943633353 2:190279078-190279100 GAGAGTCCCCACCAGCAAGAAGG - Intronic
943635685 2:190304337-190304359 CAGAGTCCCCACCAGTAAGAAGG - Intronic
943851099 2:192724090-192724112 CAGAGTCCCCACCAGGAAGAAGG - Intergenic
944389175 2:199199730-199199752 GAAAGTCCCCACCAGCAAGAAGG + Intergenic
944422385 2:199545175-199545197 CAGAGTCCTGACCAGCAAGAAGG - Intergenic
944428874 2:199611997-199612019 GAGAATCCCCAACAGCAAGAGGG + Intergenic
944428985 2:199613138-199613160 TAGAGTCCTCACCAGCAAGAAGG - Intergenic
944709039 2:202319329-202319351 CAGGGTCACCAGCAGCACCATGG + Intergenic
944874676 2:203950245-203950267 GAGTGTCCCCACCAGAAAGAAGG - Intronic
944910517 2:204306155-204306177 CAGTGTCCCCATCTGTAAAATGG - Intergenic
944918708 2:204388283-204388305 GAGAGTCCCTACCAGCAAGAAGG + Intergenic
944995581 2:205289867-205289889 GAGAGTCCCCACCAGCAAGAAGG + Intronic
945146328 2:206742356-206742378 CAGTGTCCCCAGCTTCATCAGGG - Intronic
945147658 2:206755318-206755340 CAGTGTCTCCATCTGCACGAAGG - Exonic
945158173 2:206860926-206860948 GAGTGTCCCCACCAGCAAGAAGG + Intergenic
945874439 2:215263605-215263627 TAGTGGCCCAAGCAACAAGAAGG - Intergenic
946021088 2:216640608-216640630 CAGTGTCCACACCTGCAAAATGG - Intronic
946121717 2:217521706-217521728 TAGAGTCCCCACCATCAAGAAGG - Intronic
946440977 2:219695542-219695564 AAGTGTTCCCATCAGCAAGAAGG + Intergenic
947857044 2:233331145-233331167 CAGTTTCCCCATCAGTAAAATGG - Intronic
948036288 2:234860928-234860950 GAGAGTCCCCACCAGCAAGAAGG - Intergenic
948060176 2:235037276-235037298 CAGTGTCCCCAGCTGCTTGGTGG + Intronic
948150235 2:235739135-235739157 CAGTGTCCCCAGATGCAAAGGGG - Intronic
948204270 2:236154287-236154309 CAGTCACCCTATCAGCAAGATGG + Intergenic
948320978 2:237069161-237069183 GAGAGTCCCCAACAGTAAGAAGG + Intergenic
948730310 2:239959310-239959332 TAGTGTCCTCAGCAGTGAGAGGG - Exonic
948900525 2:240954584-240954606 CAGTGTGCTCAGCAGCCAGGAGG + Intronic
949088800 2:242182017-242182039 CAGTGTGCCCAGCTGCCAGCAGG + Intergenic
1168850740 20:975210-975232 CAGTGTCCCCTGGAGCACCAGGG - Intronic
1168911929 20:1455193-1455215 CAGTGTGCCCAGCACCAACCTGG - Intronic
1168984610 20:2037493-2037515 CAGTGTCCTCAGCTGCAAAATGG - Intergenic
1169288641 20:4330414-4330436 GAGAGTCCCCACCAGCAAGAAGG - Intergenic
1169551791 20:6708557-6708579 AAGTCTCCTCACCAGCAAGAGGG - Intergenic
1169777150 20:9267994-9268016 GAGAGTCTCCACCAGCAAGAAGG + Intronic
1170118707 20:12889032-12889054 CTGTGTCCCCAGCAGAGTGATGG + Intergenic
1170157946 20:13285557-13285579 AAGAGTTCCCTGCAGCAAGACGG + Intronic
1170247860 20:14244147-14244169 CAGTTTCCCCAGCTACAAAATGG - Intronic
1170779499 20:19411513-19411535 AAGTGCATCCAGCAGCAAGAAGG + Intronic
1171037353 20:21726340-21726362 CAGAGTCACCACCAGCAGGAAGG - Intergenic
1171471714 20:25377476-25377498 CGGAGTCCCCACCAGCAAGAAGG - Intronic
1172031121 20:31982844-31982866 CAGAGGCCCCATCAGTAAGAAGG - Intronic
1172062149 20:32193909-32193931 CAGTGTCCTCAGCACCCACAAGG - Exonic
1172226585 20:33309485-33309507 CAGTGTCCCCATCTGCAAAATGG + Intronic
1172563959 20:35913579-35913601 CAGTGTGCCCTGCTGCAGGATGG + Intronic
1172629129 20:36366580-36366602 CAGTTTCCCCACCAGCCAAATGG - Intronic
1172694005 20:36809249-36809271 CAGTTTCCCCATCTGCAAAATGG + Intronic
1172768335 20:37362899-37362921 CAGTTTCCTCAGCGGCAAAATGG - Intronic
1172804478 20:37601590-37601612 AAGTGTCCCTATCAGCAAGAAGG + Intergenic
1172886316 20:38233508-38233530 CAGTTTCCTCATCAGCAAAATGG - Intronic
1172901664 20:38339494-38339516 TAGTCTCCCCAGCAGCCAGAGGG - Intergenic
1173449177 20:43147292-43147314 CAGTTTCCTCATCAGCAAAATGG + Intronic
1173457734 20:43216843-43216865 CACTGTGCCCCGAAGCAAGAAGG + Intergenic
1173907360 20:46638681-46638703 CAGTTTCCTCATCAGCAAAATGG + Intronic
1173920404 20:46740506-46740528 CAGCGTCCCTTGCAGCAAGAGGG + Intergenic
1174012494 20:47461761-47461783 AAGAGTCCCCAACAGCAAGAAGG - Intergenic
1174119337 20:48250540-48250562 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
1174219591 20:48943021-48943043 CAGTGTTCCTAACAGCAAGAAGG - Intronic
1174277590 20:49414955-49414977 CAGTCTCCCCATGAGTAAGATGG + Intronic
1174409996 20:50329046-50329068 CAGTGTTCCCAACTGCAAAATGG - Intergenic
1174483568 20:50847562-50847584 CAGTTTCCTCAGCTGTAAGATGG - Intronic
1174556758 20:51401013-51401035 CAGTCTCCCCAGCCACGAGATGG + Intronic
1174604426 20:51750657-51750679 CAGTGTCCTCATCTACAAGAGGG - Intronic
1174753542 20:53136073-53136095 GAGTGTCCCCACCAGCAAGAAGG - Intronic
1174919542 20:54686918-54686940 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
1175175827 20:57111495-57111517 CAGTTTCCCCTTCAGTAAGATGG - Intergenic
1175296938 20:57915025-57915047 CAGAGCCCCCACCAGCAAAAAGG - Intergenic
1175299926 20:57935500-57935522 AAGTGTCCCCACCAGCAACAAGG - Intergenic
1175368989 20:58474279-58474301 CAGTTTCCTCATCAGCAAAATGG - Intronic
1175850783 20:62091251-62091273 CAGGTTCCCCACCAGCAAGAGGG - Intergenic
1176146237 20:63566735-63566757 CAGTTTCCCCATCTGTAAGAGGG - Intronic
1176278048 20:64285699-64285721 CAGTGTCTCCAGCTGCCAGCAGG + Intronic
1176278092 20:64285942-64285964 CAGTGTCCCCAGCTGCCAGCAGG + Intronic
1176278106 20:64286004-64286026 CAGTGTCCCCAGCTGCCAGCAGG + Intronic
1176947252 21:14997842-14997864 CAGTTTCCCCATCTGCAAAATGG - Intronic
1176997801 21:15577557-15577579 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1177008489 21:15702903-15702925 GAGAGTCCCCACCAGAAAGAAGG + Intergenic
1177110831 21:17026339-17026361 CAATGTCCCAGGCAGGAAGATGG + Intergenic
1177366653 21:20148354-20148376 TAGTCTCACCACCAGCAAGAAGG + Intergenic
1177376347 21:20275137-20275159 GAGAGTCCTCATCAGCAAGAAGG - Intergenic
1177505963 21:22017181-22017203 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
1177666104 21:24161719-24161741 CAGAGTCCCCATCAGGAAGAAGG + Intergenic
1177912828 21:27053551-27053573 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1178012283 21:28302245-28302267 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1178269540 21:31177231-31177253 CAGTGTCCTCACCTGCAAAATGG - Intronic
1178633889 21:34285824-34285846 CAGTGTCCCCAGCTTCATCAAGG - Intergenic
1178760109 21:35394028-35394050 TAGAGTCCCCACCAGCAAGAAGG + Intronic
1178764185 21:35433608-35433630 CAGTGTCCCCAGCTTCATCAGGG + Intronic
1178838990 21:36123469-36123491 GAGAGTCCCCACTAGCAAGAAGG - Intergenic
1178846444 21:36177768-36177790 GAGAGTCTCCACCAGCAAGAAGG + Intronic
1179097723 21:38330541-38330563 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
1179194710 21:39154173-39154195 CAGAGGCCCCACCAGCAAGAAGG + Intergenic
1179437574 21:41373024-41373046 CTGTCTCCCCAGCTGCAATAAGG - Intronic
1179582940 21:42355751-42355773 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
1179651927 21:42816742-42816764 GAGAGTCCCCACCAGCAGGAAGG - Intergenic
1180097797 21:45567872-45567894 GAGGGTCCCCACTAGCAAGAAGG - Intergenic
1180213286 21:46308924-46308946 CAGAGTCCCCAACAGCAAGAAGG + Intronic
1180215149 21:46318781-46318803 CAGTGCCCCCAGCCCCAAGGTGG - Intronic
1180237105 21:46469337-46469359 CAGTGAACCCATCAGCAGGATGG + Intronic
1180659890 22:17457565-17457587 CTGTATCCCCAACAGCTAGACGG + Intronic
1180724842 22:17939183-17939205 CAGAGTCCCCACCAGCAAAAAGG + Intronic
1180756779 22:18167879-18167901 CAGTCTCTCCACCTGCAAGAGGG - Exonic
1181024339 22:20119367-20119389 CAGTGGACAGAGCAGCAAGATGG - Intronic
1181026230 22:20129355-20129377 GAGAGTCCCCAGCAGTGAGAAGG + Intergenic
1181074943 22:20369260-20369282 GAGAGTCCCCACCAGCAAGCAGG + Intronic
1181074985 22:20369564-20369586 CAGTCTCTCCACCTGCAAGAGGG + Exonic
1181462873 22:23095624-23095646 CAGTGTCCCCTGTGGCAAGAGGG + Exonic
1181684093 22:24516579-24516601 CAGTGTCCCCAGCAGGACAGGGG + Intronic
1181749003 22:24976132-24976154 CAGTGTTCCCAGCTGCAGCAGGG - Intronic
1181986827 22:26805690-26805712 CAATTTCCCCAGCTGCAAAATGG + Intergenic
1182048726 22:27297299-27297321 CAGTTTTCCCATCAGCAAAATGG - Intergenic
1182080418 22:27524814-27524836 CAGTGTCCCCATCTGTAGGATGG - Intergenic
1182538231 22:31022241-31022263 CAGAGTCCCCAACAGCAAGAAGG - Intergenic
1182547727 22:31085441-31085463 CAGTCTCCCCAACAGCACAACGG - Intronic
1182547836 22:31085849-31085871 CAGTGTCCCCATCTGGAAAATGG - Intronic
1182989663 22:34755007-34755029 AAGAGTCCCCACCAGCAAGGAGG - Intergenic
1183124334 22:35761230-35761252 CAGTGCCCCTATCAGGAAGAGGG - Exonic
1183230115 22:36576782-36576804 CAGTGTCCCCATCACACAGATGG - Intronic
1183409535 22:37646826-37646848 CCGAGGCCCCAGCAGCCAGACGG - Exonic
1183457560 22:37930888-37930910 CAGAGTCCCCAGCGGGGAGAGGG + Intronic
1183603271 22:38852395-38852417 TAGAGTCCCCACCAGCAAGAAGG + Intergenic
1183752252 22:39728195-39728217 CAGTTTCCCCATCTGTAAGAGGG + Intergenic
1184473995 22:44710953-44710975 CAGTGTCCCCATCTGGAAAATGG - Intronic
1184783137 22:46658967-46658989 CAGTGCCGCCAGCAGGAAGCAGG + Intronic
1184893170 22:47391742-47391764 CAGTGTCCCCATCGCCAACAGGG - Intergenic
1185344508 22:50305494-50305516 CAGTCTCCCCACCTGCAGGATGG + Intronic
1185357730 22:50384637-50384659 CAGTGTCCCCAGCAGCAAGAAGG - Intronic
949265452 3:2151817-2151839 GAGAGTCCCCACCAGCAAGAAGG + Intronic
949408401 3:3738575-3738597 GAATGTCTCCAGCAGCAAAATGG - Intronic
949638429 3:6009855-6009877 CAGTGTCCCTAGCTTCATGAGGG - Intergenic
949667376 3:6355830-6355852 AAAGGTCCCCACCAGCAAGAAGG - Intergenic
949872954 3:8605168-8605190 CAGTTTCCACATCAGCAAAATGG + Intergenic
950101924 3:10362488-10362510 CAGTTTCCCCATCTGTAAGATGG + Intronic
950107088 3:10395052-10395074 CAGTTTCCCCAGCTGCAAATTGG + Intronic
950168204 3:10817007-10817029 CAGTGTCCTCACCTGCAAAATGG - Intronic
950180631 3:10910759-10910781 CAGTCTCCTCAGCTGTAAGAGGG + Intronic
950194844 3:11001806-11001828 CAGTGTCCTCATCTGCAAAATGG + Intronic
950211658 3:11127698-11127720 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
950328715 3:12138595-12138617 CAGTTTCCCCATCAGCCAAATGG + Intronic
950555573 3:13693836-13693858 GAGAGCCCCCAGCAGCAAGAAGG - Intergenic
950633616 3:14299818-14299840 CAGTGTCCTCACCACCAACATGG + Intergenic
950673138 3:14539156-14539178 CAGTTTCCCCAACTGCAAAATGG + Intronic
950685002 3:14610514-14610536 AAGAGTCCCTACCAGCAAGAAGG + Intergenic
951180962 3:19658337-19658359 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
951359941 3:21713358-21713380 CAGTGCCCTCAGCACCAAGATGG - Intronic
951384189 3:22025093-22025115 CAGTGTCCCCAGCTTCATCAGGG - Intronic
952327846 3:32336963-32336985 CAGAGTCCCCACCAGCAAAAAGG - Intronic
952413068 3:33066452-33066474 CAGAGTCCCCACCAGCAAGAAGG + Intronic
952679437 3:36074126-36074148 CAGTCTCCCCAGCACCGACAGGG + Intergenic
952702917 3:36344665-36344687 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
952832421 3:37576213-37576235 CTGTGTGCCCAGCTGCAAGAAGG - Intronic
952852672 3:37741768-37741790 CAGTGGCACCATCAGCACGAGGG - Exonic
952920587 3:38281461-38281483 CAGAGTTCCCAACAGCAAGAAGG - Intergenic
953034320 3:39198773-39198795 GAGAGTCCTCACCAGCAAGAAGG + Intergenic
953141620 3:40234475-40234497 CAGTGTCTCCAGCAGCCCAAAGG + Intronic
953377603 3:42441849-42441871 ATGTGTTCCAAGCAGCAAGAGGG + Intergenic
953744498 3:45563664-45563686 CAGAGTTCCCACCAGCAAGAAGG + Intronic
953833673 3:46324950-46324972 GAGTATCCCCACCAGCAAGAAGG - Intergenic
953897748 3:46815170-46815192 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
954129338 3:48552147-48552169 CGGTGTCCCCAGCTGTAAAATGG + Intronic
954410223 3:50367358-50367380 CAGTGTGCCCAGCAGCAGGCAGG - Intronic
954511910 3:51132812-51132834 CAGTGTCCCCAGCTTCATCAGGG - Intronic
954529264 3:51304236-51304258 CAGTTTCCCCAGCACCAGCAGGG + Intronic
954539046 3:51381731-51381753 CAGAGGCCACAGCAGCATGAAGG + Exonic
954674748 3:52309561-52309583 CAGTGTCCCCACCTGCAAAAAGG + Intergenic
954690540 3:52393236-52393258 CAGTCTCCCCAGCAGCCGTAGGG - Intronic
955025015 3:55159227-55159249 CAGTCTCCCCACTAGAAAGAAGG - Intergenic
955330203 3:58041069-58041091 CAGTTTCCTCAGCTGCAAAACGG - Intronic
955683342 3:61525540-61525562 CTGTGTGCCAAGCAGCATGAGGG + Intergenic
956525577 3:70155983-70156005 CAGTGTCCTCATCTGCAAAATGG - Intergenic
956581159 3:70815317-70815339 CAGTGTCCATAGGAACAAGATGG + Intergenic
956641995 3:71424185-71424207 TAGTCTCACCAGCAGCAAGAAGG + Intronic
956741993 3:72282369-72282391 CAGAGTCCCCATCAGCAAGAAGG + Intergenic
956929337 3:74024953-74024975 CAAAGTCCCCACCAGGAAGAAGG + Intergenic
956984587 3:74684035-74684057 GAGAGACCCCACCAGCAAGAAGG - Intergenic
957055525 3:75439774-75439796 CAGTTTCCCCAGCTGTAAAATGG - Intergenic
957247887 3:77736002-77736024 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
957634092 3:82759463-82759485 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
957754256 3:84466699-84466721 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
957997659 3:87710748-87710770 CAGAGTCCCCAGCAGCAAGTAGG + Intergenic
958445301 3:94207656-94207678 CAAAGTCACCAACAGCAAGAAGG + Intergenic
958488688 3:94745375-94745397 CAGAGTCCCTACCAGCAAGAAGG + Intergenic
958616528 3:96500144-96500166 CAGTGTCCCCAAGAGAAAAAGGG + Intergenic
959133874 3:102392414-102392436 GAGGGTTCCCACCAGCAAGAAGG - Intronic
959893195 3:111579592-111579614 GAGAGTCCCCATCCGCAAGAAGG - Intronic
960259352 3:115547879-115547901 CAGAGTCCCCACCATGAAGAGGG + Intergenic
960766290 3:121134164-121134186 CAGAGTCCCTACCAGCAAGAAGG - Intronic
960962361 3:123081087-123081109 CAGTCTCCCTTGCAGCAAGGGGG - Intronic
961063993 3:123858509-123858531 AAGAGTCCCCACCAGCAGGAAGG - Intronic
961298864 3:125908832-125908854 CAGTTTCCCCAGCTGTAAAATGG + Intergenic
961314043 3:126022436-126022458 CAGAGTCCCCGCCAGCAAGAAGG - Intronic
961516627 3:127441972-127441994 GAGTGTCCGCTGCAGCAAGAAGG + Intergenic
961605066 3:128087526-128087548 CAGTCTCCCCATCTGAAAGATGG - Intronic
961889198 3:130116159-130116181 CAGTTTCCCCAGCTGTAAAATGG - Intergenic
962390504 3:134967618-134967640 CAGAGTCCCCACCAGCAAGAAGG + Intronic
962970109 3:140392911-140392933 CAGAGTCCCCACCGGCAAGAAGG - Intronic
963074161 3:141330867-141330889 GAGAGTCCCCACCAGCAAGAAGG + Intronic
963077934 3:141365367-141365389 GAGAGTCCGCACCAGCAAGAAGG - Intronic
963222986 3:142831375-142831397 GAGAGTCCCCACCAGCAAGAAGG + Intronic
963353992 3:144187339-144187361 CAGAGTCCTTATCAGCAAGAAGG + Intergenic
963377819 3:144492468-144492490 CAGTTTCCTCAGCTGCAAAATGG - Intergenic
964028890 3:152113318-152113340 GAGAGTTCCCACCAGCAAGAAGG - Intergenic
964145997 3:153464136-153464158 TAGAGTCCCCACCAGCAAGAAGG + Intergenic
964202813 3:154137346-154137368 GAGTGTCCCCACCGGCAAGAAGG + Intronic
964739284 3:159948675-159948697 CAGAATCCCCACCAGCAAGAAGG + Intergenic
964879134 3:161404273-161404295 GAGAATCCCCATCAGCAAGAAGG + Intergenic
965050295 3:163638292-163638314 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
965299272 3:166989482-166989504 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
965332865 3:167399050-167399072 CGGAGTCCCCACCACCAAGAAGG + Intergenic
965610980 3:170543681-170543703 CAGTCTCTCCAGGACCAAGAGGG + Intronic
966043280 3:175518586-175518608 GAGAGTCCCCATCAGCAGGAAGG - Intronic
966044676 3:175533581-175533603 CAGTGTCCCCAGCTTCATCAGGG + Intronic
966214597 3:177489619-177489641 CAGAGTCCCCATCAGCAAGAAGG - Intergenic
966223277 3:177571337-177571359 CAGAGCCACCACCAGCAAGAAGG - Intergenic
966400729 3:179544504-179544526 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
966445321 3:179995905-179995927 CAGTGTCCCCAGCTTCATCAGGG - Intronic
966757582 3:183385902-183385924 CAGTGTCCAAAGCAGGAAGAAGG - Intronic
966894992 3:184437888-184437910 GGGTGTCCCCACCAGCAAGAAGG + Intronic
966897573 3:184457283-184457305 AAGAGTCCCCACCAACAAGAAGG - Intronic
966900705 3:184482026-184482048 GAGAGTCACCACCAGCAAGAAGG - Intronic
967144286 3:186593067-186593089 CAGTGTCCTCACCAACAGGAAGG + Intronic
967215471 3:187206293-187206315 AATAGTCCCCACCAGCAAGAAGG - Intergenic
967403472 3:189089580-189089602 CAGAGTCCCCACCAGCAAGGAGG - Intronic
967689953 3:192462479-192462501 GAGAGTCCCTACCAGCAAGAAGG + Intronic
967762875 3:193244697-193244719 CAGAGTCTCCACCAACAAGAAGG - Intronic
967992886 3:195144698-195144720 CAGTTTCCCCTGCACCAAAAGGG + Intronic
968027186 3:195452265-195452287 CGGAGTCCCCACCAGCAAGAAGG - Intergenic
968275812 3:197439560-197439582 CAGTGTCCACTGGAGCAAGAAGG - Intergenic
968372962 4:11994-12016 CAGTGTCCCCAGCTGCCAGCAGG - Intergenic
968372975 4:12056-12078 CAGTGTCCCCAGCTGCCAGCAGG - Intergenic
968373024 4:12299-12321 CAGCGTCCCCAGCTGCCAGCAGG - Intergenic
968491686 4:893598-893620 CAGTGACGTCAGAAGCAAGAAGG + Intronic
968661342 4:1800028-1800050 CAGTCTCCCCATCAGCAACACGG - Intronic
968674160 4:1868482-1868504 GAGAGTCCACACCAGCAAGAAGG - Intergenic
968906507 4:3454953-3454975 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
968939285 4:3629736-3629758 CAGTTTCCCCAGCAGTAAATGGG - Intergenic
968998338 4:3960082-3960104 CAGTTTCCCCAGCTGTAAAATGG - Intergenic
969046787 4:4342161-4342183 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
969229307 4:5818710-5818732 CAGAGTCCCCACCAGCAAGAAGG + Intronic
969304132 4:6315784-6315806 CAGGCTTCCCAGCAGCAATAAGG - Intergenic
969755661 4:9148570-9148592 CAGTTTCCCCAGCTGTAAAATGG + Intergenic
969884587 4:10204042-10204064 CAGTGTCCCCAACAGCACTGGGG + Intergenic
969921514 4:10544803-10544825 CAGAGTCACCACCCGCAAGAAGG - Intronic
971331938 4:25688847-25688869 CAGAGTCCCCAGTGGCAAGAGGG + Intergenic
971335295 4:25717802-25717824 CATTTTCCTCAGCTGCAAGATGG + Intergenic
971422374 4:26485359-26485381 CAGTTTCCTCAACAGCAAAACGG + Intronic
971493375 4:27237871-27237893 GAGTGTCCTCACCAGCAAGAAGG - Intergenic
972239953 4:37179573-37179595 GAGAGTCCCTACCAGCAAGAAGG + Intergenic
972362125 4:38336372-38336394 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
972449163 4:39179946-39179968 GAGAGTCCGCACCAGCAAGAAGG + Intergenic
972642581 4:40939065-40939087 GAGAGTCCCCACCAGGAAGAAGG + Intronic
972805616 4:42527365-42527387 CAGTGTCCCCAGCTTCATCAGGG - Intronic
972866001 4:43233459-43233481 CAGATTCCTCACCAGCAAGAAGG - Intergenic
972876331 4:43365588-43365610 CACTGTCCCCAAGAGGAAGAAGG - Intergenic
973092651 4:46157651-46157673 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
973118085 4:46486366-46486388 CAGTGTCCCCAGCTTCATTAGGG - Intergenic
973841520 4:54865800-54865822 CAGAGTTCCCACAAGCAAGAAGG + Intergenic
974289254 4:59910095-59910117 CAGTGTCCCCAGCTTCAACAGGG - Intergenic
974354646 4:60796693-60796715 CATGGTCCCCACTAGCAAGAAGG - Intergenic
974384472 4:61187118-61187140 GAGGATCCCCATCAGCAAGAAGG + Intergenic
974472519 4:62337109-62337131 GAGTGTCCTCACCAGCAAGAAGG + Intergenic
974747245 4:66091597-66091619 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
975325247 4:73051781-73051803 CAGAGTCCCCACTAGCAAGAAGG - Intergenic
975334413 4:73158862-73158884 CAGAGTCCCTGCCAGCAAGAAGG + Intronic
975428256 4:74255805-74255827 CAGTGTCCTTTGCAGCAATATGG - Intronic
975715655 4:77203402-77203424 CTGTGTCCCTAGCAGCAGCAGGG + Intronic
976262646 4:83160282-83160304 GAGAGTCCCCACCAGCAAGAAGG - Intergenic
976367481 4:84246758-84246780 CAGTGTCCTCAGCACCCACAAGG + Intergenic
976607625 4:86997295-86997317 TAGAGTCCCCACCAGCAAGAAGG + Intronic
976748874 4:88433621-88433643 CAGAGTTCTCATCAGCAAGAAGG + Intronic
977430408 4:96925565-96925587 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
977490433 4:97702726-97702748 CAGTGTCCCCAGCTTCATCAGGG + Intronic
977722133 4:100251523-100251545 GAGAGTTCCCACCAGCAAGAAGG + Intergenic
977987638 4:103402752-103402774 CAGTGCCCCAAGAAGTAAGATGG - Intergenic
979018647 4:115467036-115467058 CAGAGTCCTCATCAGCAAGAAGG + Intergenic
979527644 4:121734262-121734284 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
979601728 4:122592800-122592822 GAGAGTCCCCACCAGGAAGAAGG + Intergenic
979621568 4:122804384-122804406 GAGAGTCCCCATCGGCAAGAAGG - Intergenic
979727580 4:123982731-123982753 CAGGGACCCCAGTACCAAGAGGG - Intergenic
980005411 4:127536615-127536637 CAGAGTCCCTACCAGCAAGAAGG + Intergenic
980041839 4:127948816-127948838 GAGAGTCCCCACCAGCAAGAAGG + Intronic
980497878 4:133608051-133608073 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
981275079 4:142889940-142889962 GAGAGTCTCCAGCAGCAAGAAGG - Intergenic
981361019 4:143845727-143845749 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
981371757 4:143966729-143966751 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
981380847 4:144069927-144069949 CAGAATCCCCACCAGCAACAAGG - Intergenic
981625179 4:146747275-146747297 CAGTGGCTCCAGTATCAAGATGG - Intronic
981849344 4:149210390-149210412 CAGAGTCCCCATCAGCAAGAAGG - Intergenic
982118909 4:152120351-152120373 GAGAGTCCCCACCGGCAAGAAGG + Intergenic
982429841 4:155310196-155310218 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
982508418 4:156250007-156250029 CACAGTCCCAATCAGCAAGACGG + Intergenic
982526852 4:156489746-156489768 CAGTGTCCCCAGCTTCATCAAGG - Intergenic
982690592 4:158543537-158543559 CAGTGTCTCCACAAACAAGATGG + Intronic
982835148 4:160113888-160113910 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
983163493 4:164447058-164447080 AAGGGTCTCCACCAGCAAGAAGG - Intergenic
983163710 4:164448955-164448977 CAGGGTTTCCACCAGCAAGAAGG - Intergenic
983184716 4:164688947-164688969 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
983238558 4:165207102-165207124 CAGTGTCCCAGGCAGGAAGCAGG - Intronic
983895119 4:173072980-173073002 CAGAGTCTCCACCAGCAAGAAGG + Intergenic
984147370 4:176079785-176079807 CAGAGTCCCAACCAGCAGGAAGG - Intronic
984435895 4:179709778-179709800 GAGAGTCCCCACCAGCAGGAAGG - Intergenic
984755386 4:183321786-183321808 CAGTGTCCCTACCTGGAAGATGG - Exonic
984882710 4:184424611-184424633 GAGGGTCCCCACCAGCAAGAAGG + Intronic
984973489 4:185210134-185210156 CAGGATCCCCAGCAGGAAGGCGG - Intronic
985013576 4:185608888-185608910 CTAAGTCCCCAGGAGCAAGAGGG - Intronic
985375587 4:189334047-189334069 GAGTGTTCCCACCAGCAAGAAGG - Intergenic
985462420 4:190120511-190120533 CAGTGTCCCCAGCTGCCAGCAGG + Intergenic
985462433 4:190120573-190120595 CAGTGTCCCCAGCTGCCAGCAGG + Intergenic
985466631 4:190203224-190203246 CAGTGTGCCCAGCTGCCAGCAGG + Intergenic
985495524 5:202631-202653 CAGTGTCCACACCAGCTTGAAGG + Exonic
985556536 5:561377-561399 CAGTTTCCCCATCAGCAAGATGG + Intergenic
985615282 5:916394-916416 CACTGTCCCCAGCAGCCGGTTGG + Intronic
986037388 5:3953114-3953136 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
986150723 5:5127935-5127957 CAGTGTCCTCATCAGTAAAATGG - Intergenic
986829264 5:11558217-11558239 CTGTATCCCCTGCACCAAGATGG - Intronic
986855939 5:11868813-11868835 CAGAGTCTCCAGCAGCAAGAAGG + Intronic
986955885 5:13148809-13148831 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
986984807 5:13488437-13488459 GAGAGTCTCCATCAGCAAGAAGG + Intergenic
987159431 5:15125892-15125914 GAGAGTCCCCACCAGTAAGAAGG + Intergenic
987504055 5:18747189-18747211 CAGTGTCCCCAGCATCATCAGGG - Intergenic
988186397 5:27869145-27869167 GAGTGTTTCCACCAGCAAGAAGG + Intergenic
988443878 5:31263177-31263199 GAGAGTCCCCACCAGTAAGAAGG - Intronic
988561771 5:32288212-32288234 CAGTGTCCCCAGCTTCATCAGGG - Intronic
988788265 5:34584091-34584113 GAGAGTCCCCACCAGAAAGAAGG - Intergenic
989005341 5:36804658-36804680 CCGAGTCCCTACCAGCAAGAAGG + Intergenic
989457998 5:41664438-41664460 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
989722345 5:44544105-44544127 GAGAGTCCTCACCAGCAAGAAGG + Intergenic
990339966 5:54812796-54812818 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
990449530 5:55921798-55921820 CAATGTCCCCAGGAGCACGGAGG - Intronic
990463611 5:56052013-56052035 GAGAGTCCCCATCAGCAAGAAGG - Intergenic
990828640 5:59931465-59931487 GAGGGTCCCCACCAGCAAGAAGG - Intronic
990969053 5:61483146-61483168 CAGAGTCCCCACCAGCAAGAAGG - Intronic
991030593 5:62078203-62078225 CAGTGGTGCCAGCAGCAACAGGG + Intergenic
991168716 5:63594674-63594696 GAGAGTTCCCACCAGCAAGAAGG + Intergenic
991246369 5:64512503-64512525 CAGTTTCCTCAACAGCAAAATGG + Intronic
991332824 5:65510940-65510962 CAGAGTCACCAGCAGCAAGAGGG + Intergenic
991474193 5:67002737-67002759 CATTTTCCCCAGCTGCAATATGG - Intronic
992035843 5:72775169-72775191 AAGAGGCCCCACCAGCAAGAAGG + Intergenic
992056393 5:72995643-72995665 CAGACTCCCCACAAGCAAGAAGG - Intronic
992116066 5:73539534-73539556 CACTGTGCCCAGCTGCCAGAAGG + Intergenic
992198942 5:74365617-74365639 CAGTGATCCCAGCACCAAGTGGG + Intergenic
992214180 5:74509046-74509068 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
992242548 5:74786901-74786923 CTGTGTCCCCAGCATCATCAGGG - Intronic
992729428 5:79646176-79646198 TAGTGTCCCCAAGTGCAAGAAGG + Intronic
992833085 5:80614584-80614606 GAGAGTCCCCACCAGCAAGAAGG - Intergenic
993123450 5:83803235-83803257 CAAAGTTCCCACCAGCAAGAAGG - Intergenic
993319497 5:86455932-86455954 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
993412928 5:87594487-87594509 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
993565924 5:89475339-89475361 CATTGTTCCTGGCAGCAAGAAGG - Intergenic
993593722 5:89827005-89827027 CAGTCACGGCAGCAGCAAGAAGG + Intergenic
993791433 5:92216238-92216260 CAGTGTCCCCAGCTTCATCATGG - Intergenic
993837661 5:92835144-92835166 CAGTTTCCCCAGCACCACCAGGG + Intergenic
993945710 5:94115040-94115062 TTGTGTCCCCAGCATCTAGATGG - Intergenic
994379353 5:99053009-99053031 GAGAGTCCCCATCAGCAGGAAGG + Intergenic
994640082 5:102396809-102396831 CAGAGTACCCACCAGCCAGAAGG - Intronic
995264169 5:110138905-110138927 CAGTCTCCCCAGCACCAGCAGGG + Intergenic
995345639 5:111113732-111113754 CAGAGTCTCCACCAGCAAGAAGG - Intronic
995381355 5:111537823-111537845 CAGTGTCCTCATCTGTAAGAAGG + Intergenic
995443960 5:112222433-112222455 CAGTATCCCCATGAGAAAGATGG - Intronic
995571994 5:113490349-113490371 CAGAGTCCCCACCAGCAGGGTGG + Intergenic
995572280 5:113492682-113492704 CAGAGTTTCCACCAGCAAGAAGG + Intergenic
996102578 5:119459639-119459661 CAGAGTCCCCACCAGAAAGGAGG - Intronic
996165302 5:120215202-120215224 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
996734596 5:126747186-126747208 GAGAGTCTCCACCAGCAAGAAGG - Intergenic
996783069 5:127209516-127209538 CTGAGTCCCTACCAGCAAGAAGG - Intergenic
996785308 5:127230698-127230720 CAGTCTCCCCATCTGCAAAATGG - Intergenic
997189124 5:131914149-131914171 GAGAGTCCCCATCAGCAAGAAGG + Intronic
997472963 5:134126951-134126973 CAGTTTCCCCATCTGCAAAAAGG - Intronic
997618455 5:135269600-135269622 CAGTGTCCCAGGCAACAACACGG + Intronic
997903382 5:137789724-137789746 CACGGTCCCCACCAGCAATAAGG - Intergenic
998133921 5:139664866-139664888 CAGTGTCCTCATCTGCAAAATGG + Intronic
998166339 5:139846554-139846576 CAGGTTCCCCAGCAGCCAGTGGG + Intergenic
998225521 5:140323427-140323449 CAGTGGCCCCAGCAGCCGGGTGG - Intergenic
998290694 5:140911264-140911286 CAGTGTCCCCAGCTTCATCAGGG + Intronic
998335048 5:141364377-141364399 CAGCGTCCCCAGGAGCATGAAGG - Exonic
999134853 5:149311807-149311829 CAGTGTCCACATCTGCAACATGG - Intronic
999138058 5:149336572-149336594 GAGAGACCCCATCAGCAAGAAGG - Intronic
999600402 5:153256401-153256423 CAGTGTCCTCATCAGAAAAATGG - Intergenic
999711775 5:154324228-154324250 CAGTGTCCCCAGCTGCTGGCAGG + Intronic
999762609 5:154714069-154714091 CAGTTTTCCCAGCTGCAAAATGG + Intronic
1000039032 5:157471448-157471470 CATTGTCCCCATCTGCAAAATGG - Intronic
1000153512 5:158527463-158527485 GAGAGTCCTCACCAGCAAGAAGG + Intergenic
1000267572 5:159652422-159652444 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
1000730425 5:164828287-164828309 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1001398083 5:171430880-171430902 CAGTTTTCCCATCAGCAAAATGG - Intronic
1001422770 5:171599948-171599970 CAGTTTCTGCAGCAGCAAGGGGG + Intergenic
1001440758 5:171741030-171741052 GAGAGTCCCCACCTGCAAGAAGG - Intergenic
1001454088 5:171847612-171847634 CAGGGTCCTCATCTGCAAGATGG - Intergenic
1001596457 5:172901970-172901992 CAGTTTCCCCAGCTGTAACATGG - Intronic
1001654644 5:173340239-173340261 GAGAGTCCCAAGCAGCAAGAAGG + Intergenic
1001718934 5:173840752-173840774 CAGTTTCCCCATCAGTAAAATGG - Intergenic
1002053135 5:176583212-176583234 CAGTGTCCTCATCTGCAAAATGG - Intronic
1002086798 5:176780978-176781000 CAGTGTCTCCATGAGCAGGAAGG + Intergenic
1002309268 5:178304812-178304834 CAGTTTCCTCATCAGCAAGTGGG + Intronic
1002334229 5:178466946-178466968 CAGTTTCCCCAGCTGTAAAATGG + Intronic
1002521762 5:179796282-179796304 CAGCGCCACCAGCAGCCAGAGGG - Exonic
1002591699 5:180295152-180295174 CAGAGTCCCCAGCAGCAAGAAGG + Intergenic
1002754798 6:148599-148621 CAGTGTCCCCAGCTGCCAGCAGG - Intergenic
1002754847 6:148842-148864 CAGTGTCTCCAGCTGCCAGCAGG - Intergenic
1002792875 6:448503-448525 CAGAATCCCCACCAGCAAGAAGG + Intergenic
1002857529 6:1051452-1051474 GAGAGGCCCCACCAGCAAGAAGG - Intergenic
1002933049 6:1647417-1647439 GAGTGTCCCCAGCAGGCTGAAGG + Intronic
1003232717 6:4269225-4269247 CAGAGTCTCCACCAGCCAGAAGG + Intergenic
1003253692 6:4456057-4456079 CAGTGTTCCAGGCTGCAAGAAGG + Intergenic
1003326658 6:5097137-5097159 GAGAGTCTCCACCAGCAAGAAGG - Intergenic
1003459423 6:6316818-6316840 CAGTTTCTCCATCAGCAAAATGG - Intronic
1003513258 6:6799167-6799189 CAGTGTCCCTACCAGCAGGAAGG - Intergenic
1003613793 6:7636897-7636919 CAGAGTCCCCTCCAGCAAGAAGG - Intergenic
1003616417 6:7659020-7659042 GAGAATCCCCACCAGCAAGAAGG - Intergenic
1003642818 6:7889627-7889649 CAGTAGCCCCATTAGCAAGAAGG - Intronic
1003649062 6:7941559-7941581 GAGAGTCCCCACCAGCAAGAAGG - Intronic
1004043002 6:12000353-12000375 CAGTGTCCCCATCTGTAAAATGG - Intergenic
1004824660 6:19405899-19405921 CAGTGTCCCCAGCTTCAGCAGGG + Intergenic
1005107192 6:22236432-22236454 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
1005506939 6:26477687-26477709 CTCTGTCACCAGCAGCCAGAGGG - Intergenic
1006207646 6:32362380-32362402 GAGAGTCCCCAGTAGCAAGAAGG + Intronic
1006241138 6:32679937-32679959 CAGTCTCCCCAGCAGTGGGACGG + Intergenic
1006424443 6:33955552-33955574 CAGTTTCCTCATCTGCAAGATGG + Intergenic
1006674403 6:35751875-35751897 CAGTGTATTCAGCAGCAAGAAGG - Intergenic
1006778932 6:36618683-36618705 CAGTCTCCCCAGCTGGAAGTAGG + Intergenic
1006818351 6:36869370-36869392 CAGAGTCCCCACCAGCAAGAAGG - Intronic
1007375659 6:41454956-41454978 CAGTGACCCAGGCACCAAGATGG - Intergenic
1007396323 6:41579931-41579953 CAGTTTCCTCATCTGCAAGATGG - Intronic
1007526872 6:42503708-42503730 CAGAGTCCTCACCAGCAAGAAGG - Intergenic
1008399925 6:51052809-51052831 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1008448773 6:51624771-51624793 CAGTGTCCTCATCAGTAACATGG - Intronic
1009723699 6:67508486-67508508 GAGAGACCCCACCAGCAAGAAGG - Intergenic
1010189376 6:73179266-73179288 GAGAGTCCCCACCAACAAGAAGG - Intronic
1010325666 6:74559269-74559291 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
1010552080 6:77236049-77236071 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1010581070 6:77596416-77596438 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
1010583131 6:77623892-77623914 GAGAATCCCCACCAGCAAGAAGG - Intergenic
1010818237 6:80385435-80385457 CAGTGTCCCCAGCTTCAACAGGG - Intergenic
1011039717 6:83015939-83015961 CAGTGTCCCCAGCTTCATCAGGG + Intronic
1011257601 6:85439122-85439144 CAGTTTTCCCAGCATCAATAGGG + Intergenic
1011324629 6:86136049-86136071 GAGAGTCCCCACCAGCAAGAAGG - Intergenic
1012865878 6:104617223-104617245 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
1013043193 6:106457201-106457223 GAGAGTCCCTACCAGCAAGAAGG - Intergenic
1013175561 6:107673679-107673701 GAGAGGCCCCATCAGCAAGAAGG - Intergenic
1013248019 6:108306190-108306212 CACTGTGCCCAGCCTCAAGATGG + Intronic
1013357228 6:109356755-109356777 GAGGGTCCCCACCAGCAAGAAGG + Intergenic
1014019189 6:116568039-116568061 CAGAGTCCCCACATGCAAGAAGG + Intergenic
1014081097 6:117286726-117286748 CAGTGTCTCTTGCAGTAAGAAGG - Intergenic
1014227417 6:118863771-118863793 GAGAGTCCTCATCAGCAAGAAGG + Intronic
1014589322 6:123243840-123243862 CAATGTCCCCAGGAGCAAAGAGG + Intronic
1014932754 6:127353476-127353498 CAGAGTTCCTATCAGCAAGAAGG - Intergenic
1014948829 6:127530245-127530267 GAGGGTCCCCACCAGCAAGAAGG - Intronic
1015467280 6:133560897-133560919 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
1015475383 6:133654651-133654673 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1015538210 6:134288114-134288136 CATTTTCCCCAGCTGTAAGAAGG - Intronic
1015810266 6:137155420-137155442 GAGAGTCCCCACCAGCAAGAAGG - Intronic
1015935055 6:138400798-138400820 GAGAGTCCCCACCAGCAGGAAGG - Intergenic
1016198224 6:141373256-141373278 TGGAGTCCCCATCAGCAAGAGGG + Intergenic
1016386029 6:143531685-143531707 GGGAGTCCCCACCAGCAAGAAGG + Intergenic
1016420336 6:143875952-143875974 CAGTGTCCCCAGCTTCATCAGGG + Intronic
1016440314 6:144076549-144076571 GAGAGTCCCCACAAGCAAGAAGG + Intergenic
1016623970 6:146144477-146144499 CAGTGTCCCCACTAGCAACAAGG + Intronic
1017044501 6:150334490-150334512 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
1017232524 6:152088679-152088701 CAGAGTCCCCAGCAGAAAGAAGG + Intronic
1017363006 6:153598630-153598652 CAGAGTAACCATCAGCAAGAAGG - Intergenic
1017443790 6:154489240-154489262 CATCGTGCCCAGCAGCAATAGGG - Intronic
1017484224 6:154888328-154888350 CAGAGTCCCCATCAGCAAGAAGG - Intronic
1017767672 6:157620206-157620228 CAGTGTCCCCATCAGCAAGAAGG - Intronic
1017931650 6:158960642-158960664 AAGGGTCCCCACCAGCAAGAAGG - Intergenic
1018411162 6:163550194-163550216 CAGAGTCCCCACCAGCAAGAAGG - Intronic
1018458123 6:163971240-163971262 CAGTGTCCCCACCAGCTGGGTGG - Intergenic
1019207388 6:170373923-170373945 CAGAGCCCCCAGCACCAACATGG + Intronic
1019416898 7:932005-932027 CAGAGTCCCCAGCAAGAAGCCGG + Intronic
1019552282 7:1608999-1609021 CACTGTCCCCAGCAGCAAGGAGG - Intergenic
1019623246 7:2002788-2002810 CACTGTCCCCAGCAGGGAGCTGG - Intronic
1019926114 7:4193525-4193547 CAGTGTCCCCAGCTTCATCAAGG + Intronic
1020031777 7:4938378-4938400 CAGCATCCTCAGCAGCAAGAAGG - Intronic
1020351795 7:7227824-7227846 GAGAGTCCTCAACAGCAAGAAGG + Intronic
1020396360 7:7722861-7722883 CAGTGTCCCCAGCTTCATCAGGG - Intronic
1020709968 7:11594943-11594965 CAGTGTCCCCAGCTTCATCAGGG - Intronic
1021110981 7:16694375-16694397 CAGAGTCCCCACCAGCAAGAAGG - Intronic
1022203221 7:28137914-28137936 CAGTCTCCCCATCAGGAAAATGG - Intronic
1022412628 7:30150890-30150912 CAGTGTCCCCAGCTTTAAAATGG + Intronic
1022506757 7:30912364-30912386 CAGTGTCCCCATCTGCACAATGG - Intronic
1022507756 7:30917094-30917116 CAGTTTCCCCATCAGTAAAATGG - Intronic
1023036554 7:36136199-36136221 CAGAGTCTCCACCAGCAAGAAGG - Intergenic
1023642137 7:42269980-42270002 CAGAGTCTCCACCAGCAAGAAGG - Intergenic
1023715298 7:43037759-43037781 CAGAGTCGCCAACAGCAAGAAGG + Intergenic
1023729416 7:43176506-43176528 CAGAGTCCCCACCAGTAAGAAGG - Intronic
1023795357 7:43787804-43787826 CAGGGTCCCGACGAGCAAGATGG - Intronic
1023827402 7:44018867-44018889 CAGTGTCCTCATCTGCAAAATGG + Intergenic
1024116700 7:46201074-46201096 CAGAGTCCCTACCAGCAAGAAGG - Intergenic
1024210667 7:47200631-47200653 CAGTGGCCCCAGCTGCATGTAGG + Intergenic
1024240607 7:47432380-47432402 CAGAATCCCCAACAGCAAGAAGG + Intronic
1024302522 7:47898053-47898075 GAGTGTCCACAGCAGCAGGGAGG + Exonic
1024467319 7:49725321-49725343 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
1024611962 7:51073836-51073858 CAGTGTCACCATTATCAAGATGG - Intronic
1024673350 7:51616531-51616553 CAGAGTCCCCACTAGCAGGAAGG - Intergenic
1024822740 7:53352537-53352559 GAGGGGCCCCACCAGCAAGAAGG - Intergenic
1024921657 7:54563509-54563531 CAGTGTCCCCAGCAGGAGGAAGG + Intronic
1024985589 7:55190939-55190961 CAGTGACCCCAGCAGCCAGCAGG + Intronic
1026241101 7:68575860-68575882 GAGAGTCCTCACCAGCAAGAAGG - Intergenic
1026272307 7:68847206-68847228 GAGTGTCCCCACCAGCAACGAGG + Intergenic
1026335034 7:69386838-69386860 GGTTGTCCCCAGCTGCAAGAGGG - Intergenic
1028194285 7:87887628-87887650 CAGAGTCTCCACCAACAAGAAGG - Intronic
1028427527 7:90706897-90706919 TAGTCTCCCCTGAAGCAAGAGGG - Intronic
1028534096 7:91872044-91872066 CAGAGTCCCCACCAGCAAGAAGG + Intronic
1028801687 7:94972830-94972852 CAGTCTCCCCATCAGTAACATGG - Intronic
1028990784 7:97046856-97046878 GAGAGTCCCCACCAGTAAGAAGG + Intergenic
1029167420 7:98602565-98602587 GAGAGTCCCCATCAGCAAGGAGG + Intergenic
1029198535 7:98823372-98823394 CAGTGTCCACATCTGCAAAATGG - Intergenic
1029458877 7:100684359-100684381 CAGTGCCCCCAGCAGGGAGGAGG + Intronic
1029662710 7:101973586-101973608 CCGTGTCCCCTGCACCCAGATGG + Intronic
1029738558 7:102478614-102478636 CAGTGTCCTCATCTGCAACATGG + Intronic
1029773637 7:102671358-102671380 CAGTGTCCTCATCTGCAACATGG + Intronic
1029946692 7:104540726-104540748 CAGTTTCCCCACCTGAAAGAGGG - Intronic
1030028923 7:105351242-105351264 CAGAGTCCCCACCAGCAAGAAGG + Intronic
1030277099 7:107733437-107733459 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1030368195 7:108670283-108670305 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1030704200 7:112674504-112674526 GAGAGTCCCCAGCAACTAGACGG - Intergenic
1030860653 7:114621772-114621794 CAGTGTACCCAGCGGCAGGAGGG + Intronic
1030879597 7:114861212-114861234 GAGGGTCCCCGCCAGCAAGAAGG + Intergenic
1031251674 7:119390799-119390821 CAGAGTACCCATCAGCAAAAAGG - Intergenic
1031744979 7:125484331-125484353 CAGAATCCCCACCAGCAAGAAGG - Intergenic
1032010112 7:128340443-128340465 CAGAGTCCCCACCAACAAGAAGG + Intronic
1032547513 7:132756104-132756126 CATTTTCCCCAGTAGCAAAAGGG + Intergenic
1033262178 7:139853470-139853492 CAGTGTTCCCATCTGCAAAACGG + Intronic
1033262399 7:139855121-139855143 CAGAGTCCCCACCAGCAAGAAGG + Intronic
1033561541 7:142536698-142536720 CAGAGTCCTCACCAGCAAGAAGG - Intergenic
1033724872 7:144104164-144104186 CAGTGCCCCCATCTGCAAAATGG - Intergenic
1033778589 7:144642822-144642844 CAGTGTCCCCATCTGTAAGTTGG + Intronic
1034204344 7:149302584-149302606 AAGGGGCCCCAGCAGCAAGTAGG - Intergenic
1035513056 8:206823-206845 CAGTGTCCCCAGCTGCCAGCAGG - Intergenic
1035513071 8:206884-206906 CAGTGTCCCCAGCTGCCAGCAGG - Intergenic
1035513120 8:207125-207147 CAGTGTCCCTAGCTGCCAGCAGG - Intergenic
1035879776 8:3233370-3233392 CAGAATCCCCACCAGCAAGAGGG + Intronic
1036049858 8:5184301-5184323 GAGAGTCCCCATCAGCAAGAAGG + Intergenic
1036142032 8:6217542-6217564 CAGTGTCCCCAGCCTCATCAGGG - Intergenic
1036378908 8:8223876-8223898 CAGTTTCCCCAGCTGTAAAATGG + Intergenic
1036470844 8:9051258-9051280 CAGAGTCCCCACCAGCAACAAGG - Intronic
1036695456 8:10971700-10971722 TAGTGTCCCCATTGGCAAGAGGG - Intronic
1036850658 8:12198724-12198746 CAGTTTCCCCAGCTGTAAAATGG - Intergenic
1036872023 8:12440989-12441011 CAGTTTCCCCAGCTGTAAAATGG - Intergenic
1037244662 8:16819302-16819324 CAGGGTTTCCAGCAACAAGAGGG - Intergenic
1037249597 8:16877139-16877161 CAGTGCCCCCAGCACCAGCAAGG + Intergenic
1037484675 8:19336143-19336165 CAGTTTCCCCAGCTGTAAAATGG - Intronic
1037606387 8:20441210-20441232 CAGTGTCCCCATCTGTAAAATGG - Intergenic
1037928521 8:22864061-22864083 CTGTGTGCCCAGGAGCAAGGCGG - Intronic
1037931293 8:22881866-22881888 AAGTTTCCCCAGCAGTAAAATGG + Intronic
1038001966 8:23399585-23399607 CCAAGTCCCCACCAGCAAGAAGG + Intronic
1038158827 8:25017210-25017232 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
1038187771 8:25291259-25291281 CAGTTTCCACAGTTGCAAGAGGG + Intronic
1038448636 8:27623521-27623543 GAGAGTCCCCACCAGCAAGAAGG - Intergenic
1038691864 8:29771614-29771636 CAGAGTCCCCACCAGCAGGAAGG + Intergenic
1038821086 8:30952407-30952429 GAGAGTCCCCACCAGCAAGAAGG - Intergenic
1039073845 8:33670954-33670976 GAGAGTCCCCATCAGCAGGAAGG + Intergenic
1039204429 8:35135151-35135173 GAGAGTCCTCATCAGCAAGAAGG - Intergenic
1039252288 8:35679901-35679923 GGGAGTCCCCACCAGCAAGAAGG - Intronic
1039320983 8:36430848-36430870 GAGAGTCCCCACCAGCAAGAAGG - Intergenic
1039704327 8:39991486-39991508 CAGTGTACATAGCAGTAAGATGG + Intronic
1039787890 8:40849664-40849686 CCATGTCCACAGCACCAAGACGG + Intronic
1040055758 8:43056038-43056060 TAGTGGCCCCAGCAGGGAGAGGG - Intronic
1040454755 8:47585690-47585712 CAGAGTCTCCACCAGCAAGAAGG - Intronic
1040841804 8:51792638-51792660 CAGTCTCCCCAGCACCAGCAGGG - Intronic
1041029832 8:53725316-53725338 CAGAGTCCTCACCAACAAGAAGG + Intronic
1041153971 8:54964503-54964525 CAGAGTCACCACCAGCAAAAAGG + Intergenic
1041356686 8:57007904-57007926 GAGTGTCCCCACCAGCAAGAAGG + Intergenic
1041361482 8:57059152-57059174 GAGAGTCCCTACCAGCAAGAGGG - Intergenic
1041768509 8:61446484-61446506 CATAGTCCCCACCAGCAAGAAGG - Intronic
1041985841 8:63921810-63921832 CAGTGTCCCCAGCCTCATCAGGG - Intergenic
1042442058 8:68839921-68839943 CAGTCTCCCCATCTGCAAAATGG - Intergenic
1042624919 8:70747540-70747562 GAGAGTTCCCACCAGCAAGAAGG + Intronic
1042724293 8:71856249-71856271 CAGAGTTCCCATTAGCAAGAAGG + Intronic
1042867472 8:73368455-73368477 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
1043100534 8:76039746-76039768 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
1043134563 8:76505264-76505286 CAGACTTCCCACCAGCAAGAAGG - Intergenic
1043169059 8:76941223-76941245 CAGAGACCCCATCAGCAAGAAGG - Intergenic
1043257663 8:78156714-78156736 CAGTGTCCCCAGCTTCAGCAGGG - Intergenic
1043260304 8:78186824-78186846 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
1043340471 8:79231377-79231399 CACTGCACCCAGCTGCAAGATGG + Intergenic
1043563185 8:81519093-81519115 GAGAGTACCCACCAGCAAGAAGG - Intergenic
1043571826 8:81612499-81612521 AAGAATCCCCACCAGCAAGAAGG + Intergenic
1043811729 8:84750790-84750812 TAGGGTCCCCACTAGCAAGAAGG + Intronic
1044150461 8:88770454-88770476 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1044195541 8:89372721-89372743 CAGAATTCCCACCAGCAAGAAGG - Intergenic
1044286350 8:90415369-90415391 CAGTGTCCCCAGCTGCACCAGGG + Intergenic
1044721571 8:95154671-95154693 CCATGTCCCCAGCAGAAAGCAGG - Exonic
1044776192 8:95691018-95691040 CAATTTCCCCATCAGTAAGATGG + Intergenic
1045348901 8:101320097-101320119 CAGAGTCCCCACCAGTAAGAAGG - Intergenic
1046511689 8:115212029-115212051 GAGAGTTCCCACCAGCAAGAAGG + Intergenic
1046684526 8:117210285-117210307 CTCTGTTCCAAGCAGCAAGATGG + Intergenic
1046880597 8:119302961-119302983 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
1047105725 8:121728401-121728423 CACTGTACCCAGCCGCTAGAAGG - Intergenic
1047188715 8:122658777-122658799 CAGTTGTCCTAGCAGCAAGATGG + Intergenic
1047590316 8:126320163-126320185 GAGAGTCCTCACCAGCAAGAAGG + Intergenic
1047595624 8:126374987-126375009 CAATGACCCCAGCATCAACAGGG + Intergenic
1047957502 8:129986667-129986689 CAGATTCCCCACCAGCAAGAAGG + Intronic
1047995482 8:130331035-130331057 CAGTTCCCCCAGCTGCAAAAAGG + Intronic
1048003606 8:130400424-130400446 CAGTATTCCCAGCTGCAAAATGG + Intronic
1048009909 8:130447180-130447202 CAGTTTCCTCAACTGCAAGATGG - Intergenic
1048197393 8:132343411-132343433 CTGTGTCCCAAGCACCAAGCTGG + Intronic
1048451973 8:134541408-134541430 CAGAGTCCCCACCAGCAAGAAGG + Intronic
1048914711 8:139171032-139171054 CAGTGTCTGCAGGAGCCAGAAGG - Intergenic
1049010351 8:139883240-139883262 CAGAGTCCCCAGCAGCAAGAGGG + Intronic
1049463243 8:142739700-142739722 CAGCGTCCCCAGCGGCACAATGG - Intergenic
1049500059 8:142957784-142957806 GAGAGTCCCCACCAGCCAGAAGG - Intergenic
1049883164 9:11523-11545 CAGTGTCCCCAGCTGCCAGCAGG - Intergenic
1050160419 9:2713092-2713114 CTGTGGCCCCAGCACTAAGAAGG - Intergenic
1050278744 9:4028221-4028243 CAGTTTCTCCATCTGCAAGATGG + Intronic
1050341602 9:4645439-4645461 CAGAGTCCCCACCAGCAAGAAGG - Intronic
1050472641 9:6008273-6008295 CCGTGTCCCCCGCAGGTAGAGGG - Intergenic
1050648939 9:7754397-7754419 CACTGTGCCCAGGAGGAAGAAGG + Intergenic
1051297060 9:15608004-15608026 CAGAGTTCCCATCAGCAAGAAGG - Intronic
1051742914 9:20268576-20268598 CAGAGTCTCCACCAGCAAGAAGG + Intergenic
1051881774 9:21847965-21847987 CAGTGTCCCCAGCTTCATCAGGG - Intronic
1052363040 9:27580444-27580466 CAGTTTCCCCAGCTACAAAATGG + Intergenic
1052368277 9:27638171-27638193 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1052789329 9:32859945-32859967 CAGTGTCCCCAGCCTCATCAGGG + Intergenic
1053017679 9:34672555-34672577 GAGAGTCCCCACCAGCAAGAAGG - Intergenic
1054765574 9:69039865-69039887 CAAAGTCCCCACCAGCAAGAAGG - Intronic
1055020629 9:71665609-71665631 CAGAGTCCTCACCAGCAAGAAGG + Intergenic
1055328383 9:75156108-75156130 GAGAGTTCCCACCAGCAAGAAGG + Intergenic
1055802716 9:80057929-80057951 CAGTGTCCTCACTAGGAAGAAGG + Intergenic
1055828895 9:80358116-80358138 CGGGGTCCCCAGCAGGAAGCAGG - Intergenic
1055843902 9:80537715-80537737 CAGAGTCCCCACTAGCAAGAAGG + Intergenic
1056642499 9:88383328-88383350 GAGAGTCCCCACTAGCAAGAAGG - Intergenic
1056742177 9:89267020-89267042 CAGTGTGCCCATCACCAAGCAGG + Intergenic
1057316224 9:93970458-93970480 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1057553006 9:96065797-96065819 CAGAGTCCCTGCCAGCAAGAGGG + Intergenic
1057570841 9:96203195-96203217 CAGAGTTTCCACCAGCAAGAAGG + Intergenic
1058114034 9:101064781-101064803 CAGAGTCCCCATCGGAAAGAAGG - Intronic
1058395404 9:104547551-104547573 CAGTGTCCCCACTAGTAAGAAGG - Intergenic
1058467433 9:105244061-105244083 CAGTTTCCACATCAGCAAAATGG + Intergenic
1059354557 9:113688546-113688568 CAGTATCCCCACCTGCAAAATGG - Intergenic
1059744574 9:117187680-117187702 GACAGTCCCCATCAGCAAGAAGG + Intronic
1059761387 9:117340871-117340893 CAGTGTGCCCATCAGCAACATGG + Intronic
1059965064 9:119605740-119605762 CAGTGTCCCCACCACCAAGCTGG - Intergenic
1060015133 9:120080472-120080494 CACTGTCACCAGAATCAAGAAGG + Intergenic
1060315389 9:122505273-122505295 CAGAGTCCTCACCAGCAAGAAGG - Intergenic
1060391336 9:123279792-123279814 CAGAGTCCCCACTAGCAAGAAGG + Intergenic
1061056157 9:128224099-128224121 CAGTGTCCCCAGTTGTAAAATGG - Intronic
1061160955 9:128893453-128893475 CTGTGTCCTCAACTGCAAGATGG - Intronic
1061231746 9:129319616-129319638 CAGTTTCCCCATCCGCAAAACGG + Intergenic
1061418911 9:130462758-130462780 CAGTGTCCTCATCCGTAAGATGG + Intronic
1061432755 9:130541721-130541743 CAGTTTCTCCAGCTGTAAGATGG + Intergenic
1061510958 9:131060777-131060799 CAGTCTCCCCATCTGCAAAATGG - Intronic
1061586795 9:131574884-131574906 CAGTTTCCCCAGCTGGAAGTGGG - Intergenic
1061796632 9:133089211-133089233 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
1061860380 9:133464875-133464897 CAGTGGCACCAGCACCAGGAAGG - Intronic
1061883559 9:133579678-133579700 CAGTCTCCCCACCTGCAAAATGG - Intronic
1061950081 9:133931284-133931306 CAGAGAGCCCAGCAGCAGGAGGG + Intronic
1062171072 9:135135006-135135028 CTGCTTCCCCAGCAGAAAGAAGG - Intergenic
1062176602 9:135166694-135166716 CAGTCCACCCAGCGGCAAGAAGG + Intergenic
1062447973 9:136603677-136603699 CAGTTTCCCCACCAGTCAGAAGG + Intergenic
1062465545 9:136679325-136679347 CAGTTTCCCCATCTGCAACAGGG - Intronic
1062601338 9:137319912-137319934 CAGGGTCCCCAGCCCCAACAAGG + Intronic
1062734175 9:138126274-138126296 CAGTGTCTCCAGCCGCCAGCAGG + Intergenic
1185664383 X:1753379-1753401 GAGAGTCCCCACTAGCAAGAAGG - Intergenic
1185841422 X:3395136-3395158 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
1186196409 X:7113964-7113986 TGGAGTCCCCACCAGCAAGAAGG - Intronic
1186251310 X:7669763-7669785 CAGAGTCTCCACCAGCAAGAGGG + Intergenic
1186279277 X:7975479-7975501 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1186368177 X:8917922-8917944 GAGAGTCCCCACCAGGAAGAAGG + Intergenic
1186387825 X:9127772-9127794 CAGAGTCCTCACCAGCAAGAAGG + Intronic
1186469095 X:9807363-9807385 GAGTGTCCCCAGGAGCAAGCAGG + Intronic
1186470151 X:9814757-9814779 CAGTGTCCCCAGCTTCATCAGGG + Intronic
1186508395 X:10111823-10111845 CAGTGTCATCAGCAGCAAATGGG + Intronic
1186586111 X:10874884-10874906 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
1186877222 X:13828407-13828429 GACTGTCCCCATCAGCAAGAAGG + Intronic
1186987913 X:15036613-15036635 CAGAGTCTCTATCAGCAAGAAGG - Intergenic
1187286125 X:17905532-17905554 GACAGTCCCCACCAGCAAGAAGG + Intergenic
1187592000 X:20727011-20727033 AAGAGTCCCTACCAGCAAGAAGG - Intergenic
1188285954 X:28325815-28325837 CAGAGTCTCCACCAGCAAGAAGG - Intergenic
1188611344 X:32102033-32102055 CTGTGTCCCCATGAGCAAAAAGG + Intronic
1188616178 X:32161884-32161906 CAGTGTCCTCATCTGCAAAATGG - Intronic
1188686311 X:33074723-33074745 GAGAGTTCCCACCAGCAAGAAGG + Intronic
1188801453 X:34536179-34536201 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
1189136493 X:38555995-38556017 CAGAGTCCCCATCAGCAAGAAGG - Intronic
1189234083 X:39474454-39474476 CAGTTTCCCCACCTGCAAAATGG + Intergenic
1189358048 X:40326579-40326601 CAGTCTCCACAGCAGAAAAATGG - Intergenic
1189421992 X:40864317-40864339 GAGAGTCCCCACCAGCAAGAAGG - Intergenic
1189470346 X:41309017-41309039 CAGTGCCCCCAGCAGGAAAGAGG - Intergenic
1189940161 X:46112976-46112998 CAGTCTCCCCAGCACCAGCAGGG + Intergenic
1190407082 X:50098937-50098959 CAGTGTTCCCATCTGCAAAATGG + Exonic
1190527749 X:51345161-51345183 AAGAGTCCTCACCAGCAAGAAGG + Intergenic
1190547038 X:51538326-51538348 CAGAGTACCCACCAGTAAGAAGG + Intergenic
1190551860 X:51591120-51591142 CAGAGTACCCACCAGTAAGAAGG - Intergenic
1190583702 X:51915562-51915584 CAGTGTCCCCAGCAGCAAGAGGG + Intergenic
1191768851 X:64733162-64733184 CAGTGTCCCCAGCACCAGCAGGG + Intergenic
1192223046 X:69210398-69210420 CAGTCTCCCCATCAGCAAAATGG + Intergenic
1192961832 X:76139231-76139253 GAGAGTCCCCACCAGCAAGAAGG - Intergenic
1193368195 X:80659767-80659789 CAGAGTCCCTATCAGCAAGAAGG + Intergenic
1193832594 X:86307441-86307463 CAGTGTCCCCAGCTTCATCAGGG - Intronic
1193876940 X:86872623-86872645 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1193879161 X:86900417-86900439 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
1193904251 X:87223878-87223900 CAGTGTCCCCAGCTTCATCAAGG - Intergenic
1194032347 X:88832516-88832538 CAGTGTCCCCAGCTTCATTAGGG + Intergenic
1194179935 X:90698634-90698656 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
1194375545 X:93128331-93128353 CAGAGTCCCCACCAGCAGGGAGG + Intergenic
1194513759 X:94824918-94824940 CAGTGTCCCCAGCTTCATCAAGG + Intergenic
1194798873 X:98246587-98246609 TAGAGTCCCTACCAGCAAGAAGG - Intergenic
1194810246 X:98380257-98380279 CAGGGTGCCCAGCAGCAGGCTGG - Intergenic
1195064509 X:101228459-101228481 CAGTGTCCTCATCTGCAAAATGG - Intronic
1195661312 X:107381683-107381705 CAGTTTCCCCATCAGCAAAATGG - Intergenic
1195749205 X:108147354-108147376 CAGTGTCCCCAGCTTCATCAGGG + Intronic
1196145005 X:112306837-112306859 CAGTGGCCACAGCAGGAAGCTGG + Intergenic
1196275464 X:113761435-113761457 CAGTGTCCCCAGCTTCAACAGGG - Intergenic
1197404741 X:126036510-126036532 CAGTGTCCCCAGCTTCATCAGGG - Intergenic
1197723172 X:129758802-129758824 CAGTTTCCCCAGCTGTAAAAAGG + Intronic
1198181461 X:134213783-134213805 CTAAGTCCCCACCAGCAAGAAGG + Intergenic
1198460974 X:136862687-136862709 CAGCGTCCCCACCAGCAAGGAGG - Intronic
1198783395 X:140260507-140260529 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
1198967056 X:142238165-142238187 AAGAGTCCCCACCAGCAAGAAGG - Intergenic
1199429943 X:147747500-147747522 GAGAGTCCCCACCAGCAAGAAGG - Intergenic
1199718501 X:150525042-150525064 CAGTCTGCCCATCAGGAAGAGGG + Intergenic
1199735966 X:150687014-150687036 CAGCGTTCCCACCAGGAAGAAGG - Intergenic
1199751476 X:150823681-150823703 GAGAGTCCCCACCTGCAAGAAGG - Intronic
1199997579 X:153035767-153035789 GAGAGTCCCCACCATCAAGAAGG + Intergenic
1200158152 X:153988996-153989018 CAGTGACCCTAGGAACAAGATGG - Intergenic
1200179092 X:154139590-154139612 CTGTGTCCTCATCAGGAAGATGG - Intergenic
1200402649 X:156028626-156028648 CAGTGTCCCCAGCTGCCAGCAGG + Intergenic
1200526590 Y:4280803-4280825 CAGTGTCCCCAGCTTCATCAGGG + Intergenic
1200815668 Y:7529629-7529651 CAGTGACTCCAACAGCAAGTAGG - Intergenic
1201391217 Y:13499456-13499478 CAGAGTTCCCACCAGCAAGAAGG - Intergenic
1202100105 Y:21298758-21298780 CAGTGTCCCCAGCTTCATCAGGG - Intergenic