ID: 1185359962

View in Genome Browser
Species Human (GRCh38)
Location 22:50400200-50400222
Sequence CAAGGGAAACACTGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 449}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185359962 Original CRISPR CAAGGGAAACACTGGGAGGA AGG Intronic
900324453 1:2101397-2101419 CAAGGGAAAGAAAGGAAGGAGGG - Intronic
901510380 1:9715485-9715507 CAAGGCAGCCACTGGGAGGTGGG - Intronic
902151994 1:14450763-14450785 CAAAGGAAAGACTGAGAAGAGGG + Intergenic
903000532 1:20262426-20262448 GAAGGGTAAAACTGGAAGGAAGG - Intergenic
903868047 1:26412446-26412468 GAAGGGGAAGCCTGGGAGGAGGG - Intronic
904250582 1:29221261-29221283 CCGTGGAAACACTGGGAGAAGGG + Intronic
905780041 1:40700888-40700910 AAGGGGACACAGTGGGAGGATGG - Intronic
907013807 1:50991518-50991540 CAAGGGAATCAATGGGAACAAGG - Intergenic
907229215 1:52979907-52979929 AAAGGGAAAGAAAGGGAGGAAGG - Intronic
909132518 1:71755564-71755586 CATGGGACAAACTGAGAGGAGGG - Intronic
910262002 1:85302256-85302278 AAAGGGAAAGACTGGAAGGCAGG - Intergenic
911265410 1:95737344-95737366 CAAGGGAAAGGCTGGAAGGGGGG - Intergenic
911364943 1:96926845-96926867 AAATGGAAACACTGGGTGGAGGG - Intergenic
912089542 1:106054458-106054480 CAAATGTAACACTGGGAAGAAGG + Intergenic
914704881 1:150162446-150162468 GAGGAGAAGCACTGGGAGGAAGG - Intronic
915698523 1:157768734-157768756 TAAGGGAAACTCTGGGAACAGGG + Intronic
915706549 1:157849292-157849314 CAAGAGGAACTCTGTGAGGAAGG + Intronic
915820730 1:159021245-159021267 CAGGGGAAAGAGTGGGAGGGGGG - Intronic
916339054 1:163708045-163708067 CAAGGGAGAGGGTGGGAGGAAGG - Intergenic
917953646 1:180068599-180068621 CAAGTGAAACACTGAAAGAATGG + Intronic
918045399 1:180938178-180938200 CAAGGGACACAGTGGGAACAGGG - Intronic
918488406 1:185053998-185054020 CTAGAGAAACACTGGGTGGGGGG - Intronic
919818561 1:201457954-201457976 GAAGGGAGACCCTGGGAGGCAGG - Intergenic
919883418 1:201915754-201915776 CAAGGGAACATCTGTGAGGATGG - Intronic
920404306 1:205697486-205697508 CAAAGGTAGCCCTGGGAGGAGGG + Intergenic
920915899 1:210257764-210257786 CAGGGAAAATACTGGCAGGAAGG + Intergenic
920940459 1:210477348-210477370 CTAGGGAAACAGTGGGAAGAAGG - Intronic
922336040 1:224618565-224618587 GAGGGGAAACTCGGGGAGGAAGG + Intronic
923321923 1:232842785-232842807 CAAAGGAAACAGATGGAGGATGG + Intergenic
924501234 1:244639772-244639794 AAAGGTAAACACTGTGAGGGTGG + Intronic
1063622309 10:7660723-7660745 CATGGGAAAGAATGGGAGGCAGG + Intronic
1063674166 10:8125130-8125152 CAACAGAAACAAAGGGAGGAGGG + Intergenic
1063773717 10:9235676-9235698 CTATGGAAATATTGGGAGGAGGG - Intergenic
1063872088 10:10428658-10428680 CAAGGAAAAGAGTGGGAAGAGGG - Intergenic
1064665857 10:17650680-17650702 CTAGGGAAAAACTGGAAGCAGGG - Intronic
1065991533 10:31014671-31014693 CAAGTGAGGCACTGGGAGGTTGG - Intronic
1066205579 10:33186254-33186276 CAAGGTGACCACTGGAAGGAAGG - Exonic
1066784423 10:38987439-38987461 CAGGGGAAAGGCTGGGAGGAGGG - Intergenic
1067171559 10:43910970-43910992 GAATGGAAACACTGGGATGGAGG + Intergenic
1067234441 10:44436233-44436255 TAAGGCAAACACTGGTGGGAGGG - Intergenic
1068432163 10:56947887-56947909 CATGGGAAAGACTGGGAGCAAGG - Intergenic
1069821109 10:71229336-71229358 CAGAGGAGACCCTGGGAGGATGG + Intronic
1069994313 10:72333173-72333195 CGAGAGAAACTCTGGGAGGGTGG + Exonic
1070377639 10:75849134-75849156 CAATGGGGACACTGGGACGAGGG - Intronic
1070519376 10:77238533-77238555 CTAAGGAAACTCTGGGAGGGAGG - Intronic
1070637413 10:78140364-78140386 AAAGGGAAACAGTGAGAAGAGGG + Intergenic
1071135183 10:82445536-82445558 TAAGGGAAACAGTGGGAGAAAGG - Intronic
1071342250 10:84659777-84659799 GATGGGTAATACTGGGAGGAGGG - Intergenic
1071807775 10:89142968-89142990 AAAGAGAAACCCAGGGAGGAAGG - Intergenic
1071895045 10:90057109-90057131 CAGGGGAAAAGGTGGGAGGAAGG + Intergenic
1072411247 10:95203986-95204008 CTGGGGAAACACTGGGAGCCTGG - Intronic
1073354866 10:102845786-102845808 CATTGGAAAGACTGGGAAGATGG + Intergenic
1073374995 10:103025916-103025938 CAATGCAAACACTGGGAGATGGG + Intronic
1073676234 10:105650158-105650180 CAAAAGAATCACTGGGGGGAAGG - Intergenic
1075781123 10:125017887-125017909 CATGGGTAACACTGGGGTGATGG - Intronic
1075923989 10:126235889-126235911 CAAGGGGAACACACGGAGGAGGG + Intronic
1076159979 10:128236212-128236234 CAAGGGCAACAGTGGGGGCATGG + Intergenic
1077496278 11:2887996-2888018 CCAGGGACACACCTGGAGGAAGG + Exonic
1077531201 11:3096094-3096116 CAAGGGAAAAACAGGAGGGAGGG + Intronic
1078035925 11:7805578-7805600 CAAGGGAAAGGCAGGGAGCAAGG + Intergenic
1078536921 11:12182768-12182790 CAAGGTGGACAGTGGGAGGAGGG - Intronic
1078677335 11:13434681-13434703 CAAAGCAAACAATGGGAGAATGG + Intronic
1080931624 11:36817411-36817433 CAAGGGAATCAGTGGGGAGATGG - Intergenic
1082294690 11:50425329-50425351 CAGGGTAAAAACTGGAAGGAAGG + Intergenic
1082588897 11:54980300-54980322 CAAGGGAAAAACTAGAAGGAAGG + Intergenic
1084083204 11:66842764-66842786 CAAGGGGAAGCCTGGGAGAACGG - Intronic
1084463452 11:69308903-69308925 CCAGGGATGCCCTGGGAGGAGGG + Intronic
1084640961 11:70425440-70425462 CCAGGAAAACACTGAGGGGAAGG + Intronic
1085010498 11:73137694-73137716 CAGGTGAAAAAGTGGGAGGAAGG + Intronic
1085711079 11:78829756-78829778 CAAGGGAAAGACTGGAAATAGGG + Intronic
1085919714 11:80938178-80938200 CAGGGGAATCAGTGAGAGGAGGG - Intergenic
1087024148 11:93633315-93633337 ACATGGAAACCCTGGGAGGATGG + Intergenic
1087177906 11:95111861-95111883 TAAAGGGAACACTGGGAGGCTGG - Intronic
1088908965 11:114176219-114176241 CAAGGGGAGACCTGGGAGGAGGG + Intronic
1089411688 11:118248455-118248477 CAAGGGAAAAATTGGTAGGTAGG - Intronic
1089711643 11:120319130-120319152 AAAGAGAAACACAGGGAGGAAGG - Exonic
1090902651 11:131046410-131046432 CAGGGGAACCACTGGCAGCATGG - Intergenic
1091691723 12:2601761-2601783 CAAGGGATGCTGTGGGAGGAAGG + Intronic
1091809848 12:3387524-3387546 CAAGGCAGACACTGAGAGGTGGG + Intronic
1092857857 12:12691977-12691999 GAAGGCACAAACTGGGAGGAGGG - Intronic
1096390445 12:51224669-51224691 CAAGGGAAAGAACGGGAGGGAGG - Intergenic
1096647192 12:53045378-53045400 GTAGGGAGGCACTGGGAGGAGGG - Intergenic
1097536868 12:60883325-60883347 CAGGGGAAAGGTTGGGAGGAGGG - Intergenic
1097578421 12:61423552-61423574 AAAAGGAAAGACTGGGAGCATGG - Intergenic
1097607577 12:61774663-61774685 CGGGGGAAAGAGTGGGAGGATGG + Intronic
1098261561 12:68676733-68676755 GAAGGGAAAGACAGGAAGGAAGG + Intergenic
1098546629 12:71718786-71718808 CAAGGGAATTTCTGGGATGATGG - Intergenic
1099567230 12:84267755-84267777 CAAGGGAAACCAAAGGAGGAGGG + Intergenic
1100165189 12:91909030-91909052 CAAGGAAAAGGGTGGGAGGAGGG + Intergenic
1100420017 12:94423827-94423849 CGACTGAAACACTGGAAGGAAGG + Intronic
1100513350 12:95299780-95299802 AAATGGAAACTCTGGGAGTAGGG - Intronic
1101075899 12:101129598-101129620 CAGGGGAAACGGTGGAAGGAGGG + Intergenic
1103634605 12:122293312-122293334 CTAGGGAACCACTGGGATGGAGG - Intronic
1103744695 12:123114544-123114566 CAAGGGGCACACTGGGACAAAGG - Intronic
1105996678 13:25679082-25679104 CCAGGTAAGCAATGGGAGGAAGG + Intronic
1106234875 13:27853271-27853293 CAAGGGAAAAGCTGGGAGGTAGG + Intergenic
1108074118 13:46661103-46661125 CCAGGAAAACAGTGGAAGGAGGG - Intronic
1108898834 13:55371812-55371834 CAATAGAAACACTGGAAGGCAGG + Intergenic
1109617766 13:64859152-64859174 CAGGGGAAAGAGTGGGAGTAGGG - Intergenic
1111736476 13:92146657-92146679 TGGGGGAAACAGTGGGAGGAGGG - Intronic
1111820090 13:93203134-93203156 CAGGGGAAAGAATGGGAGTAGGG - Intergenic
1113233653 13:108243323-108243345 CAAAGTAAACACTTGGAAGATGG + Intergenic
1114287930 14:21262746-21262768 CAAGGGAAACAGGAGGAAGATGG + Intronic
1115307047 14:31944308-31944330 CATGGTAAACACTTGGAGGGAGG - Intergenic
1115315254 14:32018622-32018644 CTAGAGAAACAATAGGAGGAGGG - Exonic
1115865731 14:37744742-37744764 AAAAGGAAACACTGGGAGTTGGG + Intronic
1118615150 14:67569928-67569950 CAGGGGAAACAAGGGCAGGAGGG - Exonic
1119012604 14:71010966-71010988 CAATGGAAACAGTAGGAGGAGGG + Intronic
1119140930 14:72266419-72266441 CTAGGTAAAAACTGGGAGGACGG - Intronic
1119380701 14:74226325-74226347 AAAGGGCAAGACTGGGAGGTGGG - Intergenic
1120310733 14:82824441-82824463 CAAGATAAACACTGTGAGGTAGG + Intergenic
1121006773 14:90495730-90495752 CAAGGAAAACAGTGGGATGATGG + Intergenic
1123110921 14:105866519-105866541 CAAGGCAAAGGCTGGGAGGCTGG + Intergenic
1124402987 15:29366546-29366568 CAAGGGAAACTCTGGGGACATGG - Intronic
1124531877 15:30515778-30515800 CAAGGGAAGCACGGGAAGCAAGG + Intergenic
1124587623 15:31024324-31024346 CAAGGGATAAGGTGGGAGGATGG - Intronic
1124649588 15:31465041-31465063 CCAGGGTCACACAGGGAGGAAGG - Intergenic
1124766780 15:32491879-32491901 CAAGGGAAGCACGGGAAGCAAGG - Intergenic
1124889166 15:33716071-33716093 CGAGAGAAAGAGTGGGAGGAAGG - Intronic
1125759176 15:42085319-42085341 TTAGGGAAACACAGAGAGGAAGG - Intronic
1126401966 15:48281162-48281184 AAAGTGAAACACAGAGAGGATGG - Intronic
1127633547 15:60848373-60848395 TAAGGGAAAAAGAGGGAGGAAGG + Intronic
1128683215 15:69666290-69666312 AAAGGCACACACTGGGAGGAAGG + Intergenic
1128913657 15:71540047-71540069 TAAGGGAATCATTGGGAGCAAGG + Intronic
1129703775 15:77783030-77783052 CAAGGCAAAGGCTGGGAGGTGGG - Intronic
1129887328 15:79047805-79047827 CACGGTCCACACTGGGAGGAAGG + Intronic
1130667877 15:85885103-85885125 CAAGGGACTCCCTGTGAGGATGG + Intergenic
1131341065 15:91601380-91601402 CATGGGAAATACTGGGAGAGGGG - Intergenic
1131390549 15:92044482-92044504 GAAGGGAAAGGCTGGGAGAAGGG - Intronic
1131393362 15:92067305-92067327 CACGGGAAGCAGAGGGAGGAGGG - Intronic
1132130536 15:99273914-99273936 CTAGGGAACCAGTGGGTGGAGGG - Intronic
1132180006 15:99745100-99745122 TAAGGGAAACACTTGGAACACGG + Intergenic
1132851295 16:2026222-2026244 CAAGGGAAAGAATGGCAGCAGGG + Intronic
1132887712 16:2189809-2189831 CAAGGCCAACCCTGGGAGGTGGG + Intronic
1133507030 16:6422389-6422411 GAGGGGAAAGACAGGGAGGAGGG - Intronic
1133864224 16:9626797-9626819 CAAGGGAGACACTGGATGGAGGG + Intergenic
1135146762 16:19969409-19969431 CAAGGGACTCACTGGGGGAATGG + Intergenic
1135379485 16:21982514-21982536 CAAGAGCAACACTGGTAAGAGGG - Intronic
1139934866 16:70562604-70562626 CAAGGGGAACACTGACAGGCAGG - Intronic
1141244868 16:82296487-82296509 CAGGGGAAAGTGTGGGAGGAGGG - Intergenic
1141263873 16:82478028-82478050 CAAAGGAAAGACTGGGTGGGAGG - Intergenic
1141322048 16:83020360-83020382 CCTGGGAAACTCTTGGAGGAAGG + Intronic
1142044235 16:87914804-87914826 CTAGGGAAACACTTAGGGGACGG - Intronic
1144100847 17:11941048-11941070 CCAAGGAACCACTGGCAGGATGG - Intronic
1144196951 17:12903743-12903765 CAGGGGAAAGGGTGGGAGGAGGG - Intronic
1144770621 17:17757476-17757498 CAAGGCACACACTGGCAGGTGGG - Intronic
1144936588 17:18903952-18903974 CAAATGAAAAACTTGGAGGAGGG - Intronic
1145866715 17:28246553-28246575 CCAGGGAGACAGTGGGAGGAGGG + Intergenic
1147390977 17:40108978-40109000 CATGGTAAACAGTGGGGGGAGGG + Intergenic
1147450623 17:40501770-40501792 GAAGGGAAGCACTGGGTGGTGGG + Intergenic
1148110723 17:45143663-45143685 GAAGGCAAACACTGACAGGACGG - Exonic
1148492537 17:48032603-48032625 CAGGAGAAAAACAGGGAGGAAGG + Intronic
1148778588 17:50109487-50109509 CCAGGGAAGGACTGGGGGGATGG - Intronic
1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG + Intronic
1150495409 17:65604317-65604339 CATGAGATCCACTGGGAGGAAGG + Intronic
1150590867 17:66560968-66560990 CCAGGGAAAAACTGGGAGACAGG - Intronic
1151256474 17:72880611-72880633 CAAGGGAAAAATTGGGAGAGGGG + Intronic
1151547114 17:74799925-74799947 CAAGGTAAACCGTGGGAGGGCGG - Intronic
1152892888 17:82892456-82892478 CAAGGGTTACACTGGGAGCTTGG - Intronic
1154038743 18:10833154-10833176 CAAGGAACACAGTGGCAGGATGG + Intronic
1154083454 18:11280038-11280060 CAAGTGAGAGACTGGGAGGGAGG + Intergenic
1155301888 18:24437136-24437158 CAAGGGAAACTTTTAGAGGAAGG + Intronic
1156053142 18:32963296-32963318 GAATGGAAACACTGTGAGGTGGG - Intronic
1156212315 18:34958184-34958206 CAAAGTAAACACTGGGAAGTGGG - Intergenic
1156392432 18:36663419-36663441 AAAGCCAAAAACTGGGAGGAAGG - Intronic
1157309145 18:46538851-46538873 CAAGTGAGAGACTGGGAGCAGGG - Intronic
1158673842 18:59500848-59500870 CAATGGAAACACAGGAAGGTGGG + Intronic
1158710226 18:59830897-59830919 CCAGAGAAAGACAGGGAGGAAGG + Intergenic
1159453564 18:68633036-68633058 CAGGGGAAAGGGTGGGAGGAGGG - Intergenic
1159626676 18:70703273-70703295 TTAGAGAAACACTGGGAAGAAGG - Intergenic
1161431281 19:4233687-4233709 CAAGGGGGAGACAGGGAGGAGGG - Intronic
1161539662 19:4842621-4842643 AAAGGCACACACTGGGAGGTAGG + Intronic
1161644504 19:5444725-5444747 CAAGGGGGAGACAGGGAGGAGGG - Intergenic
1161717780 19:5886526-5886548 AAAGAGATACACAGGGAGGAAGG + Intronic
1161737942 19:6002951-6002973 CAGGGACAACACAGGGAGGAGGG + Intronic
1163298563 19:16428780-16428802 CATGGGTAACTGTGGGAGGAAGG + Intronic
1163760427 19:19133312-19133334 CCAGGGGAACACTGGGAGGTAGG + Intronic
1164594719 19:29525693-29525715 CGAGGGACACACGGGGAGCAGGG + Intergenic
1165335778 19:35168723-35168745 TAAGGGAGACACCTGGAGGAAGG - Intronic
1165569262 19:36761650-36761672 CAAGGGACGTGCTGGGAGGATGG - Exonic
1165758364 19:38307119-38307141 CCAGGGAAATTCTGGCAGGAAGG + Intronic
1165941656 19:39417558-39417580 CTAGGGAAGCACTGGGCGGAGGG + Exonic
1166966015 19:46529621-46529643 AAAGGGAAAGAAAGGGAGGAAGG + Intronic
1167070865 19:47221429-47221451 CAGGGGTGACACTGGGAGGGGGG - Exonic
1167428829 19:49442969-49442991 CAGGGGCAAGACTGGGAGGGCGG - Intergenic
1167571180 19:50290117-50290139 GAAGGGAGTCACTGGGTGGATGG - Intronic
1168578762 19:57535767-57535789 TAAGGGAAAAACAGGGAGGTGGG - Intronic
1168710114 19:58494725-58494747 CAACAGAAACAAAGGGAGGAGGG - Intronic
925799404 2:7583262-7583284 CAGGAGAAAGAATGGGAGGAAGG + Intergenic
926038055 2:9650343-9650365 CAGGGGAAACCCTGGGGGTAGGG - Intergenic
927693846 2:25227069-25227091 CAAAGGGAACACTGGGTGAAGGG + Intergenic
927767316 2:25822780-25822802 AATTGGAAACACTGGGAAGATGG + Intronic
928444112 2:31317914-31317936 CCCGGGGAATACTGGGAGGATGG + Intergenic
928469386 2:31558548-31558570 ACAGGGAAACACCGGGACGATGG - Intronic
928752452 2:34486633-34486655 CATAGGAAACACTGGGAGACAGG - Intergenic
929962135 2:46504840-46504862 CCAGGGAAAGGCTGGAAGGAAGG - Intronic
930241552 2:48940887-48940909 CAAGGGAAAGAAGAGGAGGAGGG - Intergenic
930635126 2:53796277-53796299 GAAGGTAAAGAATGGGAGGAGGG - Intronic
932112498 2:69013581-69013603 CAAGGGGGACGCAGGGAGGATGG + Exonic
932324498 2:70848404-70848426 AAAAGGAAAAACTGGAAGGATGG + Intergenic
932695925 2:73956496-73956518 AAGGGGAAAAACTGGAAGGAGGG + Intronic
932781361 2:74560592-74560614 CAAGGGATCCACTGTGAGCATGG + Intronic
933743523 2:85553357-85553379 CACAGGAAACACTGGGCTGAGGG + Exonic
933990244 2:87628651-87628673 CAAGGGAGACAGAGGGTGGAGGG + Intergenic
935257898 2:101328583-101328605 CAGAGGTAACGCTGGGAGGAAGG + Intergenic
935462303 2:103352655-103352677 CAAGAGAGTCACTGGGAGAAAGG - Intergenic
936029194 2:109058108-109058130 CACGGGCATCACTGGCAGGATGG - Intergenic
936303602 2:111322173-111322195 CAAGGGAGACAGAGGGTGGAGGG - Intergenic
937872030 2:126792810-126792832 CCAGGGAAACAGTGGGAGGCAGG + Intergenic
938700122 2:133869945-133869967 CAAGGGAAAGGGTGGGAGCAGGG + Intergenic
939683422 2:145167927-145167949 CAGAGGATACACTGGGAAGATGG + Intergenic
940718708 2:157258217-157258239 CAAGGAAGACATTGTGAGGAGGG + Exonic
941017502 2:160373873-160373895 CAAGGGAAGATCAGGGAGGAGGG + Intronic
942164397 2:173228079-173228101 CAAGGGCAACCCTGGAGGGAAGG + Intronic
942472313 2:176273676-176273698 CAAGGGAAATACTGGTAGTAAGG - Intronic
942864728 2:180659597-180659619 TAAGGGATACAGTGTGAGGAGGG + Intergenic
943591636 2:189804848-189804870 CAAGGAAAGCATTGGGAAGAAGG - Intronic
943919152 2:193679978-193680000 CAAGGGAAACAGAGAAAGGAAGG + Intergenic
944494734 2:200295336-200295358 GAAAGGAAAGAATGGGAGGAAGG - Intergenic
945032885 2:205682104-205682126 CAAGGGAGACCCCGGGGGGACGG - Intronic
945517050 2:210775281-210775303 CAAGAGCAGCACTAGGAGGATGG - Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946072631 2:217047631-217047653 GAAGGGCACCAGTGGGAGGATGG - Intergenic
947337344 2:229101080-229101102 CAATGGAAACTTGGGGAGGATGG + Intronic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947767441 2:232646774-232646796 CCAGGGAAACTCTGGAAGGTGGG - Intronic
1169111575 20:3037434-3037456 CACAGGAAACATTGGGAGGCAGG + Intronic
1169161003 20:3378357-3378379 CGCAGGAAAGACTGGGAGGAAGG + Intronic
1170552025 20:17486416-17486438 CAAGAGAAAGGGTGGGAGGATGG + Intergenic
1170856542 20:20061702-20061724 CATGGGGAACACAGGGAGGCGGG - Intronic
1171458091 20:25283085-25283107 CGTGGGCAACAATGGGAGGAGGG + Intronic
1172173847 20:32960701-32960723 TAAGGGGACCACAGGGAGGAGGG - Intronic
1172635699 20:36408239-36408261 AAAGGGAAGAACAGGGAGGAGGG + Intronic
1173576668 20:44116390-44116412 CCAGGGCAACACAGGGAGGCTGG + Intronic
1174556588 20:51399982-51400004 CAGGTGAGACACGGGGAGGAGGG - Intronic
1175593370 20:60211665-60211687 CAAAGGAAACACATGGAGAATGG + Intergenic
1176164970 20:63668049-63668071 CTGGGCACACACTGGGAGGAGGG - Intronic
1176165004 20:63668151-63668173 CCGGGCACACACTGGGAGGAGGG - Intronic
1176911439 21:14569985-14570007 CAAGTGAAAAACTGGGGGGGGGG - Intronic
1180155880 21:45977289-45977311 GAAGGGAGAGAGTGGGAGGAGGG - Intergenic
1181407020 22:22692308-22692330 CAAGGCGGGCACTGGGAGGACGG + Intergenic
1181410024 22:22712234-22712256 CAAAGGAAACAGAGAGAGGAGGG - Intergenic
1181415004 22:22753073-22753095 CAAGGTGAGCACTGGGAGGACGG + Intronic
1181513888 22:23400852-23400874 CAGGGCAACCACAGGGAGGAGGG + Intergenic
1181660200 22:24341167-24341189 CAGGGCAGATACTGGGAGGAGGG + Intronic
1182619323 22:31610160-31610182 CAAGGGTGGGACTGGGAGGAGGG + Intronic
1183395582 22:37569105-37569127 CAAAGGACACACTGTGAGGCTGG - Exonic
1183956092 22:41381619-41381641 AAGGGGGAACACTGGTAGGAGGG + Intronic
1183982109 22:41547211-41547233 CAAGAGAGAGAGTGGGAGGAGGG - Intergenic
1184195726 22:42926493-42926515 GAAGAAAAACAGTGGGAGGAAGG + Intronic
1184916887 22:47575427-47575449 CAAGGGAAGGACAGGGAGGAGGG - Intergenic
1185310877 22:50153587-50153609 CGAGGGAAGCACCGGGAGGGAGG - Intronic
1185359962 22:50400200-50400222 CAAGGGAAACACTGGGAGGAAGG + Intronic
949326205 3:2867632-2867654 CAAGGGAGAAGCTGAGAGGATGG - Intronic
950461469 3:13124813-13124835 GAAGGCAGCCACTGGGAGGAGGG - Intergenic
950647052 3:14383470-14383492 CCAGGGAGCCACTGGGAGGCTGG + Intergenic
950901871 3:16505244-16505266 GAAAGGAAACAATGGGAGGTAGG - Intronic
952383037 3:32818877-32818899 CTCGGGAAACACTGAGAGGATGG - Exonic
952576391 3:34779170-34779192 AAAGGAACACACTGGGATGATGG + Intergenic
952747814 3:36798131-36798153 CAATGGGAACACTTGGAGGAAGG - Intergenic
952760108 3:36905929-36905951 CAAGGGGAACAGTGTCAGGAAGG + Intronic
953573960 3:44097970-44097992 CCAGGGAAGCACTGGTTGGAGGG + Intergenic
953884573 3:46708030-46708052 CCAGGCATACACTTGGAGGAGGG - Intronic
954416778 3:50397119-50397141 CAAGGGAGACCCAGGGAGGGAGG + Intronic
955465697 3:59235077-59235099 CTAGAGAAACACAGGAAGGAGGG - Intergenic
956773839 3:72549089-72549111 GAAGGGAAACAGTGGGAAGGAGG - Intergenic
959592177 3:108092435-108092457 CAATGGAAAGTCTTGGAGGAGGG - Intergenic
960237341 3:115299122-115299144 CATGAAAAACACTGGGAGCAAGG + Intergenic
960778708 3:121292878-121292900 CAAGGGAAAGGGTGGGAGGTAGG + Intronic
961486831 3:127222576-127222598 CCAGGGAAGCAGTGGGAGGGAGG + Intergenic
961810354 3:129518462-129518484 CAGGGGCCACACTGGGAGGAGGG + Intronic
962040815 3:131705801-131705823 CAAGGGAAGGAATGGAAGGAGGG + Intronic
962453109 3:135538415-135538437 CAAGGGAAGGACTTGGAAGAAGG - Intergenic
963769994 3:149379510-149379532 CAAGTGAGAGACTGGGGGGAGGG + Intergenic
963918851 3:150886726-150886748 CCAGGGAAGCAGAGGGAGGAGGG - Intronic
964026258 3:152078560-152078582 CCAGGGGAATACTGGTAGGATGG - Intergenic
964132922 3:153311266-153311288 CATGGGAGACACTGGGTCGAAGG + Intergenic
964439335 3:156689808-156689830 CCAGGCAAACAATGGGAGGCAGG - Intronic
965069094 3:163894219-163894241 CAAGGTACACAATGGGAGGAGGG + Intergenic
965606057 3:170498695-170498717 AATGGGAAATACTGGGCGGAGGG - Exonic
966150003 3:176857426-176857448 CAAAGGAAACCCTGGAAGGAAGG + Intergenic
967043468 3:185715431-185715453 CCAGGTAAACACCGGGAGGCAGG + Intronic
967156264 3:186695264-186695286 GAAGTTGAACACTGGGAGGATGG - Intergenic
967529603 3:190533491-190533513 CAGGGGAAGCACAGGGGGGAGGG - Intronic
967911838 3:194548905-194548927 CAAGCGAAAGACTTGGAGAAAGG + Intergenic
967967892 3:194976391-194976413 CAAAGGAAACACCTGGAAGAGGG + Intergenic
968446502 4:654962-654984 CGTGGGAAGCCCTGGGAGGACGG - Intronic
969213289 4:5704384-5704406 CAAAGGAACCACTGACAGGAAGG + Intronic
969252811 4:5980938-5980960 AAAGGGAATTTCTGGGAGGAAGG + Intronic
970126050 4:12812519-12812541 GAAGGGAAACAGGGGGAGAATGG + Intergenic
970511256 4:16784045-16784067 AAAGGGAACCACTGGCAGCAGGG - Intronic
970640078 4:18054271-18054293 CAAGGCAGCCAGTGGGAGGAAGG - Intergenic
971115212 4:23638285-23638307 CAGGGGAAAGAGTGGGAGTAAGG - Intergenic
971493003 4:27234229-27234251 GAAGAGAAAGAGTGGGAGGAAGG - Intergenic
971934320 4:33128127-33128149 CCAGGGAAAGGGTGGGAGGAGGG - Intergenic
972986472 4:44772040-44772062 CAAGGGAAGAATTGGGAGAAGGG + Intergenic
975756771 4:77579059-77579081 CAAGGGCTACACTCTGAGGATGG + Intronic
976424583 4:84887202-84887224 CCAGGGAAACACAGGAAGGCTGG + Intronic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
978115142 4:105010709-105010731 CAAGGGAAAAACTGGTAGAAGGG + Intergenic
978832325 4:113102931-113102953 AAAGTGTAACACAGGGAGGAGGG + Intronic
979485689 4:121267358-121267380 GAAGGCAAGCTCTGGGAGGAAGG + Intergenic
979593573 4:122507698-122507720 CAAGGGAAAAACTGAAAGTAAGG + Intergenic
979702295 4:123683732-123683754 CAAGGGAGAGACTTGGTGGAAGG + Intergenic
981485547 4:145282302-145282324 GATGGGAAAAACTGAGAGGAGGG + Intergenic
981736769 4:147961755-147961777 GAATGGAAACACTGGGATTAAGG - Intronic
982309578 4:153971018-153971040 CAAGGGAAACACTTGGATCGTGG - Intergenic
983624769 4:169791368-169791390 CATTGGAAAGACTGGGAAGATGG - Intergenic
983818701 4:172166634-172166656 CAATAAAAACACTGGTAGGAAGG - Intronic
983909307 4:173219123-173219145 CTCGGGAAAGACTGGGAGGGAGG - Intronic
984241003 4:177219214-177219236 CAAGGGAAAAAGAGGGAGTAGGG - Intergenic
984641906 4:182175837-182175859 CATGCGGAACACTGGGATGATGG + Intronic
985071800 4:186172937-186172959 CAAGAGAAACAGTGGGGAGAGGG - Intergenic
985263481 4:188136743-188136765 AAAGAGAAAGACTGGGAGGTAGG + Intergenic
985639019 5:1054496-1054518 CTGGGGAAACGCTGGGCGGAGGG + Intronic
986174053 5:5336963-5336985 CATGGGCAGCACAGGGAGGAGGG + Intergenic
988181074 5:27794939-27794961 TAAGAGAAACACTGAGAGAAAGG + Intergenic
988445956 5:31286452-31286474 CAAGGGAACCACATGCAGGAAGG + Intronic
988506083 5:31824511-31824533 TAGGGGCTACACTGGGAGGAAGG + Intronic
988673326 5:33405694-33405716 CAAGGGAAACACCTGGGAGAAGG + Intergenic
989832734 5:45940506-45940528 CTAGGAAAAAACTGGAAGGAAGG + Intergenic
990961150 5:61394700-61394722 CAAGGCAAATACTGTTAGGAGGG + Intronic
991111266 5:62902190-62902212 CCAGGGAATTGCTGGGAGGATGG + Intergenic
991970044 5:72131774-72131796 CAGAGAAGACACTGGGAGGAAGG - Intronic
992232106 5:74673548-74673570 CGGAGGACACACTGGGAGGAGGG - Intronic
992554859 5:77893181-77893203 CCAGGAGAACACTTGGAGGAGGG - Intergenic
992638042 5:78744322-78744344 GAAGGGACATACTGGGAGAAGGG - Intronic
993238738 5:85351314-85351336 GAAGGGAAAGGCTGGGAGGAGGG - Intergenic
994247318 5:97494042-97494064 CAAAGATAACACTTGGAGGAGGG + Intergenic
994614338 5:102084595-102084617 CAAGGGAAACACAGGCATTAGGG + Intergenic
994738685 5:103591200-103591222 TAAGGGAAACTGTGGGAGGTTGG - Intergenic
994974652 5:106786951-106786973 CACAGGAAAGACTGAGAGGAAGG - Intergenic
995402628 5:111759075-111759097 CCAGGGAAGTACTGGAAGGAAGG + Intronic
995969571 5:117952041-117952063 CAAGGGAAACATTGTGGGAAAGG - Intergenic
996677266 5:126190887-126190909 CCAAGGAAACACTGGGCAGAAGG - Intergenic
997299840 5:132795157-132795179 CAAGGGAAAAAATGAGATGAAGG + Intronic
998651808 5:144129057-144129079 CAAGAGAAAAGCTTGGAGGAGGG + Intergenic
999699720 5:154217413-154217435 CAAGGGAGACAGTGAGAGGGTGG + Intronic
1001619941 5:173075351-173075373 CAAGGAATACACTGGGGGAAAGG - Intronic
1001873567 5:175179842-175179864 CAAGGGAACCACAGGAATGAAGG - Intergenic
1001991514 5:176119845-176119867 CAAGGGAAAGATAGGAAGGAGGG - Intronic
1002225362 5:177718281-177718303 CAAGGGAAAGATAGGAAGGAGGG + Intronic
1002254862 5:177951377-177951399 CGAGGGAAACACTGAGGGGATGG - Intergenic
1002254888 5:177951479-177951501 CGAGGGAAACACTGAGGGGCTGG - Intergenic
1002254901 5:177951530-177951552 CGAGGAAAACACTGAGGGGAGGG - Intergenic
1002254915 5:177951581-177951603 CGAGGGAAACACTGAGGGGATGG - Intergenic
1002268482 5:178052833-178052855 CAAGGGAAAGATAGGAAGGAGGG - Intronic
1002483186 5:179516885-179516907 CGAGGGAAACACTGAGGGGGTGG + Intergenic
1002483200 5:179516936-179516958 CGAGGGAAACACTGAGGGGGTGG + Intergenic
1002483253 5:179517140-179517162 CGAGGGAAACACTGAGGGGGTGG + Intergenic
1002483267 5:179517191-179517213 CGAGGGAAACACTGAGGGGGTGG + Intergenic
1002483294 5:179517293-179517315 CGAGGGAAACACTGAGGGGGTGG + Intergenic
1004116392 6:12771856-12771878 CAAGGGCAAGACTGGGGGAAGGG + Intronic
1004429694 6:15532284-15532306 CAAAGGAAAAGCTGGGAAGAAGG + Intronic
1005131890 6:22518220-22518242 AAAAGGAAATACTGGGAAGATGG + Intergenic
1005704361 6:28436718-28436740 AAAGGGAAACAAATGGAGGATGG + Intronic
1005911018 6:30309600-30309622 CAGGGGAAAGACTGGGAGTGTGG + Intergenic
1005959053 6:30683602-30683624 GAGGGGAAACCCAGGGAGGAAGG + Intronic
1007485706 6:42179207-42179229 AAAGGGAATCAGGGGGAGGAGGG - Intronic
1008004274 6:46393478-46393500 CAGGGGAAACGGTGGGATGAGGG + Intronic
1008196000 6:48521605-48521627 AAAGAGAAAAACTGGGAGAATGG + Intergenic
1008267289 6:49444156-49444178 CAAGGGAAGGACTGGGAGGGGGG + Intronic
1008358914 6:50591549-50591571 GAAGGGAAACAATGGGGGGCTGG + Intergenic
1008543042 6:52562296-52562318 TAAGGGAAGCACAGGGAGAAAGG + Intronic
1009938357 6:70260003-70260025 CAAGGCAAAGACAGGGAGGATGG - Intronic
1010368278 6:75078007-75078029 CAAGGGAAAGAATGGCAGCAGGG + Intergenic
1011351590 6:86429910-86429932 GAAGGGAAAGACTGGAAAGATGG - Intergenic
1012258999 6:97065870-97065892 CCAGGGAGACAGTGTGAGGAAGG + Intronic
1013091967 6:106908270-106908292 CAAGGGAGACTTGGGGAGGAGGG - Intergenic
1013285192 6:108675274-108675296 CAAGGGAGACACAGGGAGAGAGG - Intronic
1013294225 6:108744221-108744243 CAAGGGAAGCAAGGGAAGGAAGG + Intergenic
1013685994 6:112583771-112583793 CAGGGAAAAAACTGGGAGGTGGG - Intergenic
1014034716 6:116753086-116753108 CTAGGGAAAGACTGGTAGGCAGG - Intronic
1014945016 6:127487434-127487456 ATAGGGTAACACTGGGAGGGAGG + Intronic
1015281863 6:131442849-131442871 CAAGGAAAACACTAGGATCATGG - Intergenic
1016139949 6:140595682-140595704 AGAGGGAAAGACTGGGAGAAAGG + Intergenic
1016459263 6:144264929-144264951 CAAGGTAACCACTGAGAGGCTGG + Intergenic
1017146527 6:151240312-151240334 CGAGGGAAAAACCGGGGGGAGGG + Intronic
1017459257 6:154633786-154633808 CAAGCGAGACATTTGGAGGATGG - Intergenic
1018690222 6:166338657-166338679 CAAGGCAAGCACTGGGGAGAGGG + Intronic
1019234395 6:170597537-170597559 GAAGGGAAGCAAAGGGAGGAAGG + Intergenic
1019479769 7:1261178-1261200 CAGGGGACGGACTGGGAGGATGG + Intergenic
1019479777 7:1261201-1261223 CAGGGGACGGACTGGGAGGATGG + Intergenic
1019479808 7:1261288-1261310 CAGGGGACGGACTGGGAGGATGG + Intergenic
1019479816 7:1261311-1261333 CAGGGGATGGACTGGGAGGATGG + Intergenic
1019479838 7:1261376-1261398 CAGGGGACGGACTGGGAGGATGG + Intergenic
1019479863 7:1261445-1261467 CAGGGGACGGACTGGGAGGATGG + Intergenic
1019479871 7:1261468-1261490 CAGGGGATGGACTGGGAGGATGG + Intergenic
1019479886 7:1261510-1261532 CAGGGGACGGACTGGGAGGATGG + Intergenic
1019479894 7:1261533-1261555 CAGGGGACGGACTGGGAGGATGG + Intergenic
1019479902 7:1261556-1261578 CAGGGGACGGACTGGGAGGATGG + Intergenic
1019479918 7:1261602-1261624 CAGGGGACGGACTGGGAGGATGG + Intergenic
1019479926 7:1261625-1261647 CAGGGGATGGACTGGGAGGATGG + Intergenic
1020119749 7:5496350-5496372 CAAGGGAGGCACTGGCCGGAGGG - Intronic
1020204478 7:6104628-6104650 CCAGGGAAGCACAGGGCGGAAGG + Intergenic
1021998002 7:26200100-26200122 TAAGGAAAACGCTGAGAGGAAGG + Intronic
1022685716 7:32594289-32594311 TAAGGGAAAGAGTGTGAGGAGGG + Intergenic
1022777457 7:33542476-33542498 TGAGGGAAAGAGTGGGAGGAGGG - Intronic
1022848644 7:34237035-34237057 CAAGGAAAGCCTTGGGAGGATGG + Intergenic
1022957954 7:35398712-35398734 CAAGGTAAACGGTGGGAAGAAGG - Intergenic
1024198336 7:47081846-47081868 GAGGGGAGACACTGGGAGGAAGG + Intergenic
1024875718 7:54020714-54020736 CGGGGGAAAGAGTGGGAGGAGGG - Intergenic
1026844536 7:73690791-73690813 GAAGGGAAGCTGTGGGAGGAGGG + Intronic
1028189700 7:87831705-87831727 CAATGGAAACTTTGGGAGAAGGG + Exonic
1028760594 7:94491775-94491797 CAGGGGAAAGAGTGGGAGGGAGG + Intergenic
1029585579 7:101468722-101468744 CTGGGGAAACTGTGGGAGGAGGG + Intronic
1029918936 7:104241545-104241567 CCAGGGATACACTGGGACAAGGG - Intergenic
1032106688 7:129037572-129037594 CAAGAGAAAGACTGGGGGTAGGG + Intronic
1032845132 7:135745646-135745668 TTAGGGAAAGGCTGGGAGGATGG + Intronic
1033310669 7:140259744-140259766 CTAGGAAAAGACTTGGAGGAGGG + Intergenic
1033514779 7:142094877-142094899 CAAGTGAAACACTGGAGGTAGGG - Intronic
1033659947 7:143396295-143396317 CCAGGGAAGCGCTGGAAGGAAGG + Intronic
1034607359 7:152329626-152329648 GAAGGGAAACGAAGGGAGGAAGG + Intronic
1034879549 7:154752859-154752881 CAAGGGAAAGACATGGTGGACGG + Intronic
1035737790 8:1901299-1901321 CAGGAGAGTCACTGGGAGGAAGG - Intronic
1036615051 8:10381443-10381465 CAGGGGAAGAGCTGGGAGGAAGG + Intronic
1036793651 8:11740243-11740265 CTAGGGAGACACAGAGAGGAGGG + Intronic
1036974403 8:13394828-13394850 AAAGGGAAATACTGGGACAAGGG - Intronic
1037792234 8:21955628-21955650 CAAGGAAACCCCTGGAAGGACGG - Intronic
1037993382 8:23336368-23336390 CCAGTGAAACACTGGGATGGAGG - Intronic
1038408361 8:27339644-27339666 CAATGGAAAGACTGGCAGGGTGG + Intronic
1038680546 8:29663364-29663386 AAGGGGCAACACTGGGCGGAGGG - Intergenic
1039847123 8:41333413-41333435 GAAGGCAAGCACTGGGAGCAGGG + Intergenic
1041005344 8:53492569-53492591 CAAGGGAAGCAACGGGAGGTAGG + Intergenic
1041534133 8:58907120-58907142 CAAGGGAAATACAGGAGGGATGG - Intronic
1042110578 8:65377289-65377311 CAAAAGAAACAATGGAAGGAAGG - Intergenic
1042466935 8:69139230-69139252 CGAGGGGAAGAGTGGGAGGAGGG - Intergenic
1042684149 8:71418800-71418822 GAAGGGCAACAATGGGAGGGAGG + Intronic
1043489697 8:80736690-80736712 CAGGGGAAATAGTGGGAGGAGGG + Intronic
1043577271 8:81672564-81672586 AAAGGGACACACTGGGAGAGGGG - Intronic
1044163965 8:88957313-88957335 AAAGGGTAACACTGGGGGGTTGG - Intergenic
1044249333 8:89988004-89988026 TAAGGGAAAGACTGAGAGTAGGG + Intronic
1045875487 8:106976649-106976671 CAAGGGCAGCACTGGGAGTCTGG - Intergenic
1046607179 8:116384313-116384335 CAAAGCAAATACTGGGAGAAGGG - Intergenic
1046624989 8:116567170-116567192 CAAGGGAAAGGGTGGGAGGGGGG + Intergenic
1046669174 8:117038860-117038882 CAAGGCAAACACTTGTGGGATGG - Intronic
1046767476 8:118085254-118085276 CCATGGGAACAATGGGAGGAAGG + Intronic
1047167686 8:122458420-122458442 CAGTGGAAACAGTGGGTGGAGGG + Intergenic
1048272358 8:133039808-133039830 CAAGGGAATCCCTGGGTGCAGGG - Intronic
1048382775 8:133882685-133882707 CAAGGGGCACACAGGGAAGAAGG - Intergenic
1048722737 8:137345060-137345082 CAAGGGAAACAAAGGAAAGAAGG - Intergenic
1048838869 8:138547154-138547176 CAAAGGAAACACTGGGATTTAGG - Intergenic
1048874768 8:138828051-138828073 CGAGGAAAACATGGGGAGGATGG - Intronic
1049576788 8:143393384-143393406 CAAGGGAGACCCTGAGGGGAGGG - Intergenic
1049699731 8:144004826-144004848 CAAGGCACAGACTGGGAGCAGGG + Intronic
1050734186 9:8744642-8744664 CAAGGGAAAGGCTGGCAGCAGGG + Intronic
1051492587 9:17683269-17683291 CATGGGGAACACTGGGGGCAAGG + Intronic
1051518714 9:17960095-17960117 CAATGGAAACACAGGAAAGAAGG - Intergenic
1053165542 9:35841444-35841466 CAAGGGAAGCACTAGGAAGGAGG - Intronic
1053214161 9:36257500-36257522 CAAGCGTAAAACTGGGGGGAGGG + Intronic
1053796584 9:41732175-41732197 CAAGGGACATACCGGGAGGATGG - Intergenic
1054148593 9:61582646-61582668 CAAGGGACGTACCGGGAGGATGG + Intergenic
1054184993 9:61944235-61944257 CAAGGGACGTACCGGGAGGATGG - Intergenic
1054468352 9:65513801-65513823 CAAGGGACGTACCGGGAGGATGG + Intergenic
1054653517 9:67644265-67644287 CAAGGGACATACCGGGAGGATGG + Intergenic
1055301431 9:74887265-74887287 CACGGGGAACACTGGGCGCACGG + Intronic
1055751327 9:79508811-79508833 CAAGGGAAAAGCTTGCAGGAGGG - Intergenic
1056551505 9:87656782-87656804 CAAGGGACAGAGTGGGAGGTGGG + Intronic
1056844527 9:90025661-90025683 CCTGTGGAACACTGGGAGGAGGG - Intergenic
1057437853 9:95058750-95058772 AAAGGAAGACACTGGGAAGAGGG + Intronic
1057875306 9:98749077-98749099 CAAGGAAAACACTGGGTTGTGGG + Intronic
1059749854 9:117237810-117237832 GAAGTGAAACACTGTGAGCATGG - Intronic
1060352995 9:122875980-122876002 TAAGGGAAATAATGGGAGAAGGG + Intronic
1060926000 9:127455522-127455544 CAAGCTAAAAACTGGCAGGAGGG + Intronic
1061960796 9:133988083-133988105 CAGGGGAAATTCTGGAAGGAGGG + Intronic
1062095005 9:134698606-134698628 CAGGTACAACACTGGGAGGAAGG - Intronic
1185711372 X:2306251-2306273 CAAGAGAAACACTGGTAGGAAGG + Intronic
1186952687 X:14644614-14644636 CAAAAGAAACACTGTGAGTAAGG - Intronic
1186963379 X:14761376-14761398 CAAGGGGAATACTGGCAGGGAGG + Intergenic
1187448418 X:19376842-19376864 CAAGTGAAACAGTGGGAGTGGGG - Intronic
1187802009 X:23074425-23074447 GAGGGTAAACAGTGGGAGGAGGG + Intergenic
1188412635 X:29892716-29892738 AATGGGAAACAATGTGAGGATGG + Intronic
1188787935 X:34371850-34371872 AAAAGGAAATACTGGGAAGAAGG - Intergenic
1189218696 X:39351097-39351119 CAAGGGAAAGTGTGGGAGGCGGG - Intergenic
1189351843 X:40281378-40281400 CCAGGGAATCACTAGGAGAATGG + Intergenic
1189837362 X:45039477-45039499 CAAATGAATCAATGGGAGGAGGG - Intronic
1190485446 X:50919135-50919157 CAAGAAAAACACTGGCAGGATGG + Intergenic
1191819282 X:65285265-65285287 CAAGGGAAAGGGTGGGAGAAGGG - Intergenic
1191915336 X:66195040-66195062 AAAGGGATAAACAGGGAGGAAGG - Intronic
1195951299 X:110276726-110276748 CAAGGGCAACACTGTGAGGCTGG - Intronic
1196005087 X:110828205-110828227 CAAGGGGAAGGGTGGGAGGAGGG + Intergenic
1198750545 X:139932964-139932986 CGAGAGAAAGACTGAGAGGAGGG - Intronic
1199900029 X:152164023-152164045 CAAGGGAAGAACTGTGAGGGTGG + Intergenic
1200175836 X:154115665-154115687 CAAAGGAGACCCCGGGAGGAGGG - Intergenic
1200766817 Y:7087255-7087277 CAAATGAAGCACTAGGAGGATGG - Exonic
1201261719 Y:12165132-12165154 CAAGGAAACCTCTTGGAGGATGG - Intergenic
1201684069 Y:16681958-16681980 CAAGGGTAACAATGGGACAAGGG - Intergenic
1201785992 Y:17779721-17779743 AATGGGAAACACTTGGGGGAGGG - Intergenic
1201815561 Y:18126267-18126289 AATGGGAAACACTTGGGGGAGGG + Intergenic