ID: 1185362343

View in Genome Browser
Species Human (GRCh38)
Location 22:50415859-50415881
Sequence GCACCATTAGGACAGAGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 174}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185362338_1185362343 14 Left 1185362338 22:50415822-50415844 CCTTAAGAGAGAAGTCCTGAAGA 0: 1
1: 0
2: 0
3: 17
4: 165
Right 1185362343 22:50415859-50415881 GCACCATTAGGACAGAGGGATGG 0: 1
1: 0
2: 2
3: 12
4: 174
1185362336_1185362343 21 Left 1185362336 22:50415815-50415837 CCCTGGTCCTTAAGAGAGAAGTC 0: 1
1: 0
2: 0
3: 7
4: 143
Right 1185362343 22:50415859-50415881 GCACCATTAGGACAGAGGGATGG 0: 1
1: 0
2: 2
3: 12
4: 174
1185362337_1185362343 20 Left 1185362337 22:50415816-50415838 CCTGGTCCTTAAGAGAGAAGTCC No data
Right 1185362343 22:50415859-50415881 GCACCATTAGGACAGAGGGATGG 0: 1
1: 0
2: 2
3: 12
4: 174
1185362339_1185362343 -1 Left 1185362339 22:50415837-50415859 CCTGAAGACAGAGCTTACATACG 0: 1
1: 0
2: 1
3: 4
4: 77
Right 1185362343 22:50415859-50415881 GCACCATTAGGACAGAGGGATGG 0: 1
1: 0
2: 2
3: 12
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185362343 Original CRISPR GCACCATTAGGACAGAGGGA TGG Intronic
900702513 1:4057133-4057155 GCACCATGAAGACAGTGGGAAGG - Intergenic
901145860 1:7064288-7064310 GCTTCATAAGGAGAGAGGGAGGG - Intronic
901454738 1:9356617-9356639 GGACCATGGGGACTGAGGGAGGG - Intronic
902799267 1:18819351-18819373 GCATCTTCCGGACAGAGGGATGG - Intergenic
902888368 1:19423420-19423442 GAACGATGGGGACAGAGGGAGGG + Intronic
904889445 1:33768144-33768166 GTAGCATTATGACAGTGGGAAGG - Intronic
910847765 1:91619743-91619765 ACACCATTATGGCAAAGGGATGG - Intergenic
919075111 1:192803788-192803810 GTACCCTTAGGAGAGTGGGATGG - Intergenic
920792528 1:209106646-209106668 GCACCAGATGGAGAGAGGGAAGG - Intergenic
921172191 1:212559632-212559654 GCAACATTAGCACAGTAGGAGGG - Intergenic
921744801 1:218727873-218727895 GCTCCTTGAAGACAGAGGGAAGG - Intergenic
921907313 1:220508816-220508838 GCAAAAGTAGGATAGAGGGAAGG + Intergenic
923875937 1:238047224-238047246 ACACCATCAGGACATAGGCATGG - Intergenic
924723438 1:246644890-246644912 GCCCCATTTTAACAGAGGGAGGG + Intronic
1064999734 10:21327660-21327682 GCAACAGGAGGAAAGAGGGAGGG - Intergenic
1065593784 10:27292901-27292923 GCACCATTAGGGCAGAGGTAGGG - Intergenic
1065944377 10:30593586-30593608 GGACAATGAGGACAGAGGAATGG - Intergenic
1066291820 10:34021409-34021431 GAACCAATAGGATAGATGGACGG - Intergenic
1066373379 10:34836364-34836386 GAACCATGAGGTCAGGGGGAAGG - Intergenic
1067277702 10:44849844-44849866 CCACCTGTGGGACAGAGGGAGGG - Intergenic
1069073141 10:64010719-64010741 GAACCAATAGAATAGAGGGAGGG - Intergenic
1070516699 10:77214710-77214732 GCACTGTTGAGACAGAGGGAAGG - Intronic
1071168864 10:82839959-82839981 GTAGCATAAGGAAAGAGGGAAGG - Intronic
1072367347 10:94726387-94726409 GAACAATAAGGACACAGGGAGGG - Intronic
1072537069 10:96371792-96371814 GCACCAGCAGATCAGAGGGAGGG + Intronic
1074473181 10:113745655-113745677 CCACCACTGGGGCAGAGGGAGGG - Intergenic
1075925821 10:126251435-126251457 GAACCAATAGGATAGATGGATGG + Intronic
1076367050 10:129927860-129927882 GCTCAGTTAGGACACAGGGATGG + Intronic
1076824213 10:132959167-132959189 GCGCCACAAGGACTGAGGGAGGG - Intergenic
1077287193 11:1772930-1772952 GCACAGTTAGGGCAGGGGGAGGG + Intergenic
1081652432 11:44833344-44833366 GCACCATTTGCTCAGAGGTAGGG - Intronic
1082203751 11:49405849-49405871 GAAGCCTTAGGACAGAGGGACGG - Intergenic
1084533738 11:69744946-69744968 TCAGCAGTAGGACTGAGGGATGG + Intergenic
1086651336 11:89294585-89294607 GAAGCCTTAGGACAGAGGGACGG + Intronic
1089157483 11:116413659-116413681 GCAACATCAGGAGAGAGGGGAGG + Intergenic
1091144455 11:133265476-133265498 GCAACATCAGGAGAGAGGAATGG + Intronic
1091341105 11:134814684-134814706 GTACCATTAGGGCAAAGGGTTGG - Intergenic
1092195256 12:6545743-6545765 GGATCCTTGGGACAGAGGGAGGG - Intronic
1092698662 12:11202293-11202315 GCAACAGAAGGAAAGAGGGAAGG + Intergenic
1093216020 12:16361907-16361929 GGACCATGAGGGTAGAGGGAAGG - Intronic
1094763803 12:33567662-33567684 GCATCATTTTGACAGAGGAAAGG - Intergenic
1096279205 12:50237267-50237289 GCAACAAAAGGACAAAGGGAAGG + Intronic
1098498245 12:71162036-71162058 GCTCCATAAGCACAGAGGGTAGG - Intronic
1102876975 12:116456608-116456630 GTAACATAAGCACAGAGGGAAGG - Intergenic
1102901980 12:116646111-116646133 GCACCGTGAGGACAGAGAGGAGG + Intergenic
1103028889 12:117596069-117596091 GCAGCATGAGAACAGAGGGGAGG - Intronic
1105015750 12:132786044-132786066 GCTCCCTTGGGGCAGAGGGAGGG - Intronic
1106015751 13:25867573-25867595 GCACCCTTAGGAAAGGGTGAAGG - Intronic
1113148498 13:107236041-107236063 GCACTATTAGGAGACAGTGAGGG - Intronic
1113867934 13:113540562-113540584 GCCCCATTAGGAAATAGGGAAGG - Intronic
1114547519 14:23513506-23513528 CAACCAGAAGGACAGAGGGATGG + Intergenic
1121137060 14:91509400-91509422 GCTCCACGAGAACAGAGGGACGG - Intronic
1123974449 15:25539735-25539757 GCACCATTAAGAGAGTGAGAAGG - Intergenic
1124410046 15:29429641-29429663 TCAGAATTAGGACAGAGGGGAGG - Intronic
1125382963 15:39106796-39106818 GCACCATATGAACAAAGGGAAGG + Intergenic
1128784779 15:70386784-70386806 GCTCAATTAGGACAGAGAGCAGG + Intergenic
1131448369 15:92518556-92518578 GCACTCTGAGGTCAGAGGGATGG - Intergenic
1133231205 16:4367479-4367501 GCACCTTGAGGACAGAGGCAGGG - Intronic
1133703086 16:8327223-8327245 GCACCTTTAGTTCAGAGGGTTGG - Intergenic
1134185701 16:12083428-12083450 GCCACATAAGGACAGAGAGAAGG - Intronic
1135609897 16:23857345-23857367 GCAGAATCAGCACAGAGGGAGGG + Intronic
1138887360 16:61095766-61095788 ATACCATTAGGACATAGGCATGG + Intergenic
1139377378 16:66508675-66508697 GCACCATTAGACCCGAGTGACGG - Exonic
1141208483 16:81954532-81954554 GAACAATGAGGACACAGGGAGGG - Intronic
1149433799 17:56616762-56616784 GCAAGGTTAGGACAGAGGGAGGG - Intergenic
1153656379 18:7286375-7286397 GAACCAGTAGGATAGATGGATGG + Intergenic
1155276875 18:24196985-24197007 GCACCATCAGGAATGAGGGGTGG + Intronic
1157321064 18:46635009-46635031 GGACCATTAGCACAGAGGAAGGG - Intronic
1157890150 18:51407745-51407767 GAACAATGAGGACACAGGGAGGG - Intergenic
1157904859 18:51560706-51560728 GCACCATTAGGAGATAGGGATGG - Intergenic
1158370607 18:56798437-56798459 TCACCACTAGGACAGAGGCCAGG + Intronic
1159107799 18:64023880-64023902 ACATCATTAAGATAGAGGGAAGG - Intergenic
1161301539 19:3545157-3545179 GGACCATGAGGAGACAGGGAAGG - Intronic
1161719927 19:5897078-5897100 GCATCGTGAGGACTGAGGGAGGG - Intronic
1162798004 19:13096499-13096521 GCACGCTGAGGACAGGGGGAGGG - Intronic
1163848513 19:19650684-19650706 CGACCAATAGAACAGAGGGAGGG + Intronic
1164144684 19:22504761-22504783 GCCCCATGAGGAGAAAGGGAGGG + Intronic
1165051138 19:33142333-33142355 GCACTAGGAGGGCAGAGGGAGGG + Intronic
1165178464 19:33947453-33947475 GCACCACTTGGACAGTGGGTGGG + Intergenic
926614461 2:14981911-14981933 GCAGTATGTGGACAGAGGGAGGG - Intergenic
927118585 2:19929420-19929442 TCACCAATATGACAGAGGAAGGG + Intronic
927319251 2:21723339-21723361 GTACCAATAGGATGGAGGGATGG + Intergenic
928622223 2:33102038-33102060 GCCCCATTAGGCCAGAGAGGTGG - Intronic
929879210 2:45821764-45821786 TCACCCTGGGGACAGAGGGAAGG + Intronic
930396816 2:50832170-50832192 GCACCAATGGAAAAGAGGGATGG + Intronic
931635967 2:64341061-64341083 GCACCATTAAGCCAGAGTGATGG + Intergenic
931700852 2:64907921-64907943 GCAGCATCGGGAAAGAGGGATGG + Intergenic
935391913 2:102561781-102561803 GCTGCCTTAGGACAGTGGGAAGG - Intergenic
936151641 2:110025192-110025214 GCACCTTTAGGTCAGAGCCAGGG - Intergenic
936193033 2:110346177-110346199 GCACCTTTAGGTCAGAGCCAGGG + Intergenic
944635644 2:201673873-201673895 GCACCAGAAGGACGGAGGGGAGG - Intronic
946052222 2:216872851-216872873 GCACCAGAATGACACAGGGAAGG - Intergenic
948226655 2:236316473-236316495 ACACCATTATGACAGTGAGATGG + Intergenic
948425510 2:237884735-237884757 GAAGCTTTAGGGCAGAGGGACGG - Intronic
1171010659 20:21507735-21507757 GCACCAAGAGGCCAGTGGGATGG + Intergenic
1172214677 20:33226905-33226927 GGACCATCAGCACAGAGAGAAGG - Intronic
1172535382 20:35669062-35669084 GCTCCATTAGGTCAAAGGAAAGG + Exonic
1173476418 20:43363096-43363118 GCACCATTTGCACATAGGAAAGG - Intergenic
1173485003 20:43434645-43434667 GGAGCACAAGGACAGAGGGAAGG + Intergenic
1174051970 20:47773205-47773227 GCTCCATGAGGACAGAGGCCTGG - Intronic
1176088355 20:63308108-63308130 CCGCCCTCAGGACAGAGGGAGGG - Intronic
1178530745 21:33373556-33373578 GCACCTTGAGATCAGAGGGAGGG - Intergenic
1179566629 21:42253035-42253057 GCCGCATTAGCACACAGGGAGGG + Intronic
1179901992 21:44399186-44399208 GCACCACCAGGACACAGGGAAGG - Intronic
1179940230 21:44634244-44634266 GCACCATTAAAACAGAGACAGGG - Intronic
1180055976 21:45359479-45359501 TGCCCATGAGGACAGAGGGATGG - Intergenic
1180068546 21:45424754-45424776 GCACACCTAGGACTGAGGGAGGG - Intronic
1182035961 22:27198557-27198579 GCACCATTAGGAAAGGGGCAGGG + Intergenic
1182042441 22:27248975-27248997 GCACAATCTGGACACAGGGATGG + Intergenic
1183115095 22:35685743-35685765 GTTCCATCAGGACAGAGGAATGG - Intergenic
1184241454 22:43213076-43213098 GCACCCCTGGGACAAAGGGAGGG + Intronic
1185263866 22:49887190-49887212 GCACCACTAGGCCAGAGGCGTGG + Exonic
1185362343 22:50415859-50415881 GCACCATTAGGACAGAGGGATGG + Intronic
1185376415 22:50484531-50484553 ACGGCATGAGGACAGAGGGAGGG + Exonic
950857942 3:16122831-16122853 GTACTGTAAGGACAGAGGGATGG - Intergenic
952035716 3:29198054-29198076 GGACTATTAGGAGAGAGGAAAGG - Intergenic
953179186 3:40580752-40580774 GCTGCATTAGCACAGAGGGTAGG + Intergenic
953376273 3:42431014-42431036 GCACCCTTTAGAAAGAGGGAAGG - Intergenic
956253843 3:67263212-67263234 GAACCAGCAGCACAGAGGGAAGG + Intergenic
956840677 3:73137127-73137149 TCCCCATTAGGACAGAGCGTGGG - Intergenic
958048711 3:88318326-88318348 GCACCATAATGACAGGTGGAGGG - Intergenic
965612873 3:170563300-170563322 ACACCAGTAAGAGAGAGGGAGGG - Intronic
966254584 3:177903309-177903331 GCACCTTGAAGCCAGAGGGATGG + Intergenic
968814007 4:2812468-2812490 GCACCATCAGGTCAGTGGGGCGG + Intronic
970015896 4:11512245-11512267 GCACCTCTAGGATAGATGGATGG + Intergenic
970309238 4:14764771-14764793 ATACCATTAGGAGAGAGGAAAGG + Intergenic
970341924 4:15116315-15116337 GAACCAATAGGATAGATGGATGG + Intergenic
972707245 4:41557128-41557150 GCAACATTAGAACACAAGGAAGG - Intronic
972978273 4:44663884-44663906 GCACCAGTAGTGCTGAGGGACGG - Intronic
973978752 4:56288394-56288416 ACTCCAATAGGAGAGAGGGAGGG - Intronic
974021690 4:56697234-56697256 GAACAATGAGAACAGAGGGAGGG + Intergenic
974756166 4:66210823-66210845 GAACCAGAAGGTCAGAGGGAGGG - Intergenic
977811654 4:101362290-101362312 GTACCCTTAGGAAATAGGGAGGG - Intergenic
980319440 4:131250222-131250244 GGACTATTAGGAGAGAGAGAGGG - Intergenic
988976759 5:36523790-36523812 AAACCATAAGGAGAGAGGGAGGG - Intergenic
989752737 5:44915403-44915425 GCACCAGTAGGACTGATGAATGG + Intergenic
990171226 5:53052276-53052298 GAACAATGAGGACACAGGGAGGG - Intronic
996848837 5:127930752-127930774 GCTCCATTAGGATTGAGGGTAGG - Intergenic
997698666 5:135881010-135881032 GCACCATTAGTGCAAAGGTAGGG - Intronic
999107002 5:149081897-149081919 GCACCAAGAGGACACAAGGAGGG + Intergenic
999777086 5:154820186-154820208 GCACCACCAGGGTAGAGGGAAGG - Exonic
1001698688 5:173691061-173691083 TCATAATGAGGACAGAGGGACGG - Intergenic
1002470386 5:179431476-179431498 CCACCATTGGGAAAGAGGAAGGG + Intergenic
1003031506 6:2605247-2605269 GAAACAGTAGGAAAGAGGGAAGG + Intergenic
1004801049 6:19148451-19148473 ACACCATTAGGAGAGTGGTAAGG - Intergenic
1007749858 6:44065264-44065286 GCTCCCTGAGGACAGAGGGCAGG - Intergenic
1009584958 6:65588538-65588560 GCACGATATGGACAGGGGGAAGG - Intronic
1010003048 6:70967480-70967502 GAACCATTAGGATGGATGGATGG - Intergenic
1011688193 6:89840950-89840972 GCTCCATTATCACAGAAGGATGG + Intronic
1013149264 6:107428157-107428179 GCACCTTAAAGACAGAGTGAAGG - Intronic
1014123500 6:117751731-117751753 ATACCATTAGGACATAGGCATGG + Intergenic
1014587919 6:123223720-123223742 GCACCATCAGGAAGGAAGGAAGG - Intronic
1014681501 6:124436640-124436662 GTACCCTGAGGACAGAGGCAAGG - Intronic
1018736574 6:166691120-166691142 GCAACATTATGACAGAGCGCAGG - Intronic
1018743122 6:166745092-166745114 GCCACATGAGGACAGGGGGAAGG - Intronic
1020706402 7:11549721-11549743 GAACAATGAGGACACAGGGAGGG + Intronic
1021077666 7:16324607-16324629 GCACCTCTAGTACAGATGGAGGG + Intronic
1022702333 7:32773157-32773179 ATACCATTAGGACATAGGCATGG + Intergenic
1022906560 7:34863297-34863319 ATACCATTAGGACATAGGTATGG + Intronic
1023040417 7:36168078-36168100 ACACAATTACAACAGAGGGATGG - Intronic
1023623104 7:42092372-42092394 GCAGCAAGAGGACACAGGGATGG + Intronic
1027521827 7:79218554-79218576 GTACCATTTGCACAGAGTGAAGG + Intronic
1027627460 7:80563786-80563808 GCACCATTAGCACAAAAGCAGGG + Intronic
1030580378 7:111347586-111347608 GGAACAGTAGGAAAGAGGGAAGG + Intronic
1031900454 7:127403575-127403597 GCAGCTTTTGGACACAGGGAAGG + Intronic
1031940979 7:127788928-127788950 GTACTATAAGAACAGAGGGAAGG - Intronic
1034275100 7:149820580-149820602 TCCCCAGTAGGGCAGAGGGAGGG + Intergenic
1034464505 7:151218593-151218615 GCACCATAATGACAGGTGGAGGG + Exonic
1034686877 7:152979911-152979933 GCACAAGTAGGAGAGAGGAAAGG - Intergenic
1035062093 7:156076853-156076875 TCAGCATTAGGACTGAGGGAGGG - Intergenic
1041972160 8:63756156-63756178 ATACCATCAGGACAGAGGCACGG - Intergenic
1042338175 8:67650695-67650717 TCATCATGAGGAAAGAGGGATGG + Intronic
1044928116 8:97226337-97226359 TCACGATTAGAAGAGAGGGAAGG + Intergenic
1048387360 8:133924696-133924718 TCTCCATTTGGAAAGAGGGAGGG + Intergenic
1050576041 9:6996345-6996367 GCACCATGAGGCCAGAAGAAGGG - Intronic
1056935957 9:90914851-90914873 TTACCAGAAGGACAGAGGGAAGG + Intergenic
1186862693 X:13689216-13689238 GCGCAATGAGGACAGAGAGAGGG - Exonic
1186956080 X:14683621-14683643 ATACCATTAGGACATAGGCATGG - Intronic
1187020631 X:15377785-15377807 GAATCACTATGACAGAGGGAGGG - Intronic
1188446751 X:30261349-30261371 GCCTCATTAGCACAGAAGGATGG + Intergenic
1189135494 X:38545143-38545165 GAACCATCAGGACAGAGTGGTGG + Intronic
1192063745 X:67859298-67859320 GAACAATGAGGACACAGGGAGGG - Intergenic
1192210419 X:69124183-69124205 GCAGCACCAGGAGAGAGGGAGGG - Intergenic
1193516253 X:82468462-82468484 TAACAATGAGGACAGAGGGAGGG - Intergenic
1195579648 X:106486972-106486994 GCACCATTAAGAAAGAGAAAAGG - Intergenic
1196432363 X:115640444-115640466 GCACCAAAAGGACAAAAGGAAGG + Exonic
1199315062 X:146367191-146367213 GCACCATCAGGGCAGAGCTAAGG - Intergenic
1199921117 X:152405110-152405132 GCACAGTTAGGGGAGAGGGAAGG - Intronic
1200270472 X:154677914-154677936 GCTCCAATAGGACAGAGGGGAGG + Intronic