ID: 1185359940

View in Genome Browser
Species Human (GRCh38)
Location 22:50400093-50400115
Sequence GACCCACTGCTGCTTCCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 211}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185359940_1185359943 -7 Left 1185359940 22:50400093-50400115 CCAGTGGGAAGCAGCAGTGGGTC 0: 1
1: 0
2: 1
3: 27
4: 211
Right 1185359943 22:50400109-50400131 GTGGGTCACAGCGGGCCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185359940 Original CRISPR GACCCACTGCTGCTTCCCAC TGG (reversed) Intronic
900213351 1:1468089-1468111 GACCCAGGGCAGCTTCCCAGAGG - Intronic
900936885 1:5771635-5771657 GCCCCACCTCTGGTTCCCACTGG - Intergenic
901671357 1:10858067-10858089 GTCCCACTGCTGTGGCCCACTGG - Intergenic
901710701 1:11112664-11112686 GAGCCTCTGCAGCCTCCCACGGG + Intronic
902744697 1:18465840-18465862 CATCCTCTGCAGCTTCCCACTGG + Intergenic
903022117 1:20401753-20401775 AACCCACTGCTGCTTCCTTCTGG + Intergenic
903469272 1:23574411-23574433 GAGGCACTGCTGCTTCCTGCAGG + Intergenic
904458907 1:30663861-30663883 GAGGCCCTGCTGCTTCCCACTGG - Intergenic
905576265 1:39047146-39047168 CAGCCACTGTTGCTTCCGACAGG - Intergenic
905934559 1:41813216-41813238 GTCCCACTTCTGCTTCTTACTGG - Intronic
906251268 1:44312659-44312681 GCCCCACTGCAGCTTGCCGCTGG - Intronic
906843723 1:49167534-49167556 GCTCCACTGCTCCTTCCCAAAGG + Intronic
907190364 1:52642881-52642903 GAACCACTGCTGCTACGGACAGG - Exonic
909817931 1:80020071-80020093 GACCCAGTGTTCCTTCCCTCTGG + Intergenic
917858598 1:179123219-179123241 GAGCCACTGCTCCTGGCCACCGG - Intronic
918075698 1:181169820-181169842 GACACGCTGCTGCTTTCTACTGG + Intergenic
918097747 1:181348829-181348851 AACTCACTGCTGCTCCCCACAGG - Intergenic
920660526 1:207910853-207910875 CGCCCACAGCTGCTTCCCCCCGG - Intronic
924616687 1:245617899-245617921 TCCCCCCTGCTCCTTCCCACAGG + Intronic
1063904255 10:10766467-10766489 GACACACTGCTGCCTCCATCGGG + Intergenic
1065550312 10:26862999-26863021 GATCCACTCCCGCTTCCCCCAGG - Intergenic
1066480304 10:35789168-35789190 GTCCCGCTGCTGCTTGCCTCTGG + Intergenic
1067426872 10:46217250-46217272 GCCCCACCGCTGTTGCCCACAGG - Intergenic
1067690201 10:48496989-48497011 GGCCCACTGCTCCATCCCCCAGG + Intronic
1069390736 10:67931870-67931892 CTCCCACTGCAGCCTCCCACAGG + Intronic
1070288732 10:75101124-75101146 GACCCACAGCTGTTCCCCACTGG - Intronic
1070411949 10:76149993-76150015 GGCCATTTGCTGCTTCCCACAGG + Intronic
1071062695 10:81591459-81591481 GCTGCACTCCTGCTTCCCACAGG - Intergenic
1071928731 10:90441095-90441117 CAGCCACTGCTGCCTCCAACTGG + Intergenic
1075496482 10:122923522-122923544 GTCCCACTGCTGGTGGCCACGGG + Intergenic
1076655784 10:132022494-132022516 GCCTCACTGCTGCTGCCCATGGG - Intergenic
1076979817 11:198406-198428 GGCCCACTGCTCCTTCCCTGGGG - Intronic
1077115113 11:880604-880626 TACCCACTGCTGCCACCCTCAGG + Intronic
1077319230 11:1933699-1933721 CACCCACTGCCCCTGCCCACAGG + Exonic
1079030125 11:16980470-16980492 GATCCACAGCCGCCTCCCACAGG + Intronic
1081710052 11:45210549-45210571 GAGCCACGGCTGCTTCCCTGGGG - Intronic
1083292193 11:61696425-61696447 GCCCCACTGCTCCTCCCCGCTGG - Intronic
1083847735 11:65345765-65345787 CACCCACTCCTGTTTCCCAGAGG + Exonic
1085417103 11:76326365-76326387 GGCCCACGTCTGCTTCCCTCTGG + Intergenic
1090795157 11:130129088-130129110 CACCAGCTGCTGCTTCTCACTGG - Exonic
1092970864 12:13693533-13693555 AACCCAGGGCTGCTTCTCACAGG + Intronic
1094027659 12:25975911-25975933 GACACTGTGCTGCTTCCCAAAGG - Intronic
1094787265 12:33863302-33863324 GTCCCAGTGGTGCTGCCCACAGG - Intergenic
1098270236 12:68762862-68762884 GAGGCACTGCTGCTGCCCAGCGG + Intronic
1102002506 12:109566205-109566227 CACCTACTGGTGCCTCCCACTGG + Intronic
1102548438 12:113673640-113673662 AACCCAGTGCTGCTCCCCACTGG - Intergenic
1104073413 12:125368567-125368589 CTTCCACTGCTGCCTCCCACTGG - Intronic
1104349837 12:128035643-128035665 GACCCACTGAGGGTTCCCCCTGG - Intergenic
1104536775 12:129624933-129624955 GAATCACTGCAGCTTCCCAGAGG - Intronic
1104569082 12:129909383-129909405 GCCCCTGTTCTGCTTCCCACTGG + Intergenic
1104805367 12:131586318-131586340 CACCCAGTGCTGTTTCCCAGGGG + Intergenic
1106078895 13:26484422-26484444 CACCCTCTGCTCCCTCCCACTGG + Intergenic
1106808480 13:33335364-33335386 GCCCCACTGTTGCCTCACACAGG - Intronic
1107024016 13:35781231-35781253 CACCTACTGCTGCTTCCAAGGGG - Intronic
1107339907 13:39395021-39395043 TCCCCACTGCTCCTTCCCACGGG + Intronic
1108699645 13:52932988-52933010 CACCCTCTGCTGCTACCCTCTGG + Intergenic
1110767283 13:79295247-79295269 TTCCCGCTGGTGCTTCCCACTGG - Intergenic
1113769059 13:112897077-112897099 GTGCCACTGCTGCTTCCAGCTGG - Intronic
1113797147 13:113065152-113065174 GACCCCCCGCAGCTTCCGACCGG - Intronic
1113969485 13:114177456-114177478 CACTCACAGCTGCCTCCCACAGG - Intergenic
1114657953 14:24327333-24327355 GACCTCCTGCCGCTTTCCACTGG - Intronic
1118636566 14:67753408-67753430 GAAACACTGCTGGTTCTCACAGG - Intronic
1119228145 14:72959866-72959888 GTTCTACTGCTGCTTCCCACTGG - Intergenic
1119419719 14:74501342-74501364 GAGCCACTGCTGCCTCCTAGTGG - Intronic
1120926649 14:89803803-89803825 AGCCCGCTGCTTCTTCCCACTGG + Intronic
1121262081 14:92573751-92573773 CACACACTGCTGGTTCCCATGGG + Intronic
1121441847 14:93954483-93954505 GACCCACTCCTTCCTCTCACAGG - Exonic
1122118342 14:99538597-99538619 CTCCCCCTGCTGGTTCCCACAGG + Intronic
1122539536 14:102490189-102490211 GATCCTGTGCTGCTTCCCACTGG + Intronic
1124221538 15:27854054-27854076 TGCCCTCTGCTGCATCCCACTGG + Intronic
1124421217 15:29524657-29524679 CGCCCATTGCTGCTTCCGACTGG - Intronic
1125546183 15:40507325-40507347 GCCCGCCTGCTGCTTCCCAGTGG + Intergenic
1126105082 15:45142090-45142112 GACCCTCTGTTGCTTCCCTTTGG + Exonic
1127262772 15:57338030-57338052 GACTCACGGCTGCTTCCTCCTGG + Intergenic
1128405861 15:67337862-67337884 GACCCAAAGCTGGTTCCCAAAGG + Intronic
1128526471 15:68415562-68415584 CACCCACTGCTGCTTCCGGCAGG + Intronic
1132877257 16:2145568-2145590 AACCCACTGCAGCATCCCACTGG + Intronic
1133816241 16:9199497-9199519 CACCCTCTGCTCCCTCCCACCGG + Intergenic
1136092344 16:27929420-27929442 GCCCTACGGCTGATTCCCACCGG - Intronic
1139580424 16:67870135-67870157 TAAACACTGCTGCTTCCCACCGG + Intronic
1139588153 16:67917565-67917587 TAGCCACTGGTGCTTCCCTCAGG - Intronic
1139653292 16:68373255-68373277 GACCCACTTGTGGCTCCCACAGG - Intronic
1140750817 16:78021926-78021948 CACCCACTTCGGCCTCCCACTGG + Intergenic
1142029382 16:87830966-87830988 CACGCACCACTGCTTCCCACTGG - Exonic
1142197399 16:88745154-88745176 GACCCACTGCTGCCTCTTCCAGG + Intronic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1143019096 17:3907459-3907481 GACTCCCTGCTCCTTCCCCCAGG + Intronic
1143373625 17:6455105-6455127 CAGCCACTGCTGCCTCCCACGGG - Exonic
1144259460 17:13504068-13504090 CACCCACTGCGGCCTCCCAAAGG - Intronic
1149994144 17:61398090-61398112 GATCCACTGCAGTTTTCCACAGG - Intergenic
1151350637 17:73529966-73529988 GACCCATTCCTGCTGCCCAGTGG + Intronic
1151515556 17:74592734-74592756 GACCCACTGCCCCTTCCCCCAGG + Exonic
1151774452 17:76189913-76189935 GACCCACTGCTTCTTGCGCCTGG - Intronic
1153252512 18:3136671-3136693 CACCCACTTCAGCCTCCCACAGG + Intronic
1154215861 18:12415696-12415718 CACCCACTGCTCCTTCCCCTGGG + Intronic
1154219037 18:12436027-12436049 GACTCGCTGGTGCTGCCCACGGG + Intergenic
1154219351 18:12438474-12438496 GACTCGCTGGTGCTGCCCACGGG - Intergenic
1154490137 18:14915493-14915515 GACCCATTGCTGTTCCCCTCAGG + Intergenic
1157045753 18:44100103-44100125 GCCCCCCTGCTACTTCTCACTGG - Intergenic
1158541015 18:58354717-58354739 TATCCCCTGCTACTTCCCACTGG - Intronic
1158617530 18:59001884-59001906 GACCCCCTGAACCTTCCCACAGG + Intergenic
1160690141 19:457930-457952 GACCCACTTCCGCCTCCCCCGGG - Intronic
1161075506 19:2283273-2283295 GAGCCACTGCTGAGTCCCCCTGG + Intronic
1161514744 19:4690150-4690172 GGCCTACTGGGGCTTCCCACAGG - Intronic
1162956381 19:14100908-14100930 GACCAGCCACTGCTTCCCACAGG - Exonic
1163178604 19:15583425-15583447 GATCCACCGCTGCTGCCCCCAGG + Intergenic
1164296510 19:23915049-23915071 CCGCCACTGCCGCTTCCCACCGG - Intronic
1166360273 19:42250243-42250265 GACCCAATGCTTGTTCCCACAGG + Intronic
1166368731 19:42290277-42290299 TACCCACTGCCGCCCCCCACTGG + Exonic
1166650425 19:44570252-44570274 GCCTCCCTGCTGCTTCCCAAGGG + Intergenic
926271765 2:11372028-11372050 CACCCACTGCTGGATCCAACAGG + Intergenic
926643941 2:15268281-15268303 GACCCACAGATGTTTACCACTGG - Intronic
928427159 2:31188862-31188884 AAGCCACTCCTGCTTCCCCCAGG + Intronic
929561481 2:42959192-42959214 GCCCCACTGCTCCATCACACTGG + Intergenic
930603252 2:53466315-53466337 ATTCCACAGCTGCTTCCCACTGG - Intergenic
934787188 2:97020222-97020244 GTCCCACTGCAGCCTCCCAATGG - Intergenic
936280826 2:111138292-111138314 GAGCCACTGCTCCTGGCCACAGG + Intronic
939629144 2:144513739-144513761 GCCCTGCTGCTGCTTGCCACCGG - Intronic
942530232 2:176902122-176902144 GTCCCACCTCTGCTTCCTACTGG + Intergenic
946596340 2:221309822-221309844 GCACCACTGCTGCTGCACACAGG + Intergenic
948075313 2:235161292-235161314 CACCCAGTGCTGCTTCCCTGTGG + Intergenic
948135789 2:235635200-235635222 GACCCACTGCTGCCACACACAGG - Intronic
948382641 2:237561481-237561503 GCCCGCCTGCTGCCTCCCACTGG + Intergenic
1171451286 20:25237704-25237726 CACCCACAGATGCTGCCCACAGG + Intergenic
1172519913 20:35559788-35559810 CACCCATTGCTACTTCCCAGTGG + Intergenic
1175177328 20:57120122-57120144 GGCACACTGCTGGTTCCCTCTGG + Intergenic
1175852259 20:62099896-62099918 GACCCACCTCTGCTTCCCATGGG + Intergenic
1175919200 20:62442131-62442153 GAGCCACTGCAGCTCCCCTCGGG + Intergenic
1176343168 21:5716634-5716656 GACCCACAGTTCCTTCCCAGAGG + Intergenic
1176475422 21:7148785-7148807 GACCCACAGTTCCTTCCCAGAGG + Intergenic
1176501659 21:7607822-7607844 GACCCACAGTTCCTTCCCAGAGG - Intergenic
1176537489 21:8114703-8114725 GACCCACAGTTCCTTCCCAGAGG + Intergenic
1177011076 21:15730464-15730486 GCCCCACTTCTCCTTCCGACGGG + Intronic
1178384271 21:32136815-32136837 AACCCAGTGATGCTTCCCACCGG - Intergenic
1179299093 21:40090447-40090469 CACCCACTGATGCTGCTCACAGG + Intronic
1179356136 21:40662049-40662071 CACCCAGTGCTGATGCCCACGGG - Intronic
1179403142 21:41102661-41102683 GACCCACAGCTCCTTCTCCCAGG - Intergenic
1182283451 22:29231163-29231185 AACCCACTGCTCATTCCCACAGG - Intronic
1183623365 22:38987355-38987377 GCCCCACTGCTGCTTCTGAATGG + Intronic
1183628967 22:39021707-39021729 GCCCCACTGCTGCTTCTGAATGG + Intronic
1183630175 22:39027812-39027834 GCCCCACTGCTGCTTCTGAATGG + Intronic
1183638214 22:39077552-39077574 GCCCCACTGCTGCTTCTGAATGG + Intronic
1184032931 22:41905418-41905440 GACACACATCTCCTTCCCACAGG + Exonic
1184825644 22:46949002-46949024 GCTCCACTCCTGCTTCCCACAGG - Intronic
1185043138 22:48515864-48515886 GGCCCACTGCTGGCTCCCCCAGG + Intronic
1185068754 22:48644917-48644939 GACTCTCTGCTGATCCCCACAGG + Intronic
1185359940 22:50400093-50400115 GACCCACTGCTGCTTCCCACTGG - Intronic
1203242432 22_KI270733v1_random:31059-31081 GACCCACAGTTCCTTCCCAGAGG + Intergenic
949811658 3:8012864-8012886 CACCCACTGCTGCTCCCAATAGG - Intergenic
950392687 3:12709032-12709054 CACCCAGTGCTGCTTCCCACAGG - Intergenic
950579367 3:13852506-13852528 GACCCACTCCTTGTTCCGACCGG - Intronic
951567767 3:24028743-24028765 ATCCCACTGATGCTTCCCATTGG - Intergenic
952132707 3:30383823-30383845 GACCCAGTGCTGGTTTCCACAGG - Intergenic
952262015 3:31749188-31749210 GAATTACTGCTTCTTCCCACTGG - Intronic
954810528 3:53244517-53244539 CACCCACTCCTGCTGGCCACAGG + Intronic
954987514 3:54808790-54808812 GAGCCACTGCTGCATCACAGTGG - Intronic
956126867 3:66018868-66018890 GACACACTGTGGCTTCCCAAAGG - Intronic
960938271 3:122916632-122916654 CTCACACTTCTGCTTCCCACGGG + Intronic
961660832 3:128468033-128468055 GAGCCCCTGATGCTCCCCACTGG - Intergenic
961795128 3:129403650-129403672 CACCCACGGATGCTGCCCACGGG + Intronic
962847633 3:139285879-139285901 GAATCACAGCTGCTGCCCACAGG + Intronic
968871538 4:3245171-3245193 GGTTCACCGCTGCTTCCCACTGG - Intronic
972352041 4:38244859-38244881 GACCCACACCTGCTTGCCTCTGG - Intergenic
972632780 4:40856792-40856814 GCCTCACTCCTTCTTCCCACCGG + Intronic
972727529 4:41758224-41758246 GAGTCACTGCTGCTGCCCCCTGG + Intergenic
975145273 4:70960124-70960146 CACCCACTTCAGCTTCCCAAAGG + Intronic
981043644 4:140246338-140246360 GTCCCACTGCAGCTCACCACAGG + Intergenic
984520144 4:180792263-180792285 TCCCCAGTGCTGCTTCCCAGAGG - Intergenic
984782225 4:183536328-183536350 TACCAATTGCTGCTTCCCTCAGG - Intergenic
984948486 4:184988763-184988785 CACTCCCTGCTGCTTGCCACAGG - Intergenic
985991619 5:3566437-3566459 GAAACACTGCTGCTTACCAAGGG + Intergenic
989555379 5:42788948-42788970 GGGCCACTGCTGCTGCCCAAGGG - Intronic
992980933 5:82171076-82171098 GACCCAATGTTGCTTCCCTTGGG + Intronic
993452501 5:88089996-88090018 GACAGACTGCTGCTACCTACAGG - Intergenic
993671395 5:90765088-90765110 TACACCCTGCTTCTTCCCACTGG + Intronic
993891415 5:93479135-93479157 GTCCCCATGCTGCTTTCCACAGG - Intergenic
996734440 5:126745724-126745746 CACCCACTTCCGCTTCCCAAAGG + Intergenic
997537284 5:134632676-134632698 GATCCATAGCTGCTGCCCACCGG + Intronic
998059269 5:139106271-139106293 CAGCCACTTCTCCTTCCCACTGG + Intronic
999367958 5:151035156-151035178 GACCGGCTGATGCTTCCCTCTGG + Intronic
1001497126 5:172196658-172196680 GACCCACCGCACCTGCCCACTGG + Intronic
1002290327 5:178196036-178196058 GAGCCACTGCTGCCTCTCAGAGG + Intergenic
1006002450 6:30976073-30976095 CACCAACCGCTCCTTCCCACAGG + Intergenic
1009897975 6:69776868-69776890 GAGCCACTGCACCTGCCCACTGG - Intronic
1013000229 6:106014342-106014364 GAGCCACTGCTGCCTGCCTCAGG + Intergenic
1015256567 6:131184740-131184762 CACCCACTCCTGTTTCCCAGAGG - Intronic
1016588070 6:145711819-145711841 GACCCGCTGATGTTTCCCACTGG - Intronic
1018004903 6:159612781-159612803 TCACCACTGCTTCTTCCCACAGG + Intergenic
1018971567 6:168533044-168533066 GACCTACTGCTGCCTGTCACAGG - Intronic
1019186686 6:170224628-170224650 GCCCCACTGCTGCCGCACACAGG + Intergenic
1020930145 7:14382871-14382893 GTTCCACTGTTGCTGCCCACTGG - Intronic
1024075105 7:45814076-45814098 GCCCCACTGTTGCCTCCCAGGGG - Intergenic
1025176174 7:56803544-56803566 GCCCCACTCCTGCCTCCCAGGGG - Intergenic
1025695619 7:63772878-63772900 GCCCCACTCCTGCCTCCCAGGGG + Intergenic
1025977276 7:66378953-66378975 GTCCAACTCCTGCTTCCCAATGG - Intronic
1026973973 7:74485192-74485214 GCCCCACTGCTGCCTCCCCTGGG - Intronic
1029692855 7:102193927-102193949 GCCCCGCTGCTGGTTACCACTGG + Intronic
1032689203 7:134265828-134265850 GAACCTCTTCTCCTTCCCACTGG + Intergenic
1034413442 7:150953123-150953145 CACCCAGTGCTGCTCCCCGCCGG + Intronic
1037203611 8:16287741-16287763 GGCTCACTGCAGCTTCCCTCAGG + Intronic
1041346418 8:56902899-56902921 GACCCACTGCTAGTTCCCCTAGG + Intergenic
1041811355 8:61914085-61914107 GGCCAACTGCTACTTCACACAGG - Intergenic
1041898869 8:62958530-62958552 GAGCCACTGCTGCTGACCACTGG - Intronic
1042746919 8:72118668-72118690 GACCCACTGCTCTGACCCACAGG + Intergenic
1048193427 8:132310879-132310901 GAACATCTGCTGCTTCCCAGTGG - Intronic
1048498086 8:134951907-134951929 GACCCAGTGTTTCTTCCCTCTGG + Intergenic
1048888033 8:138924359-138924381 CTCCCACAGCTGCATCCCACAGG + Intergenic
1049156907 8:141072875-141072897 GAGCCACAGCTGCTCCTCACAGG - Intergenic
1049571019 8:143370330-143370352 GCCCCACTGCCACCTCCCACGGG - Intronic
1051603486 9:18897237-18897259 GACTCACTGCCCCTTCCCCCGGG - Intronic
1057530339 9:95839466-95839488 GACCAGCAGCTGCTTCACACAGG - Intergenic
1060052966 9:120390198-120390220 TTCCCACAGCTGCTTCCCAGAGG - Intronic
1060053768 9:120395607-120395629 GAAACACTTCTGCTTCCAACAGG + Intronic
1061425286 9:130494579-130494601 GACCCACTGCTTCATGCCATAGG - Intronic
1062462328 9:136667079-136667101 ATCCCACACCTGCTTCCCACGGG - Intronic
1062620042 9:137416565-137416587 GCCCGGCTGCTGCTTCCCAAAGG + Intronic
1203458760 Un_GL000220v1:14136-14158 GACCCACAGTTCCTTCCCAGAGG + Intergenic
1185431278 X:13470-13492 GACCCCCTGCTCCTCCCCACGGG + Intergenic
1185431332 X:13629-13651 AACCCCCTGCTCCTCCCCACAGG + Intergenic
1185440545 X:225867-225889 GACTCCCTGCTCCTCCCCACGGG + Intergenic
1185440622 X:226090-226112 AACCCCCTGCTCCTCCCCACAGG + Intergenic
1185441554 X:230479-230501 GACCCCCTGCTCCTCCCCTCGGG + Intergenic
1185722750 X:2395277-2395299 GACACCCTCCTGCTTCACACGGG - Intronic
1186440222 X:9579693-9579715 TAAGCAGTGCTGCTTCCCACAGG - Intronic
1187339712 X:18410220-18410242 AACACACTGCTGCCTCCCACAGG - Intergenic
1189134311 X:38533038-38533060 GACCCACTACTGCTCCTCCCTGG + Intronic
1192148808 X:68699179-68699201 GGCCCTTGGCTGCTTCCCACAGG - Intronic
1193300357 X:79881604-79881626 TACCCACTGCTGCTTCCCTGGGG + Intergenic
1195129097 X:101837345-101837367 CCCCCACTGCTCCCTCCCACTGG - Intronic
1195201031 X:102550216-102550238 CCCCCACTGCTCCTTCCCCCTGG + Intergenic
1196584071 X:117409254-117409276 TACTCACTGCAGCTTCCCACAGG + Intergenic
1199500650 X:148501847-148501869 GACCCCCTTCGGCCTCCCACTGG + Intronic
1200175931 X:154116341-154116363 GACCCCCTGGTGCTTCCCCATGG + Intergenic
1201894645 Y:18980659-18980681 GACCCACTGCTCCCGGCCACAGG - Intergenic
1202173342 Y:22074303-22074325 CAGCCACTGCTGCTCCCCATGGG - Intronic
1202218018 Y:22512071-22512093 CAGCCACTGCTGCTCCCCATGGG + Intronic
1202325167 Y:23683988-23684010 CAGCCACTGCTGCTCCCCATGGG - Intergenic
1202380906 Y:24276159-24276181 GCCCCACTGTTGCCTCCCAGGGG - Intergenic
1202489878 Y:25393966-25393988 GCCCCACTGTTGCCTCCCAGGGG + Intergenic
1202545604 Y:25986066-25986088 CAGCCACTGCTGCTCCCCATGGG + Intergenic