ID: 1185362339

View in Genome Browser
Species Human (GRCh38)
Location 22:50415837-50415859
Sequence CGTATGTAAGCTCTGTCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 77}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185362339_1185362345 2 Left 1185362339 22:50415837-50415859 CCTGAAGACAGAGCTTACATACG 0: 1
1: 0
2: 1
3: 4
4: 77
Right 1185362345 22:50415862-50415884 CCATTAGGACAGAGGGATGGTGG No data
1185362339_1185362343 -1 Left 1185362339 22:50415837-50415859 CCTGAAGACAGAGCTTACATACG 0: 1
1: 0
2: 1
3: 4
4: 77
Right 1185362343 22:50415859-50415881 GCACCATTAGGACAGAGGGATGG 0: 1
1: 0
2: 2
3: 12
4: 174
1185362339_1185362342 -5 Left 1185362339 22:50415837-50415859 CCTGAAGACAGAGCTTACATACG 0: 1
1: 0
2: 1
3: 4
4: 77
Right 1185362342 22:50415855-50415877 ATACGCACCATTAGGACAGAGGG 0: 1
1: 0
2: 0
3: 4
4: 45
1185362339_1185362341 -6 Left 1185362339 22:50415837-50415859 CCTGAAGACAGAGCTTACATACG 0: 1
1: 0
2: 1
3: 4
4: 77
Right 1185362341 22:50415854-50415876 CATACGCACCATTAGGACAGAGG 0: 1
1: 0
2: 0
3: 11
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185362339 Original CRISPR CGTATGTAAGCTCTGTCTTC AGG (reversed) Intronic
906149857 1:43581400-43581422 CGTTTCTAAGCTCTGTCCCCAGG + Intronic
906377833 1:45310354-45310376 CTTATGGAAGCTCTATCTTACGG + Intergenic
910542776 1:88379589-88379611 GGTATGAAAGATATGTCTTCTGG + Intergenic
916551344 1:165852731-165852753 CTTATATAAGTTCTTTCTTCTGG + Intronic
924421974 1:243918158-243918180 CTTCTGTGAGCTCTGACTTCAGG - Intergenic
1074771255 10:116735920-116735942 CTTATGTAAGCTCTGCTTCCTGG - Intronic
1087273040 11:96131257-96131279 TGTTTTTAAGCTCTGTTTTCAGG - Intronic
1100955824 12:99906994-99907016 TGTGTGTAAGCTCTGCCTTCAGG - Intronic
1100984841 12:100194007-100194029 TGTAAGTAAGCTCTCTCCTCTGG + Intergenic
1101660632 12:106762092-106762114 GGAATGTAAGCACTGTCTTGAGG + Intronic
1104421379 12:128638583-128638605 GGTATATTAGCTCTGCCTTCAGG - Intronic
1107810185 13:44193213-44193235 CAAATGTAATTTCTGTCTTCAGG + Intergenic
1108302109 13:49089271-49089293 ATTATTTAAGCTCTGGCTTCAGG - Intronic
1109665517 13:65530120-65530142 CATCTGTCAGCTTTGTCTTCTGG - Intergenic
1111705370 13:91742223-91742245 CATATGTTTGCTCTGCCTTCTGG - Intronic
1113197028 13:107819994-107820016 AGTCTGTAATCTTTGTCTTCAGG - Intronic
1121167664 14:91822787-91822809 TCACTGTAAGCTCTGTCTTCTGG + Intronic
1202850579 14_GL000225v1_random:15341-15363 CTTGTCTAAGCTCTGTCTACAGG - Intergenic
1202854058 14_GL000225v1_random:38876-38898 CTTATCTAAGCTCTGCCTACAGG - Intergenic
1202859047 14_GL000225v1_random:70144-70166 CTTTTCTAAGCTCTGTCTACCGG + Intergenic
1202868712 14_GL000225v1_random:139586-139608 CTTTTATAAGCTCTGTCTACAGG + Intergenic
1125281670 15:38048076-38048098 CGTATTTGATCTCAGTCTTCAGG - Intergenic
1125738028 15:41942164-41942186 CGTAAGTCAACTCTGTCCTCTGG + Intronic
1131123318 15:89836982-89837004 CGTCTGTAACCTCTGTGCTCTGG + Intronic
1133779138 16:8923561-8923583 TGTATGTTATCTCAGTCTTCGGG - Intronic
1137843151 16:51659655-51659677 GGTATGTTGGCTTTGTCTTCGGG + Intergenic
1157103003 18:44746888-44746910 AGTGTGTAAGCACTGTCTTCAGG + Intronic
1158486041 18:57866868-57866890 CTTATGTAACCTCTGCCTCCCGG + Intergenic
1160116957 18:76087784-76087806 CGTTTGTAATCTGTGTCTTATGG - Intergenic
1160293274 18:77614928-77614950 CGTATGTTAGCTGTGTCTTCTGG - Intergenic
1161076653 19:2289161-2289183 CGGGTGTGAGCTCTGTGTTCCGG + Intronic
1161765239 19:6204063-6204085 CTTATGTAGGCTCTGGCTGCTGG - Intergenic
925778338 2:7356657-7356679 CTTAGGTAAGCCCTGTGTTCAGG - Intergenic
926689962 2:15726290-15726312 CCAATGTGAGCTTTGTCTTCTGG - Intronic
927254123 2:21025036-21025058 CGGAGGTAGGCTCTGGCTTCCGG + Exonic
939556146 2:143675995-143676017 AGTATGTTAGCTAGGTCTTCTGG + Intronic
939881680 2:147638815-147638837 CTTATGTAACGTCTTTCTTCTGG + Intergenic
942300794 2:174560106-174560128 CACATGTAAGCTCTGATTTCAGG + Exonic
942571053 2:177314795-177314817 CATATCTGAGCTCTGTGTTCTGG - Intronic
942598172 2:177612314-177612336 AGAATGTAAGCTCTGGCTCCTGG + Intergenic
947516882 2:230813760-230813782 TGGATTTAAGCTCTGTCTGCAGG + Intronic
1170107772 20:12770255-12770277 CGAATGGTAGTTCTGTCTTCAGG - Intergenic
1179492460 21:41750202-41750224 CGCATGTGAGCTCTGCCTTTTGG - Intronic
1185362339 22:50415837-50415859 CGTATGTAAGCTCTGTCTTCAGG - Intronic
951077820 3:18418191-18418213 CCTCTATAAGCTCTGTCCTCTGG + Intronic
958016753 3:87946330-87946352 TGTATGGGAGCTCTGTTTTCAGG - Intergenic
968437090 4:599279-599301 CCTCTGGAAGCTCTGTCCTCGGG + Intergenic
974230081 4:59100645-59100667 CGTATGGAATCTCTTTCTCCTGG - Intergenic
977328516 4:95607114-95607136 CGTATTTAATCTCTTTCTTCGGG - Intergenic
977688231 4:99873796-99873818 GGTAAGTAAGCACTGGCTTCAGG + Intergenic
979943012 4:126786586-126786608 CATATATGAGCTATGTCTTCAGG + Intergenic
981633188 4:146845327-146845349 TGTATGTAACCTGTGTCTACTGG - Intronic
984239779 4:177204361-177204383 CTTATCTAAGTTCTGTTTTCAGG - Intergenic
996517219 5:124383899-124383921 TGTATGTATCCACTGTCTTCTGG - Intergenic
996958628 5:129216464-129216486 GGTCTGTAGGCTCAGTCTTCAGG + Intergenic
997452737 5:133996470-133996492 CTTACGTAACCTCTGTCTTGGGG + Intronic
998354427 5:141523012-141523034 CCTATGTAAACTCAGTATTCTGG - Intronic
999501368 5:152149811-152149833 CCTTTGTAAGCCCTGCCTTCAGG + Intergenic
1001946749 5:175785337-175785359 CATATGTAATCTCTGTGGTCAGG + Intergenic
1004132468 6:12933739-12933761 TGTATGTAGGGGCTGTCTTCAGG - Intronic
1007883206 6:45190449-45190471 CATATGTAAACTCTGTATACGGG + Intronic
1011654500 6:89537819-89537841 CGTTTGTAACCTCTACCTTCTGG - Intronic
1016886858 6:148967206-148967228 CAAATGTAAGCACTGTGTTCGGG + Intronic
1017740159 6:157399439-157399461 TGTATATATGCCCTGTCTTCGGG + Intronic
1021179629 7:17490573-17490595 CTTATGTAAGCTAAGTTTTCAGG - Intergenic
1026309970 7:69174961-69174983 ACTTTGTGAGCTCTGTCTTCAGG + Intergenic
1030002366 7:105079207-105079229 CTCATGTAACCTCCGTCTTCCGG + Intronic
1031466865 7:122123793-122123815 CTTATGTAAGCTCTGTTTTGTGG + Intronic
1036042211 8:5097964-5097986 CATATGTTAGCTCTGTTTTTAGG + Intergenic
1036641549 8:10587421-10587443 CCCATGGGAGCTCTGTCTTCAGG - Intergenic
1039590153 8:38739434-38739456 TGTATGTAAGCACTGACATCTGG - Intronic
1039834099 8:41242515-41242537 CTTATGTGAGTTTTGTCTTCAGG - Intergenic
1041650983 8:60302649-60302671 CTTATGTAAGCTATATCTTATGG - Intergenic
1042587277 8:70355221-70355243 CTTAGGTCAGCACTGTCTTCTGG - Intronic
1042696506 8:71558848-71558870 CGTGTGCAAGCTCTGTATTAGGG - Intronic
1045984843 8:108237806-108237828 CGTATATAATCACTGTCCTCTGG + Intronic
1047756191 8:127920089-127920111 CCTAGGCAAGCTCTGTCTGCAGG - Intergenic
1055891517 9:81129154-81129176 AGTATCTACCCTCTGTCTTCAGG - Intergenic
1203736064 Un_GL000216v2:140667-140689 CTTTTATAAGCTCTGTCTACAGG - Intergenic
1191965947 X:66758290-66758312 TATATTTAAGCTGTGTCTTCAGG - Intergenic
1197629466 X:128841836-128841858 TATATGTACTCTCTGTCTTCTGG + Intergenic
1198604682 X:138323760-138323782 CTTATGAAGGCTCTGTGTTCAGG - Intergenic
1199890114 X:152070882-152070904 CGTATGCAACCTCTGCCTCCTGG + Intergenic