ID: 1185362337

View in Genome Browser
Species Human (GRCh38)
Location 22:50415816-50415838
Sequence GGACTTCTCTCTTAAGGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185362337_1185362345 23 Left 1185362337 22:50415816-50415838 CCTGGTCCTTAAGAGAGAAGTCC No data
Right 1185362345 22:50415862-50415884 CCATTAGGACAGAGGGATGGTGG No data
1185362337_1185362342 16 Left 1185362337 22:50415816-50415838 CCTGGTCCTTAAGAGAGAAGTCC No data
Right 1185362342 22:50415855-50415877 ATACGCACCATTAGGACAGAGGG 0: 1
1: 0
2: 0
3: 4
4: 45
1185362337_1185362340 8 Left 1185362337 22:50415816-50415838 CCTGGTCCTTAAGAGAGAAGTCC No data
Right 1185362340 22:50415847-50415869 GAGCTTACATACGCACCATTAGG 0: 1
1: 0
2: 0
3: 2
4: 27
1185362337_1185362341 15 Left 1185362337 22:50415816-50415838 CCTGGTCCTTAAGAGAGAAGTCC No data
Right 1185362341 22:50415854-50415876 CATACGCACCATTAGGACAGAGG 0: 1
1: 0
2: 0
3: 11
4: 64
1185362337_1185362343 20 Left 1185362337 22:50415816-50415838 CCTGGTCCTTAAGAGAGAAGTCC No data
Right 1185362343 22:50415859-50415881 GCACCATTAGGACAGAGGGATGG 0: 1
1: 0
2: 2
3: 12
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185362337 Original CRISPR GGACTTCTCTCTTAAGGACC AGG (reversed) Intronic
No off target data available for this crispr