ID: 1185362336

View in Genome Browser
Species Human (GRCh38)
Location 22:50415815-50415837
Sequence GACTTCTCTCTTAAGGACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 143}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185362336_1185362342 17 Left 1185362336 22:50415815-50415837 CCCTGGTCCTTAAGAGAGAAGTC 0: 1
1: 0
2: 0
3: 7
4: 143
Right 1185362342 22:50415855-50415877 ATACGCACCATTAGGACAGAGGG 0: 1
1: 0
2: 0
3: 4
4: 45
1185362336_1185362341 16 Left 1185362336 22:50415815-50415837 CCCTGGTCCTTAAGAGAGAAGTC 0: 1
1: 0
2: 0
3: 7
4: 143
Right 1185362341 22:50415854-50415876 CATACGCACCATTAGGACAGAGG 0: 1
1: 0
2: 0
3: 11
4: 64
1185362336_1185362343 21 Left 1185362336 22:50415815-50415837 CCCTGGTCCTTAAGAGAGAAGTC 0: 1
1: 0
2: 0
3: 7
4: 143
Right 1185362343 22:50415859-50415881 GCACCATTAGGACAGAGGGATGG 0: 1
1: 0
2: 2
3: 12
4: 174
1185362336_1185362345 24 Left 1185362336 22:50415815-50415837 CCCTGGTCCTTAAGAGAGAAGTC 0: 1
1: 0
2: 0
3: 7
4: 143
Right 1185362345 22:50415862-50415884 CCATTAGGACAGAGGGATGGTGG No data
1185362336_1185362340 9 Left 1185362336 22:50415815-50415837 CCCTGGTCCTTAAGAGAGAAGTC 0: 1
1: 0
2: 0
3: 7
4: 143
Right 1185362340 22:50415847-50415869 GAGCTTACATACGCACCATTAGG 0: 1
1: 0
2: 0
3: 2
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185362336 Original CRISPR GACTTCTCTCTTAAGGACCA GGG (reversed) Intronic
901126158 1:6930255-6930277 GTCTTCTCTGTTTTGGACCAGGG + Intronic
901209687 1:7517840-7517862 GACTTCTCTTTAAGGGACCTTGG - Intronic
902819909 1:18937524-18937546 GACTTCTCTCTCCAGCCCCATGG - Intronic
910062818 1:83114050-83114072 GTGTTCTCTCTTAAGGGGCAGGG - Intergenic
911519617 1:98912929-98912951 GAATTCTCTCCAAAGTACCATGG + Intronic
911999498 1:104812839-104812861 GAGCTCTCTGTTAAGGACCTTGG - Intergenic
912022203 1:105119516-105119538 TACTTTTCTCTTTAGGACAATGG + Intergenic
912280499 1:108308125-108308147 CAGTTTTCTCTTAAGGCCCAAGG + Intergenic
912287727 1:108386232-108386254 CAGTTTTCTCTTAAGGCCCAAGG - Intronic
915459630 1:156062082-156062104 GACTTCTCTCTTGAGAAGAAAGG + Intronic
916360602 1:163963038-163963060 GGCCTCTCCCTTCAGGACCATGG - Intergenic
918065365 1:181097141-181097163 GACTTTTCTTTTTAGGGCCATGG + Intergenic
918658060 1:187053817-187053839 GCCTTCTCTCTTACAGACTAAGG + Intergenic
919602549 1:199640326-199640348 GACTTTTCTCTTAAAGGACATGG + Intergenic
924009181 1:239645276-239645298 GGCTTCTCTCTTGAACACCAGGG + Intronic
1065117078 10:22493480-22493502 GCCTTCCATCTGAAGGACCAGGG - Intergenic
1066031086 10:31425993-31426015 GAGTTCTCTCCAAAGTACCATGG - Intronic
1067721821 10:48733047-48733069 GACTTCTCATTTAAACACCAAGG - Intronic
1067847763 10:49737110-49737132 GGCTTCTCTCTTGAGGGCCTGGG - Intronic
1068521941 10:58086407-58086429 GGCTTCTCTGTTGAGGAACAAGG + Intergenic
1072009199 10:91288686-91288708 GACCTCTCTAATAAGGCCCAAGG + Intergenic
1073175808 10:101556678-101556700 GATTTCTCTCTTCAGCTCCAAGG - Exonic
1074411634 10:113233879-113233901 GTCTTCCCTCTGAAGGAGCAAGG - Intergenic
1080217536 11:29862296-29862318 AAGTCCTCTCTTTAGGACCAAGG - Intergenic
1088152639 11:106764242-106764264 CACTTCTTTCTTAAGGAACAGGG + Intronic
1088334577 11:108689680-108689702 GTCTCCTCTCTTAAGGAGAAGGG + Intronic
1090983089 11:131740861-131740883 ACCTTCTCTCTTAAAGTCCAAGG - Intronic
1091835332 12:3581853-3581875 GACTTCTCTTTGAAGGCCCCAGG + Intronic
1095801654 12:46275366-46275388 GACCTCTCAGGTAAGGACCAGGG + Intergenic
1095843871 12:46724627-46724649 TACTTCTCTCTTCAGCCCCAGGG + Intergenic
1098688608 12:73457813-73457835 AATGTCTCTCTTAAGGACCTGGG - Intergenic
1099240937 12:80137824-80137846 GACTTCTCTATTAAAAATCAGGG + Intergenic
1100604043 12:96136412-96136434 GACTTCTCCACTCAGGACCAGGG - Intergenic
1101119217 12:101561942-101561964 GTCTGCTCTACTAAGGACCAGGG - Intergenic
1108207518 13:48105997-48106019 GACTTCTCTTTTAATTACCCAGG - Intergenic
1114549575 14:23525234-23525256 GACTTCGCTCTTCAGGGGCACGG + Exonic
1115262553 14:31469006-31469028 CACTTCTCCCTTTAGGCCCAAGG - Intergenic
1116402489 14:44525218-44525240 GACTGCTTTCTCAAGGACCTGGG + Intergenic
1117133397 14:52707716-52707738 CACTTCTCTCTTAAGCTCCGCGG - Intronic
1118793332 14:69116061-69116083 GCCTTCTCTCTTCAGACCCAGGG - Intronic
1119755871 14:77119111-77119133 GACTTCTCTCTGCACAACCAGGG + Intronic
1123130503 14:105981855-105981877 GATTTCATTCTGAAGGACCAAGG + Intergenic
1123195773 14:106615201-106615223 GACTTATATCTGAAGGTCCATGG + Intergenic
1123409951 15:20049944-20049966 GATTTCATTCTGAAGGACCAAGG - Intergenic
1123519283 15:21056651-21056673 GATTTCATTCTGAAGGACCAAGG - Intergenic
1123580742 15:21713076-21713098 GATTTCATTCTGAAGGACCAAGG + Intergenic
1123617391 15:22155699-22155721 GATTTCATTCTGAAGGACCAAGG + Intergenic
1124589664 15:31041848-31041870 TACTTCTCACTTAAGGACAATGG - Intronic
1124911007 15:33920661-33920683 GACTGTGCTCTTAAGGACAAGGG + Intronic
1128404044 15:67316908-67316930 GATTGCTTTCTTAATGACCAAGG + Intronic
1202989612 15_KI270727v1_random:447321-447343 GATTTCATTCTGAAGGACCAAGG + Intergenic
1134884893 16:17781795-17781817 GATTTCTCTCTTAAACCCCATGG + Intergenic
1144814403 17:18023676-18023698 GCCTTCTCTTTTAAGACCCAAGG + Intronic
1149045676 17:52242441-52242463 GAGTTCTCTCCAAGGGACCATGG + Intergenic
1150093952 17:62355849-62355871 CCCTTCTTTCTTAAGGGCCAAGG + Intergenic
1151527878 17:74683367-74683389 TCCGCCTCTCTTAAGGACCATGG + Intronic
1151704368 17:75758806-75758828 CACTGCTCCCTGAAGGACCAAGG - Intronic
1152618533 17:81349135-81349157 GATTTCTCTCTTGACAACCATGG - Intergenic
1153533626 18:6076912-6076934 GACATCTCTTTGAGGGACCAAGG + Intronic
1154477589 18:14778782-14778804 GACCTCACTCTTAAGTAGCAAGG + Intronic
1154482153 18:14841385-14841407 GACCTCACTCTTAAGTAGCAAGG + Intronic
1157716567 18:49891911-49891933 GTCATCTCTCACAAGGACCAGGG + Intronic
1160558380 18:79740387-79740409 CACTTCTTCCTTAAAGACCAGGG + Intronic
1163990892 19:20998364-20998386 AACTTCTCTGTTCAGGCCCAAGG - Intergenic
1167359059 19:49020271-49020293 GACTCCTCTCTGAAGGAGGAGGG - Intergenic
1167366744 19:49058508-49058530 GACTCCTCTCTGAAGGAGGAGGG - Exonic
925531447 2:4867672-4867694 AACTTCTCTCTTGAGGATTAAGG + Intergenic
925808515 2:7675609-7675631 CACTTCTCTCTCCAGGTCCAAGG - Intergenic
926830581 2:16957879-16957901 GACTTCTGTCTGTAGGGCCAAGG - Intergenic
928299608 2:30113602-30113624 GCCCACTCTCTGAAGGACCAAGG + Intergenic
930232922 2:48860743-48860765 GACATCTCTCAGCAGGACCAAGG - Intergenic
933195814 2:79388238-79388260 GACTTCACTCTCAAGAACCGAGG + Intronic
936522293 2:113218985-113219007 GTCTTCTTTCTTAAGACCCAGGG + Intronic
943312814 2:186348016-186348038 GTCTTCTCTCATAAGTACTATGG + Intergenic
947378724 2:229524252-229524274 GTCTTCTCTCTTTTTGACCATGG + Intronic
948214245 2:236216797-236216819 CACTGCTCTCTTCAGGACCCAGG + Intronic
1170467983 20:16640053-16640075 GACTTCTCCTTTCAGGGCCAAGG - Intergenic
1173218563 20:41111670-41111692 GTCTTATGTCTCAAGGACCACGG + Intronic
1173376906 20:42493749-42493771 GACTTCTTTCTGAAGTCCCAGGG - Intronic
1173828806 20:46064891-46064913 GGCCCCTCTCTTAAGTACCATGG - Intronic
1174204663 20:48829476-48829498 GACTTCTTTCTTTGGGATCATGG + Intergenic
1174755641 20:53155664-53155686 GACTTCACTTTTTAGGACCTGGG + Intronic
1176798450 21:13395239-13395261 GACCTCACTCTTAAGTAGCAAGG - Intergenic
1178109276 21:29354315-29354337 GACATTTATCTTAAGGACAATGG + Intronic
1178599920 21:33986351-33986373 CACTTCTGTCTTGAGGGCCAAGG - Intergenic
1183342772 22:37290954-37290976 GGCTCTTCTCTTCAGGACCAAGG - Intronic
1185362336 22:50415815-50415837 GACTTCTCTCTTAAGGACCAGGG - Intronic
950170038 3:10832618-10832640 GAGTTCTCTCTTAGAGAGCAGGG - Intronic
950392370 3:12706690-12706712 GATCTCCCTCTTCAGGACCAAGG - Intergenic
950590776 3:13934670-13934692 GACCTCACTCCTGAGGACCAAGG + Intergenic
955656338 3:61248987-61249009 GTCATCTCTCTTAAGGTGCAAGG - Intronic
960136037 3:114106359-114106381 GACTTCTGTCTTAAGGTCAGGGG - Intergenic
960738078 3:120802481-120802503 GAGCTCTCTCTTTAGGACAACGG - Intergenic
960821496 3:121737775-121737797 CACTTCTTTCTTAAGAACCATGG - Intronic
962272959 3:133991667-133991689 CACTCCCCTCTTAAGGAACAAGG - Intronic
963120159 3:141769499-141769521 GACCTCTCTCTTAGGAACAATGG - Intergenic
967804569 3:193704169-193704191 GACTTCTCTTTCAAGGAGGATGG - Intergenic
972937740 4:44159383-44159405 GATTTTTTTCTTAAGGACAATGG - Intergenic
976545650 4:86332836-86332858 GACTTCTCTCTTGAGAACCTTGG - Intronic
979084386 4:116388391-116388413 GCCTTCTCTCTTACAGACTAAGG - Intergenic
981044905 4:140256102-140256124 GCCTTCTCTCTTACAGGCCATGG + Intergenic
981121479 4:141056434-141056456 CCCTTCTCTTTTAAGGACCTTGG - Intronic
982607373 4:157531949-157531971 GACATTTCTCTTAAGGACAATGG - Intergenic
986765745 5:10924448-10924470 GACTCCTCTCTTAATCCCCAAGG + Intergenic
987301939 5:16605228-16605250 GATTTCTCTCTGAAGGAGGATGG - Intronic
989527352 5:42468553-42468575 TCCTTCTTTCTTAAGCACCATGG + Intronic
990310376 5:54532050-54532072 GGCTTCTCTCGTAAAGAGCAGGG + Intronic
993275048 5:85846670-85846692 GTCTTCTCTCTCCAGGACCAGGG + Intergenic
994699825 5:103120140-103120162 GACTGCCCTCTAAAGGACCCGGG - Exonic
998042542 5:138961409-138961431 GCCTTCTCTCTCAAGGAGAATGG - Intronic
1001059032 5:168472518-168472540 GACTTCATTCTTCAAGACCAAGG - Intergenic
1001763161 5:174223975-174223997 AGCTTCTCTCCTGAGGACCATGG + Intronic
1004507222 6:16256720-16256742 GAGTTCTGTCTCAAGAACCAAGG - Intronic
1007222146 6:40287104-40287126 GATTTCTCCCTTAAAAACCAGGG + Intergenic
1008215073 6:48778491-48778513 CAATTTTCTCTTAAGGCCCAAGG - Intergenic
1012827432 6:104163479-104163501 CAATGTTCTCTTAAGGACCAAGG - Intergenic
1013646556 6:112147848-112147870 GACTTATCTTTTAGGGAACAAGG - Intronic
1014548034 6:122755405-122755427 GAATTCTCACTTAAGAATCAAGG - Intergenic
1014659979 6:124157552-124157574 GACATCTCTGTGAAGGGCCAAGG + Intronic
1014937336 6:127399898-127399920 TACTGCTTTCTTAAGGACAATGG + Intergenic
1015662119 6:135587738-135587760 AAATTCTATCTTAAGGAGCAAGG + Intergenic
1015710400 6:136132932-136132954 GATTTCTCTCTTAGTGCCCACGG - Intronic
1016251601 6:142049370-142049392 AAATGTTCTCTTAAGGACCAAGG - Intergenic
1016809112 6:148242846-148242868 CATTTCTTCCTTAAGGACCATGG + Intergenic
1017273379 6:152535965-152535987 GAATTCTCACCTAATGACCATGG - Intronic
1020892702 7:13899381-13899403 GCCTTTTCTTTTAAGGATCATGG + Intronic
1022543362 7:31160360-31160382 GCCTTCTATCTGAAGAACCAGGG - Intergenic
1023682362 7:42700704-42700726 GACTTCTCTATTAGGGAGCAGGG - Intergenic
1024240079 7:47428017-47428039 GAATTCTCTATTAAAGAACAAGG + Intronic
1029853923 7:103494075-103494097 ATCTTCACTCTTAAGGAACAGGG + Intronic
1034983591 7:155494099-155494121 GACATCTCTCTTAAATATCATGG - Intronic
1044379365 8:91516036-91516058 CTCTTCTCTATTAAGGACAATGG + Intergenic
1048341732 8:133545200-133545222 ACCTTTTCTGTTAAGGACCAGGG + Intronic
1050517949 9:6464736-6464758 GACTTCTCTATTCTGTACCATGG + Intronic
1051445652 9:17136004-17136026 GATTTCTCACTCAAGGACCGCGG - Intronic
1051566021 9:18499081-18499103 GACTTTTCTCTTCAGTAGCAAGG + Intronic
1053546707 9:39030319-39030341 CTTTACTCTCTTAAGGACCACGG + Intergenic
1053811024 9:41851973-41851995 CTTTACTCTCTTAAGGACCACGG + Intergenic
1054619570 9:67335466-67335488 CTTTACTCTCTTAAGGACCACGG - Intergenic
1060392763 9:123291955-123291977 CACCTCTGTCTTCAGGACCATGG - Intergenic
1061151665 9:128832050-128832072 GAATTCTTTACTAAGGACCAGGG + Intergenic
1061638092 9:131928228-131928250 GACTCCTCTCTGGAGGAGCAGGG - Intronic
1062599875 9:137314916-137314938 GACGTCTCTCAGAAGCACCAGGG + Intronic
1188147818 X:26635547-26635569 GGCTTCTCTCTTTAGGCACATGG - Intergenic
1193897047 X:87127283-87127305 GAACTCTCCCTTTAGGACCATGG - Intergenic
1195615031 X:106905403-106905425 GATTTCCCTCTTCAGGACCTGGG - Intronic
1198013987 X:132589905-132589927 CACTTATCTCTTGGGGACCAGGG - Intergenic
1201295517 Y:12459967-12459989 GACTTCTTGCAAAAGGACCAAGG - Intergenic
1202254718 Y:22909099-22909121 TAATTCTCTGTGAAGGACCAAGG - Intergenic
1202407709 Y:24542848-24542870 TAATTCTCTGTGAAGGACCAAGG - Intergenic
1202463072 Y:25127233-25127255 TAATTCTCTGTGAAGGACCAAGG + Intergenic