ID: 1185362345

View in Genome Browser
Species Human (GRCh38)
Location 22:50415862-50415884
Sequence CCATTAGGACAGAGGGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185362339_1185362345 2 Left 1185362339 22:50415837-50415859 CCTGAAGACAGAGCTTACATACG 0: 1
1: 0
2: 1
3: 4
4: 77
Right 1185362345 22:50415862-50415884 CCATTAGGACAGAGGGATGGTGG No data
1185362336_1185362345 24 Left 1185362336 22:50415815-50415837 CCCTGGTCCTTAAGAGAGAAGTC 0: 1
1: 0
2: 0
3: 7
4: 143
Right 1185362345 22:50415862-50415884 CCATTAGGACAGAGGGATGGTGG No data
1185362338_1185362345 17 Left 1185362338 22:50415822-50415844 CCTTAAGAGAGAAGTCCTGAAGA 0: 1
1: 0
2: 0
3: 17
4: 165
Right 1185362345 22:50415862-50415884 CCATTAGGACAGAGGGATGGTGG No data
1185362337_1185362345 23 Left 1185362337 22:50415816-50415838 CCTGGTCCTTAAGAGAGAAGTCC No data
Right 1185362345 22:50415862-50415884 CCATTAGGACAGAGGGATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185362345 Original CRISPR CCATTAGGACAGAGGGATGG TGG Intronic
No off target data available for this crispr