ID: 1185362882

View in Genome Browser
Species Human (GRCh38)
Location 22:50419637-50419659
Sequence CCAGTGATGATGAGGGTCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185362882_1185362890 19 Left 1185362882 22:50419637-50419659 CCTTAGACCCTCATCATCACTGG 0: 1
1: 0
2: 1
3: 10
4: 143
Right 1185362890 22:50419679-50419701 AGCTGCTCGTCACGACCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185362882 Original CRISPR CCAGTGATGATGAGGGTCTA AGG (reversed) Intronic
900354579 1:2254106-2254128 CCAGTGACCATGAGGGGCTGGGG + Intronic
901705312 1:11068823-11068845 CCTGTCACGATGAGGGGCTAGGG + Intronic
902324518 1:15690782-15690804 CCTATGATGGTGAGGTTCTAGGG - Intronic
903017037 1:20367809-20367831 ACAGTGATGGTGAGGGTTAAGGG - Intergenic
904947865 1:34212576-34212598 GCAGAGATGAAGAGGGTCTGGGG + Intronic
908038478 1:60081767-60081789 CCAGTGATGCTGAAGGCCTGTGG + Intergenic
911042562 1:93602414-93602436 GCAGTGATGATGCAGGTCTCAGG - Intronic
915041424 1:152971216-152971238 CCAGCTCTGATGAGGGTCTCTGG - Intronic
915838015 1:159193428-159193450 CCAGTGATGATGGGCTTCTGTGG - Exonic
920208460 1:204310911-204310933 CCGGTGATGATGCGGGTGTGGGG + Intronic
921448128 1:215270767-215270789 TCAGTGATGGCGAGGGGCTAAGG - Intergenic
924481401 1:244438347-244438369 CCAGAGATGAGCAGGTTCTAGGG - Intronic
1065289246 10:24213775-24213797 CCAGTGATGAAGAGGATTTCTGG - Intronic
1074590326 10:114806699-114806721 CCAGTGATGCTCAGTGTCTGTGG + Intergenic
1074875655 10:117611200-117611222 CCAGTGAAGCTGAGATTCTAAGG - Intergenic
1075118644 10:119648313-119648335 CCAGTGATGATCAGGCCCCAGGG - Intergenic
1075261954 10:120970784-120970806 CCACTGGTGATGACGGTCTCTGG - Intergenic
1084779358 11:71398257-71398279 CCAGTGGTGGTGAGGGCCTCAGG - Intergenic
1086848951 11:91785711-91785733 CCAGTCATGATGATGGTCAGAGG - Intergenic
1088819415 11:113444715-113444737 GCAGTGCTGATTAGGGACTAAGG + Intronic
1089119263 11:116121870-116121892 CAAGTGTTGATGAGGGTGTGGGG + Intergenic
1089214970 11:116829795-116829817 CCAGTGGAGATGAGGGCCTGAGG - Intronic
1089278478 11:117355785-117355807 CCAGTGACCCTGAGGCTCTAGGG + Intronic
1090702836 11:129311885-129311907 CCAGTGATGATGTGGCTTGAAGG - Intergenic
1091111633 11:132974395-132974417 CCAGTGATGATGAGCTTTTTCGG - Intronic
1092021882 12:5209618-5209640 CAAGTGATGATGATGCTCTTTGG + Intergenic
1092424745 12:8365819-8365841 ACAGTGATGATGAAGATCAAAGG - Intergenic
1095561509 12:43571597-43571619 CCAGTGAAGAAGAGGGTGAAGGG - Intergenic
1096590348 12:52654804-52654826 ACTGTGATGATGAGGCTGTAAGG - Intergenic
1099023472 12:77435961-77435983 CCAGTGTTGCTGAGGGTAGAGGG - Intergenic
1102364181 12:112317636-112317658 CCAGTGATCATACGGGTCAATGG + Intronic
1103742940 12:123103614-123103636 CCAGTGAGGTTGAGGGCCAAGGG - Intronic
1104648799 12:130516140-130516162 CAAGTGTTGATGAGGATGTAGGG - Intronic
1104780073 12:131414143-131414165 CCAGTGTGAAGGAGGGTCTACGG + Intergenic
1105540519 13:21312250-21312272 GCAGTGATGATGAGGGTGTTAGG + Intergenic
1105986532 13:25572689-25572711 GCATTGATGATAAGGGTCTGGGG + Intronic
1106620559 13:31367170-31367192 CCAGTGATGAAGTGGGACAATGG + Intergenic
1107510906 13:41083332-41083354 CCAGTGATGATTTGGTTCTGAGG + Exonic
1110158894 13:72352140-72352162 GCAGAGATGATGAGGGTGGATGG + Intergenic
1110405784 13:75149054-75149076 CAACTGATGATGAGAGTCTTGGG - Intergenic
1111427605 13:88108664-88108686 CCAGAAATGATGGGGGTTTATGG - Intergenic
1111791387 13:92860311-92860333 CGAGTGTTGATGAGGCTATAGGG + Intronic
1115875031 14:37851846-37851868 ACAGTGCTGATGAGGGACTGGGG - Intronic
1117967196 14:61218302-61218324 ACAGTGTTGAAGAGGGTATAGGG - Intronic
1118460289 14:65981029-65981051 ACACTGAAGCTGAGGGTCTACGG + Intronic
1119614708 14:76091485-76091507 CAGGTGGTGATGAGGGTCTGAGG - Intergenic
1119733685 14:76967251-76967273 CCAGCATTGATGAGGTTCTAAGG + Intergenic
1122302006 14:100736812-100736834 CCAGTGATGATGGTGGTCGGTGG - Exonic
1124475809 15:30033501-30033523 CCAGTGATGATGAGGACAGAGGG - Intergenic
1125089292 15:35771760-35771782 ACAATGATGATGACGGTCTGGGG - Intergenic
1125606131 15:40941005-40941027 CAAGTGATCATGAGGGTCTTGGG - Intergenic
1125746817 15:42002664-42002686 CCATTGGTGACGAGGGTCTCAGG + Exonic
1127943340 15:63723947-63723969 TAAGTGATGATGAGGTTCTTGGG + Intronic
1129947023 15:79548065-79548087 CCAGTAATCATGAGGGCCTAAGG - Intergenic
1130062655 15:80580900-80580922 ACAGTGACTATGAGGGTCTGGGG - Intronic
1131541861 15:93281021-93281043 CCAGAGTTGGTGAAGGTCTAGGG + Intergenic
1132163303 15:99563307-99563329 GCACAGATGATGAGTGTCTAAGG - Intergenic
1133373498 16:5264223-5264245 ACAGTGATGATGAAGATCAAGGG + Intergenic
1135753113 16:25072978-25073000 CCAGAGATGAGGAAGGTGTAGGG - Intergenic
1138519990 16:57565609-57565631 CCAGTGCAGATCAGGGTCTCAGG + Intronic
1138902641 16:61292809-61292831 CCAGTGATCCTGAGGCTCTTGGG - Intergenic
1141302203 16:82827477-82827499 GCAGTGATGATGTGAGTCTTGGG + Intronic
1141366830 16:83451051-83451073 CCAGTGATGCTGCTGGTCTGGGG + Intronic
1141784850 16:86192358-86192380 CCAGTAGTGATGAGAGTCGAAGG - Intergenic
1143420779 17:6790247-6790269 CCAGAGATGATGAGGGAACAAGG + Intronic
1143870150 17:9952204-9952226 CAAGTGATGCTGAAGGTCCAGGG + Intronic
1147189704 17:38731291-38731313 CCAGGGAAGATGAGGGGCTCAGG - Intronic
1149618989 17:58027672-58027694 CCAGAGAGGATGAGGGAATAAGG + Intergenic
1152049776 17:77964005-77964027 CCAGTGATCATATGGGTCTTAGG - Intergenic
1152945019 17:83193518-83193540 CCAGTGCTGTTCAGGGTCTGGGG - Intergenic
1155781173 18:29837820-29837842 CCAGTGGTTATAAGGGTCAAAGG + Intergenic
1157666393 18:49491246-49491268 GCATTGATGATCAGGGTGTAAGG - Intronic
1158079296 18:53569847-53569869 CCCCTTATTATGAGGGTCTATGG - Intergenic
1160350879 18:78177173-78177195 CAAGTTATGATGAGGTTCTATGG - Intergenic
1160352939 18:78200642-78200664 CCAGGGAAGATGAGGATCTTGGG - Intergenic
1161291114 19:3493919-3493941 CCAGAGATGGGGAGGGTCTGAGG + Intronic
927320409 2:21737690-21737712 GCAGTGTTGATGAGGGTGTAGGG + Intergenic
927632189 2:24784182-24784204 CCAGTGATAATTGGGCTCTAGGG + Intergenic
929539133 2:42806489-42806511 CCAGTGTTGATGAGAGTGTGGGG - Intergenic
930015794 2:46969815-46969837 CCAGTGATGGCCAGGGCCTAGGG - Intronic
932992166 2:76800906-76800928 CCAGTGATGATGAGCATTGATGG - Intronic
933274378 2:80267814-80267836 TCAGTGAGGATGAGAGTCTAAGG + Intronic
935648708 2:105363715-105363737 CCAGGGATGCTGGGGATCTAAGG + Intronic
937867157 2:126761144-126761166 CCACTCATGATGGGGGGCTAAGG - Intergenic
937907926 2:127061336-127061358 CCTGGGATGATGAGGGTATCGGG - Intronic
939906093 2:147917380-147917402 CCAGTGTTGATGTGGATCTTTGG + Exonic
943656370 2:190513032-190513054 CGAGAGCTGATGAGGGCCTAGGG - Intronic
943934822 2:193902816-193902838 CCACTGATGATAAGGGTATGAGG + Intergenic
945546817 2:211164928-211164950 CCATTGATGATGAGGCTCTGGGG + Intergenic
946234601 2:218316035-218316057 CCACTGATGTTGCTGGTCTAAGG - Intronic
948546405 2:238732600-238732622 CAAGTGCTGATGAGGGTTCAGGG - Intergenic
1174103432 20:48144767-48144789 CCAGTGGTTAGGAGGATCTATGG + Intergenic
1174195220 20:48768006-48768028 TCCGTGATGGTGAGGGTCTCTGG + Intronic
1175409873 20:58760225-58760247 ACAGTGCAGATGAGGGTCTGGGG + Intergenic
1184774959 22:46618526-46618548 CCAGAGCTGATGAGGGTGTCGGG + Intronic
1185362882 22:50419637-50419659 CCAGTGATGATGAGGGTCTAAGG - Intronic
951459079 3:22929648-22929670 CATGTGATGAGGAGGGTGTATGG - Intergenic
952330544 3:32360746-32360768 CCAGTGATGCTGCTGGTCCAGGG - Intronic
952898866 3:38096675-38096697 CCTGGGATGATGAGGGCATATGG - Exonic
954749517 3:52805770-52805792 GCAGTGGTGAGCAGGGTCTAGGG - Intronic
955221642 3:57027935-57027957 CCAGTGATGATGAGGGAAAAAGG - Intronic
955242973 3:57196729-57196751 CCAGTGATGATCAAGGTGGAAGG - Intergenic
955762804 3:62306267-62306289 CCAGTGATGATGAGGTTTGTTGG - Intergenic
957865143 3:86013258-86013280 CCAGTGAAGAAGAGGGTGAAGGG + Intronic
962205013 3:133427236-133427258 CCAATGGTGACGAAGGTCTAAGG - Intronic
962865213 3:139442869-139442891 CCAATGACAATGAGGGTCTAAGG - Intergenic
963753970 3:149214094-149214116 CCTGTGTTGAAGAGGCTCTAAGG + Intronic
964535832 3:157719967-157719989 CCACTGTTGATGAGAATCTAGGG + Intergenic
969133350 4:5009605-5009627 CAAGTGTTGATGAGGACCTAAGG - Intergenic
972696597 4:41452497-41452519 CCAGTGTTGATGAGGATGCAGGG - Intronic
978453410 4:108861459-108861481 CCTCTGATGATGGGGATCTAAGG + Intronic
978692389 4:111529613-111529635 CCAGTCCTGATGAGGGTGTCTGG + Intergenic
981399541 4:144297286-144297308 CAAGTGTTGATGAGGATGTAGGG - Intergenic
983517443 4:168672981-168673003 CCAGTGATGATGAGTTTATTTGG - Intronic
986119136 5:4814505-4814527 CCAGTGAAGATGAGGGGAAACGG - Intergenic
990818129 5:59808002-59808024 ACAGTGGAGATAAGGGTCTAAGG - Intronic
991043843 5:62202453-62202475 ACAGTAGTGATGAGTGTCTACGG - Intergenic
991995562 5:72383000-72383022 CCAGTGCTGGTAAGGGTGTAAGG + Intergenic
992495855 5:77292516-77292538 ACAGTGATGATGAGGGTCTGGGG - Intronic
993183667 5:84588182-84588204 CATGTGCTAATGAGGGTCTAGGG - Intergenic
993475876 5:88363167-88363189 CCAGTGATGATGAGCATGTTAGG + Intergenic
995931781 5:117455100-117455122 CCAGTGCTGATGAGGGTAGCAGG + Intergenic
998241409 5:140448530-140448552 CCAGTATTGGTGAGGGTGTAGGG - Intronic
1003412694 6:5879569-5879591 GTAGTGATGATGAGGGTGTTAGG - Intergenic
1004133207 6:12941105-12941127 CCAGTGAGGCTCAGGGTCAAGGG + Intronic
1010747895 6:79584765-79584787 CCAGTGTTGATGAGAGTGTGGGG + Intergenic
1010823045 6:80438579-80438601 CAAGTGCTGATGAGGGTATGAGG - Intergenic
1016332241 6:142965657-142965679 ACAGTGATGATGGGGGTTTGGGG - Intergenic
1017796320 6:157847979-157848001 CCAGTGAGGAACAGGGGCTAGGG - Intronic
1018244087 6:161805343-161805365 CCAGATGTGATGAGGGTATAAGG - Intronic
1025733015 7:64123079-64123101 CCAGTGAAAATGAGGTTGTAGGG - Intronic
1027915265 7:84309590-84309612 CCAATGCTGATTAGGGTCAAGGG - Intronic
1028184874 7:87770595-87770617 GCAGTGATGAGGAGGAGCTAAGG + Exonic
1028202236 7:87975194-87975216 CCAGGGAAGATGGAGGTCTAAGG - Intronic
1031545285 7:123044544-123044566 ACTGTGATGAGGAGGGTCTTTGG - Intergenic
1033442696 7:141394683-141394705 CCAGTGTTCATGTGGATCTATGG + Intronic
1034221630 7:149450985-149451007 CCAGTGCTGGTGAGTGGCTAAGG - Exonic
1035107035 7:156449670-156449692 ACAGTGATGATGATGGTCGTGGG + Intergenic
1038287864 8:26222081-26222103 CCCTCTATGATGAGGGTCTAAGG + Intergenic
1042225746 8:66513158-66513180 CCAGTGATGATGGAGGTGTGAGG + Intronic
1043519918 8:81033859-81033881 GCAGTGCTGAGGAGGGTCTAAGG + Intronic
1047500400 8:125436103-125436125 CCAGTGGTGTTGAGGATCTCAGG - Exonic
1049272371 8:141702766-141702788 CCAGGCATGATGAGGGTGTGAGG - Intergenic
1058281268 9:103118053-103118075 TGAGTGAAGGTGAGGGTCTAGGG - Intergenic
1058835219 9:108854341-108854363 CCAGCGATGAGGAGTGTCTTTGG + Intergenic
1060410512 9:123396851-123396873 CCAGTTCTGGTGAGGGTATAAGG + Intronic
1060473848 9:123970632-123970654 CCACTGAGGAGCAGGGTCTAAGG + Intergenic
1060921942 9:127426932-127426954 CAAGTGTTGATGAGGATGTAAGG - Intronic
1192245957 X:69371713-69371735 CCAGAGATGAGGAAGGTCTGAGG - Intergenic
1194005150 X:88482405-88482427 CAAGTGTTGATGAGGATGTAGGG - Intergenic
1195661323 X:107381883-107381905 CCACTGTTGATGAGAGTATAGGG - Intergenic
1196966801 X:121065116-121065138 CCAGTGATGATGTGTGTTTGGGG + Intergenic
1199323282 X:146466839-146466861 ACAGTATTGATGATGGTCTAGGG - Intergenic
1199506737 X:148570959-148570981 CAAGTTAAGATGAGGGTCTTAGG - Intronic
1200448061 Y:3289056-3289078 CCAGTGAGGATGATTGTTTAGGG + Intergenic