ID: 1185362089

View in Genome Browser
Species Human (GRCh38)
Location 22:50414396-50414418
Sequence TTGTAAGAAAGCCCCCTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 74}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185362089 Original CRISPR TTGTAAGAAAGCCCCCTCAA GGG (reversed) Intronic
906935809 1:50213180-50213202 TTCTAGGAAAGCTCCCTAAATGG + Intergenic
909797703 1:79763527-79763549 TGGTTAAAAGGCCCCCTCAAAGG - Intergenic
911812664 1:102303251-102303273 TTTAAATAAGGCCCCCTCAAGGG + Intergenic
912860724 1:113211469-113211491 TTCTAAAGAAGCCCCCTCCAGGG - Intergenic
916798832 1:168194980-168195002 TGGTAAGAAAGGCCCCTCTGTGG + Intronic
918674591 1:187267091-187267113 TTGTACGAAAGCCCCTACAGTGG - Intergenic
921827273 1:219687265-219687287 TTGGAAGAAAGCAACCTCGATGG + Intronic
1064425078 10:15223217-15223239 TGGTAAGAAAGCTTCCTCAAAGG + Intronic
1079677874 11:23254125-23254147 TTATAAGAAAGGCTCTTCAAGGG - Intergenic
1081862245 11:46339817-46339839 TTTTCAGAAAGGCCCCTCCAAGG + Intronic
1083807271 11:65082185-65082207 TTTTAAGAAAGACCCCTCTGGGG - Intronic
1084950094 11:72660058-72660080 CTATAAGAAGTCCCCCTCAAAGG + Intronic
1105566971 13:21558925-21558947 TGGGAAGAAAGCCCTCTGAATGG + Intronic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1106552134 13:30781117-30781139 TTGTAACAACCCACCCTCAAAGG - Intergenic
1108398282 13:50011692-50011714 TTGTTGGAAAGCCCACACAAAGG + Intronic
1108427099 13:50313438-50313460 TTCTAACAAATCTCCCTCAAGGG - Intronic
1109798118 13:67342709-67342731 TTGTAAAAAAGACCCCGGAAGGG - Intergenic
1113865895 13:113523295-113523317 TTGTAAGAAAACTCCCCAAAAGG - Intronic
1114615560 14:24066354-24066376 TTGTAAGAAAGTCTCCTCTGTGG - Intronic
1117717527 14:58596198-58596220 TTGTAAGAAAGCCACTTGAACGG - Intergenic
1119084840 14:71730256-71730278 GTGTAAGAAGGCCTCCTCAACGG - Exonic
1133668300 16:7992749-7992771 TTGAATTAAAGCCCTCTCAAGGG + Intergenic
1136081587 16:27855808-27855830 TAGCAAGAAATCACCCTCAAGGG + Intronic
1138859222 16:60735146-60735168 TTGTAAGGAAGCAACCTCTACGG - Intergenic
1147369153 17:39979972-39979994 ATGTATAAAAGCCCTCTCAATGG + Intergenic
1148806064 17:50264590-50264612 TTGAAGCAAAGCCCCCTCAAGGG - Intergenic
1150527896 17:65942601-65942623 TTGCAGGAAAGCCCCCTAAAAGG - Intronic
1157280168 18:46341760-46341782 TTGTAAGAAAGCTTGCTCAAGGG - Intronic
1158901085 18:61962379-61962401 TTCTAAGAAAGCTCACTCACAGG - Intergenic
1160452719 18:78977033-78977055 TTGTACGAATGCCCCCACAGCGG - Intergenic
1163918304 19:20262649-20262671 TTCTAAGAAACCCTTCTCAAAGG - Intergenic
927957135 2:27215478-27215500 CTGCAAGCAAACCCCCTCAAAGG + Exonic
929400519 2:41575421-41575443 TTGTAAGAAAGCTTGCACAATGG + Intergenic
931014408 2:57959896-57959918 TTCTAACAAACCCCCCTCTAAGG - Intronic
931563498 2:63589090-63589112 GTGCAAGAAACCCCACTCAAGGG - Intronic
935818337 2:106868973-106868995 TTGTAATAAAGCCACATCTATGG + Intronic
938204639 2:129409157-129409179 TTTAAAGATAGCCCCCTTAAAGG - Intergenic
938604328 2:132876559-132876581 TTGTAAGAGAACACTCTCAATGG - Intronic
939932870 2:148255657-148255679 TTGTAAGAAAGCCTCCACCAGGG + Intronic
946920562 2:224576949-224576971 TTCTAAGAAAGCATTCTCAAAGG - Intronic
947891352 2:233623963-233623985 TTGTAAGAAAAGTCACTCAACGG - Intronic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1172323319 20:34014720-34014742 TTCTAAGAAACCCTTCTCAAAGG - Intronic
1173302787 20:41818628-41818650 TTGTAAGAGAGCCCACTGCAGGG + Intergenic
1173431481 20:42991178-42991200 GTGTAAAAATGCACCCTCAAGGG + Intronic
1174951643 20:55048500-55048522 TTGTCAAAAAGCCCATTCAAAGG + Intergenic
1174987053 20:55466762-55466784 TTTTAAGAATATCCCCTCAATGG - Intergenic
1175728497 20:61335645-61335667 TTGTCAGAAAACTCCCTCCATGG + Intronic
1179956124 21:44739802-44739824 TTTTAAGAAAGCTTCCTCACAGG - Intergenic
1182884703 22:33763445-33763467 TTGAAAAAAAGTCCCCTCTAGGG + Intronic
1185067970 22:48641466-48641488 TTCTAAGAAAACTCCCCCAAAGG + Intronic
1185362089 22:50414396-50414418 TTGTAAGAAAGCCCCCTCAAGGG - Intronic
952506670 3:34013366-34013388 TTGCAAGAGAGAGCCCTCAAGGG + Intergenic
960177152 3:114531544-114531566 TTGTGAGAAAGCTCCCTCTCAGG - Intronic
961409225 3:126706185-126706207 TTGAAAGAAGGCACCCCCAAAGG - Intronic
963525423 3:146409471-146409493 TGGTCAGAAGGCCCCCTCCATGG - Intronic
964827197 3:160841582-160841604 TTATAAGAAAGTCCATTCAAAGG - Intronic
965464370 3:169009214-169009236 ATGTAAGAAAAACCCTTCAATGG - Intergenic
969139038 4:5052914-5052936 TTCTAAGGTAGCCACCTCAAGGG - Intronic
970870064 4:20806071-20806093 ATTAAAGAAAGCCCCCCCAAAGG - Intronic
975198350 4:71553446-71553468 TTGAAAGAAAGCCACCACAAAGG - Intronic
975745359 4:77469926-77469948 TTAGAAAAAAGCCCCATCAATGG - Intergenic
976072434 4:81257364-81257386 TTGTAATCAAACCACCTCAATGG - Intergenic
991173881 5:63662517-63662539 TTTTAAGAAATACCCCTGAAAGG - Intergenic
994809065 5:104489801-104489823 TTGTAAGACAGTTCCCTTAAGGG - Intergenic
995467822 5:112468748-112468770 TTATAAAAAAGCCACCCCAAAGG - Intergenic
1003349957 6:5307151-5307173 TTTTAACAAATGCCCCTCAATGG - Intronic
1004780232 6:18900229-18900251 TTTAAAGAAAGCTCCCACAAAGG - Intergenic
1005348655 6:24913332-24913354 TCCTAAGGAAGCTCCCTCAAGGG - Intronic
1005422702 6:25669254-25669276 TTTGATGAAAGCCCACTCAATGG + Intronic
1017325454 6:153136512-153136534 TTGTAAGAATCTCCCCTCTAGGG - Intergenic
1020509197 7:9031563-9031585 TTGTAAGAAATGCCTCTAAAAGG - Intergenic
1023310638 7:38882822-38882844 TTTTAACAAAGCCTCCCCAATGG + Intronic
1024102800 7:46049960-46049982 TTCCAAGAAAGCCAACTCAAGGG - Intergenic
1026598558 7:71754310-71754332 TTTTCAGACAGCCCCCTCAAAGG + Intergenic
1031087372 7:117316165-117316187 TTCTAAGAAAGCACCCCAAAGGG - Intronic
1039594462 8:38778807-38778829 TTGGAAGAAACCACCCTAAAAGG + Intronic
1043546474 8:81321147-81321169 TTGTAAGTATGCCCTCTGAAAGG - Intergenic
1048409062 8:134152785-134152807 TTCTAAGAAATCCACCTGAAAGG + Intergenic
1053432786 9:38054251-38054273 TTGTCAGCTAGCCCCCACAAGGG + Intronic
1189802724 X:44706808-44706830 TTGTAAGGAAGAGCCCTGAATGG + Intergenic
1196892786 X:120307125-120307147 TTTTAAGAAAACCCCCTCCCAGG + Intronic
1200228089 X:154430417-154430439 TTATAAGAATTCCCCCTCACAGG - Intronic