ID: 1185362338

View in Genome Browser
Species Human (GRCh38)
Location 22:50415822-50415844
Sequence TCTTCAGGACTTCTCTCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 165}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185362338_1185362341 9 Left 1185362338 22:50415822-50415844 CCTTAAGAGAGAAGTCCTGAAGA 0: 1
1: 0
2: 0
3: 17
4: 165
Right 1185362341 22:50415854-50415876 CATACGCACCATTAGGACAGAGG 0: 1
1: 0
2: 0
3: 11
4: 64
1185362338_1185362343 14 Left 1185362338 22:50415822-50415844 CCTTAAGAGAGAAGTCCTGAAGA 0: 1
1: 0
2: 0
3: 17
4: 165
Right 1185362343 22:50415859-50415881 GCACCATTAGGACAGAGGGATGG 0: 1
1: 0
2: 2
3: 12
4: 174
1185362338_1185362342 10 Left 1185362338 22:50415822-50415844 CCTTAAGAGAGAAGTCCTGAAGA 0: 1
1: 0
2: 0
3: 17
4: 165
Right 1185362342 22:50415855-50415877 ATACGCACCATTAGGACAGAGGG 0: 1
1: 0
2: 0
3: 4
4: 45
1185362338_1185362345 17 Left 1185362338 22:50415822-50415844 CCTTAAGAGAGAAGTCCTGAAGA 0: 1
1: 0
2: 0
3: 17
4: 165
Right 1185362345 22:50415862-50415884 CCATTAGGACAGAGGGATGGTGG No data
1185362338_1185362340 2 Left 1185362338 22:50415822-50415844 CCTTAAGAGAGAAGTCCTGAAGA 0: 1
1: 0
2: 0
3: 17
4: 165
Right 1185362340 22:50415847-50415869 GAGCTTACATACGCACCATTAGG 0: 1
1: 0
2: 0
3: 2
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185362338 Original CRISPR TCTTCAGGACTTCTCTCTTA AGG (reversed) Intronic
900731848 1:4267298-4267320 TTTGCAGGACATCTCTCTGAAGG + Intergenic
900799781 1:4730038-4730060 TCTTTAAGGCTTCTCTCTTCTGG - Intronic
901122336 1:6905967-6905989 CCTTCAGGACATCTATCTGAAGG - Intronic
903587677 1:24428631-24428653 TCTTTGGGTCTTCTCTCTGAAGG + Intronic
904636647 1:31886850-31886872 ACTTCAGAACATCTTTCTTAAGG + Intergenic
908696424 1:66847553-66847575 TCATCAGGACTTATTTTTTATGG - Exonic
909034720 1:70583744-70583766 TCTTAAGCACTTCTATTTTAAGG + Intergenic
909062898 1:70899611-70899633 TCTGCAGGATTTTACTCTTAAGG + Intronic
909873520 1:80775974-80775996 TCTTCTGGAAATCTATCTTATGG - Intergenic
910317992 1:85910446-85910468 TCTTCCAGACTTATTTCTTATGG - Intronic
911794684 1:102060398-102060420 TCTTAAGGGCTTCTCTTTTTAGG - Intergenic
912244492 1:107946626-107946648 TTTTCAGTCCTTCTCTTTTATGG - Intronic
912778842 1:112525263-112525285 TTTCCAGTGCTTCTCTCTTATGG - Exonic
913456319 1:119035170-119035192 TCATCAAGACTTCTCTATAATGG - Intronic
916117073 1:161494657-161494679 TCTCCAGGACTTCTTTCTCCAGG + Intergenic
916310035 1:163388046-163388068 TCCTCAGGAGTTCTTTATTAGGG + Intergenic
918210176 1:182343397-182343419 TCATCAGGACCTCACTCTTAGGG + Intergenic
919342878 1:196336242-196336264 TCTTCAGTCCTTCACTCTCATGG + Intronic
920234982 1:204496858-204496880 TCTTCAGGATTCCTCTCTTTGGG + Intergenic
922173972 1:223180404-223180426 TCTTCTGGAATTCTCTCATGGGG + Intergenic
1063340941 10:5262529-5262551 CCTTCACGTCTTCTCTCTGAGGG + Intergenic
1066048537 10:31615405-31615427 ACTTCAGGTCTTTTCTCTTGTGG + Intergenic
1067009634 10:42698316-42698338 TCCACAGGACTTTTCTCTTGGGG - Intergenic
1067561416 10:47307397-47307419 TCTTCAATGCTTCTCTCTTATGG + Intronic
1077652017 11:3981434-3981456 GGTTCAGGACCTTTCTCTTAAGG + Intronic
1078226844 11:9399884-9399906 TGTTCAGGTCTTCTGTATTAGGG + Intronic
1078736730 11:14027105-14027127 TCGTCTGGACTTCTCTCTGCCGG + Intronic
1079309091 11:19348609-19348631 TATTCAGCACATCTCTGTTAAGG - Intergenic
1086556707 11:88119609-88119631 TCTTCAGAACATCTGTCTTGCGG + Intronic
1087847343 11:102988703-102988725 AATTCAGGAATTCTCTCTGAAGG + Intergenic
1090568594 11:128022632-128022654 TTTTGAGGTCTTTTCTCTTAAGG - Intergenic
1091448188 12:556763-556785 TATTCAGGACCTGTCTCCTACGG - Exonic
1091757019 12:3060318-3060340 TCTTCAGGGCTCCTCTCAGACGG + Intergenic
1092815355 12:12308021-12308043 TTTTCTCCACTTCTCTCTTAGGG + Intergenic
1095464680 12:42477766-42477788 TTTTCAGGTATTGTCTCTTAAGG + Intronic
1096501912 12:52069492-52069514 TCTCCAGGACCTCTCTCTACGGG + Intronic
1097599068 12:61669766-61669788 TCTCCAGGACTTCTTTATAATGG - Intergenic
1097823671 12:64153237-64153259 TCTCCAGGGCTTCTTGCTTATGG - Exonic
1097894241 12:64808503-64808525 TTTTCAGTATGTCTCTCTTATGG - Intronic
1100209382 12:92386011-92386033 TCTTCAGCACTTCCATTTTATGG - Intergenic
1106182837 13:27383221-27383243 TCTCCAGGACTTCTCCCCCAGGG - Intergenic
1107960427 13:45552872-45552894 CCATCAGGACTTCTCTATCATGG + Intronic
1110412140 13:75215987-75216009 GCATCAGGAGTTCTCTCTGAAGG - Intergenic
1111334532 13:86802893-86802915 TCTTCAGGACTCATCTCTCATGG + Intergenic
1113219502 13:108083553-108083575 TCTTAAGTACTTAGCTCTTATGG - Intergenic
1113919233 13:113897527-113897549 TCTGCAGGGCTGCTCTCTCAGGG - Intergenic
1114526798 14:23371589-23371611 ACTTCATCACTTCTCTCTTTTGG + Intergenic
1115344163 14:32324277-32324299 TATTCAAGACCTCTCTCTTGAGG - Intergenic
1117456598 14:55903950-55903972 TCTTGAGGAGGTCTCTCTGATGG - Intergenic
1202886687 14_KI270722v1_random:114096-114118 TGTTCTGGAATGCTCTCTTAGGG + Intergenic
1124291973 15:28460388-28460410 TCTTCTGGACTTCACTGTCAAGG - Intergenic
1124902625 15:33838448-33838470 TCTTCAGGGTTGCTCTCTTCAGG - Exonic
1125255348 15:37757298-37757320 CCATCAGGACTTCTTTCTTCTGG + Intergenic
1126732760 15:51701109-51701131 TCTTCATGACTCTTCTCTGATGG - Exonic
1134662885 16:15997474-15997496 TGTTCAGGACTCATCTCTTGTGG + Intronic
1135237186 16:20768167-20768189 TCTTCAGGACAAATCTCTGATGG + Intronic
1135392252 16:22103751-22103773 TTCTCAGGACATCTCTCTTCAGG + Intronic
1140583497 16:76258591-76258613 TCTTGAGGCCTTATCTCTAATGG - Intergenic
1141868721 16:86769678-86769700 ACTGCAGGCCTTCTCTCCTAGGG + Intergenic
1142338389 16:89505391-89505413 TCCTGAGGCCTCCTCTCTTATGG + Intronic
1146550294 17:33775011-33775033 TCTTCAGGATATGTCTCTTTTGG - Intronic
1148402295 17:47375864-47375886 ACTTCAGGTATTATCTCTTATGG + Intronic
1154358046 18:13637408-13637430 TCTTCAGGAGCTTTCTCTTAAGG - Intronic
1155201788 18:23524223-23524245 ACTTCAGGACCACTCTCTGAGGG - Intronic
1156762051 18:40604419-40604441 TCTTCAAAACTTTTCTCTTTAGG + Intergenic
1158631865 18:59122340-59122362 TCTTCAAGTCCTCTCTCTTTGGG - Intergenic
1163252888 19:16136954-16136976 TTTTCAGGACCTCTCTCTGCAGG + Intronic
1163625943 19:18389709-18389731 TCCTCAAAACTTCTCTCTTTGGG + Intergenic
1164045107 19:21531164-21531186 TCTTCAGGACTTTGCTCTGTAGG - Intronic
1164297153 19:23922186-23922208 CCTTCAGGACTTTGCTCTGAAGG + Intronic
1164457978 19:28424739-28424761 ACTTTAAGACTTCTCTTTTAAGG + Intergenic
1168232404 19:55041548-55041570 TCTTAGGGCCTTCTCTCTTATGG + Intronic
925763084 2:7205669-7205691 CCTTCAGGCATGCTCTCTTAGGG + Intergenic
927098143 2:19763747-19763769 TCTTCAGGAAGTTTCTCTCAGGG + Intergenic
930836045 2:55794260-55794282 TCTTCAAGAATTCTCTTTCAAGG + Intergenic
933476404 2:82797569-82797591 ACTTCTGGACTTCTGGCTTAGGG - Intergenic
935380703 2:102448331-102448353 TTTACAGGACTTCTCACTTTTGG - Intronic
939080905 2:137661096-137661118 TCTCTATGACTTCGCTCTTATGG - Intronic
939138117 2:138321243-138321265 GATTGAGGACTGCTCTCTTATGG - Intergenic
940341782 2:152589067-152589089 TCTTCAGGACTGCCCTTTTTTGG + Intronic
943045908 2:182862198-182862220 TCTGCAGGCCTTCTCTCTCTTGG - Intronic
946559400 2:220896102-220896124 TCTTCATGTCATCTTTCTTAGGG - Intergenic
947814192 2:233024836-233024858 TTTTCAGGACTTCTCTCGGAGGG + Intergenic
948549668 2:238761929-238761951 TCTTCAGCACTACTCTCTAGCGG - Intergenic
1173310347 20:41891551-41891573 TCTTCAGTGGTTCTCTTTTAAGG + Intergenic
1173821001 20:46020685-46020707 TCTCCTTGACTTCACTCTTATGG + Intergenic
1176954172 21:15081550-15081572 ACTCCTGGACTTCTCACTTAAGG - Intergenic
1178612410 21:34095924-34095946 TTTTCAGGGCTTCTTTCTTAGGG - Exonic
1182115211 22:27752596-27752618 TTTGCAGGACTTCTCATTTACGG + Intronic
1185362338 22:50415822-50415844 TCTTCAGGACTTCTCTCTTAAGG - Intronic
949281637 3:2353493-2353515 TCTTAAGGACATAGCTCTTAAGG - Intronic
949351481 3:3128082-3128104 TCTTCAGGACTCAGATCTTATGG - Intronic
952554002 3:34511272-34511294 TCTTAAGGGCATATCTCTTAGGG + Intergenic
953965964 3:47307406-47307428 TATTGAAGTCTTCTCTCTTAAGG + Intronic
955657173 3:61256756-61256778 TCTTAAGGACTTGTGTCTTAAGG - Intergenic
955661783 3:61307408-61307430 TCTTCAGAACACCTCTCTGAGGG + Intergenic
956116550 3:65924929-65924951 TTTTCATGACTTCTCTCAGAGGG - Intronic
956487333 3:69736981-69737003 TCCTTAGGACTTCTCTGCTAGGG - Intergenic
956498042 3:69849860-69849882 TCTTCAGGACTTCTTTACTCTGG + Intronic
958088216 3:88840351-88840373 TCCTCAGACCTTCTCTCTGACGG - Intergenic
959024052 3:101220085-101220107 GCTTGAAGGCTTCTCTCTTAAGG + Intergenic
959359555 3:105370390-105370412 TCTTCAGGACATCTACCTTCAGG + Intronic
960903316 3:122573483-122573505 TAGTAAGGACTTGTCTCTTAAGG - Exonic
961965515 3:130897706-130897728 TCTTCTGGACTTTTTTCCTAGGG + Intronic
962885600 3:139623387-139623409 TCTTCTGGAATTCTTTCTGAAGG + Intronic
963294671 3:143532937-143532959 TCTCAAGGACTTCTCTATTGGGG + Intronic
964411736 3:156404931-156404953 TCTTAAGTACATCTCTTTTACGG - Intronic
964903346 3:161687838-161687860 TTTTCATGACTTCTCTCTCAAGG - Intergenic
966126433 3:176582134-176582156 TCTCCAGGACTCCTCTGTTCTGG - Intergenic
969978982 4:11134844-11134866 TCTTGAGAACTGCTATCTTAGGG + Intergenic
970416560 4:15863560-15863582 TCTCCAGGACATCCCTCCTAAGG + Intergenic
974191443 4:58509225-58509247 TCAACAGGTTTTCTCTCTTAAGG + Intergenic
975570732 4:75815238-75815260 TCTTCAGGGCCTCTTTCATAAGG - Intergenic
983113050 4:163777440-163777462 GCTTCAGGACTTCTATTATAAGG + Intronic
984388538 4:179097056-179097078 TCTTCATGTCTTTTCTCATAGGG - Intergenic
986465560 5:8018702-8018724 GCTTCAGGATTTCTGTTTTATGG - Intergenic
987547135 5:19325800-19325822 TTTTCAGTACTTTTCTCTTATGG - Intergenic
987833617 5:23132324-23132346 AATTCATGACTTCTCTCTTCAGG + Intergenic
989502211 5:42180570-42180592 TCTTCATGACATATCTCTTCAGG - Intergenic
990277033 5:54208119-54208141 TCTTTAGGTTTTCTCTCTTGGGG - Intronic
991772963 5:70056924-70056946 TTTTCAGGACCTCTCTCTGCAGG + Intronic
991852256 5:70932348-70932370 TTTTCAGGACCTCTCTCTGCAGG + Intronic
992086120 5:73279765-73279787 CCTTCAGGATTTTTCTCTTCTGG + Intergenic
993784460 5:92111602-92111624 TCTTCATGTCTTATCTCTCATGG + Intergenic
994513006 5:100731763-100731785 TTTTCAGAGCTTCTCTCTAAAGG + Intergenic
995267153 5:110175662-110175684 TCTTCAGGACTGTTGTCTCAGGG + Intergenic
995918038 5:117274742-117274764 TATTCAGAACTTTTCTCTGAGGG - Intergenic
996612070 5:125394109-125394131 TCTCAAGGACTTCACTCTTGTGG - Intergenic
998093218 5:139382869-139382891 TCTCCAAGACTTCTGACTTAAGG - Intronic
998937322 5:147243229-147243251 GTTTCAAGAATTCTCTCTTATGG + Intronic
999036453 5:148356928-148356950 TCTTCAGGTCATCTCCCTCAAGG - Intergenic
1000846482 5:166288090-166288112 TCTTCAGGTCTTCTTTCTCCAGG + Intergenic
1001289959 5:170450075-170450097 TGCTCAGGACTGCTCTCTTGGGG + Intronic
1005489972 6:26338861-26338883 TCTCCAGAATTTCTTTCTTATGG + Intergenic
1008482672 6:52002605-52002627 TCTGCAGCACTTCTCTCTGCAGG + Intronic
1008552827 6:52649256-52649278 ATATCAGGAATTCTCTCTTATGG - Intergenic
1008907972 6:56700361-56700383 TATTTAGGACTTCTCACTTGAGG - Intronic
1009380328 6:63020311-63020333 TGTGCAGGGCTCCTCTCTTAGGG - Intergenic
1010133084 6:72518662-72518684 TCTTAGGGAATTCTGTCTTATGG - Intergenic
1010370901 6:75106178-75106200 TCAGCAGGACTTTTCTCTTAGGG + Intronic
1012377562 6:98580852-98580874 TCCTCAGGGGTTCTCCCTTAAGG - Intergenic
1015252661 6:131142984-131143006 TCTTTTGGATTTCTCTCTTTTGG + Intronic
1016042895 6:139450728-139450750 TCCTCAGGAGTGTTCTCTTATGG + Intergenic
1016316757 6:142798058-142798080 CCATAAGGAATTCTCTCTTATGG + Intronic
1016385347 6:143525540-143525562 TCTTCATGATTTCTGTCTTTTGG + Intergenic
1019637062 7:2081627-2081649 GCCCCAGGACTTCTCTCTTCCGG + Intronic
1020993073 7:15226653-15226675 TCTTCAGGACTGTTTTCTTCAGG - Intronic
1021922242 7:25497029-25497051 TCTGCAGGCCCTCTCTCTGAAGG + Intergenic
1026419035 7:70213717-70213739 TACTCATGTCTTCTCTCTTAAGG + Intronic
1027008678 7:74722493-74722515 TCTTGCGCAGTTCTCTCTTAGGG + Intronic
1028136086 7:87224369-87224391 TTTTCAGGCCTTCTCCCATATGG + Intergenic
1031014794 7:116561615-116561637 CCTTCAGGACTCCTATATTAGGG + Intergenic
1031197432 7:118633732-118633754 TCTTCATGACTTCTGTTTTAAGG - Intergenic
1031630321 7:124036287-124036309 TCTTCAGGTCTTCACTCTGAGGG - Intergenic
1031892144 7:127307670-127307692 TCTACAAAACTTCTCTCTTAAGG + Intergenic
1034442223 7:151091651-151091673 TCATCACGACTTCTTTCTTCCGG + Intronic
1036462831 8:8969117-8969139 TCTTCATGTCTTCTCTCGTGGGG - Intergenic
1037147936 8:15595976-15595998 TCTTCAGGACTTCAGAATTAAGG + Intronic
1037686553 8:21144541-21144563 CCTTCAAGACTGCTTTCTTATGG - Intergenic
1038503679 8:28065898-28065920 TTTCCTGGGCTTCTCTCTTACGG - Intronic
1038708541 8:29920012-29920034 ACTTCAGAACTGCTCTCCTAGGG + Intergenic
1040837318 8:51746184-51746206 TCTTCAAGAATTCTTTCTCAAGG + Intronic
1042681015 8:71384386-71384408 TCTTTAGGACTTATCTCAGATGG + Intergenic
1047465129 8:125105368-125105390 TGTTCCAGTCTTCTCTCTTATGG - Intronic
1048212921 8:132471035-132471057 TCTGCCAGATTTCTCTCTTATGG + Intronic
1050012916 9:1203312-1203334 TCTTCCTGTATTCTCTCTTAAGG + Intergenic
1050111296 9:2219361-2219383 TCTTCAGTAATTCTCTTTGAAGG - Intergenic
1058917499 9:109581747-109581769 TCTTTGGGACTTCTTTATTAAGG + Intergenic
1058949703 9:109891996-109892018 TCTTAAGGAGTTATATCTTAGGG - Intronic
1059059512 9:111020519-111020541 TCTACACCACTTCTCTCTTAGGG + Intronic
1059781662 9:117535130-117535152 TCTTTAGCACCTCCCTCTTAGGG - Intergenic
1060291554 9:122307513-122307535 TCTCCAGGACTTCTCTCCTGGGG - Intronic
1060534920 9:124377786-124377808 TCTTCATAGCTTCTCTCTGAAGG + Intronic
1060971180 9:127738983-127739005 TCTTCAGGACCCCCCTGTTAGGG + Intronic
1186929922 X:14377434-14377456 TTTTCAGGACATCACTATTAAGG + Intergenic
1189093108 X:38108408-38108430 ACTTTACCACTTCTCTCTTACGG + Intronic
1189926664 X:45961683-45961705 CCTTCAGGACCTCTCTTGTAAGG - Intergenic
1190485321 X:50917916-50917938 TCTGAAGTTCTTCTCTCTTAAGG + Intergenic
1196089066 X:111719414-111719436 TCTTAAGGACTTCAGGCTTACGG + Intronic
1197398004 X:125951412-125951434 TTTTCAGGGGTTCTCTCTGAAGG - Intergenic
1197574760 X:128198703-128198725 TCTTCAGCATTTCTTTCTTTAGG - Intergenic
1198778777 X:140211083-140211105 TCTTCACCACTTCTGTCATAAGG - Intergenic
1200216879 X:154371876-154371898 TCTCCAGGGGTTCGCTCTTAGGG - Intronic