ID: 1185363261

View in Genome Browser
Species Human (GRCh38)
Location 22:50422231-50422253
Sequence CTGTGGATGAGGAAAGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 588
Summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 534}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185363261_1185363266 -9 Left 1185363261 22:50422231-50422253 CCATCTGCTTTCCTCATCCACAG 0: 1
1: 0
2: 3
3: 50
4: 534
Right 1185363266 22:50422245-50422267 CATCCACAGGACAGAGGGCTTGG 0: 1
1: 0
2: 2
3: 29
4: 292
1185363261_1185363270 10 Left 1185363261 22:50422231-50422253 CCATCTGCTTTCCTCATCCACAG 0: 1
1: 0
2: 3
3: 50
4: 534
Right 1185363270 22:50422264-50422286 TTGGTGGACTCCTTTTCTCAGGG 0: 1
1: 0
2: 0
3: 7
4: 177
1185363261_1185363269 9 Left 1185363261 22:50422231-50422253 CCATCTGCTTTCCTCATCCACAG 0: 1
1: 0
2: 3
3: 50
4: 534
Right 1185363269 22:50422263-50422285 CTTGGTGGACTCCTTTTCTCAGG 0: 1
1: 0
2: 0
3: 13
4: 146
1185363261_1185363271 15 Left 1185363261 22:50422231-50422253 CCATCTGCTTTCCTCATCCACAG 0: 1
1: 0
2: 3
3: 50
4: 534
Right 1185363271 22:50422269-50422291 GGACTCCTTTTCTCAGGGACTGG 0: 1
1: 0
2: 0
3: 16
4: 170
1185363261_1185363268 -6 Left 1185363261 22:50422231-50422253 CCATCTGCTTTCCTCATCCACAG 0: 1
1: 0
2: 3
3: 50
4: 534
Right 1185363268 22:50422248-50422270 CCACAGGACAGAGGGCTTGGTGG 0: 1
1: 0
2: 2
3: 28
4: 365
1185363261_1185363273 20 Left 1185363261 22:50422231-50422253 CCATCTGCTTTCCTCATCCACAG 0: 1
1: 0
2: 3
3: 50
4: 534
Right 1185363273 22:50422274-50422296 CCTTTTCTCAGGGACTGGAAAGG 0: 1
1: 0
2: 2
3: 20
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185363261 Original CRISPR CTGTGGATGAGGAAAGCAGA TGG (reversed) Intronic
900666716 1:3820503-3820525 CTGGGGTGGAGGAAGGCAGATGG + Intronic
901219586 1:7575803-7575825 CTGGGGAAGAGGAAAGCTGAGGG + Intronic
901465190 1:9416901-9416923 CTGTGGCTGAGGGAGGCACAGGG - Intergenic
901911125 1:12459112-12459134 CTGTGGATATGGAGAGCTGATGG - Intronic
903165756 1:21519307-21519329 CTGCGGTGGAGGAAAGCAGGAGG - Intronic
903528301 1:24009978-24010000 CTTTGGAGGAGCAAAGCAGCAGG - Intergenic
903649071 1:24912079-24912101 CAGTGCCTGAGGAAAGAAGATGG + Intronic
904426040 1:30423779-30423801 CAGAGGATGAGGAAGGCAGTGGG + Intergenic
904475602 1:30762711-30762733 CTGAGGATGAGGTCAGCAGCAGG - Intergenic
905489366 1:38331680-38331702 CTGAGGAGGAGGAAGGCAGGTGG - Intergenic
906559368 1:46744711-46744733 CTGTGGCTGAGGGAAGCCCATGG - Intergenic
906844336 1:49174888-49174910 CTGAGGATGAAGAAGACAGAAGG + Intronic
906935297 1:50209256-50209278 CTGTGATACAGGAAAGCAGAGGG - Intergenic
907326432 1:53641426-53641448 CTGGGGAGGAGGAAAACAGGTGG + Intronic
908353441 1:63308746-63308768 CTGTGGATCGGGAATTCAGAAGG - Intergenic
910643577 1:89489941-89489963 TTCTGCATGAGGAAAGGAGAAGG + Intergenic
911087607 1:93991932-93991954 CTGTGGATGAGGAGAACAAGTGG - Intergenic
911193914 1:94974804-94974826 CTGTGGATCAGCAAATCACAGGG + Exonic
911980513 1:104560074-104560096 CTGGGGAAGAGGTATGCAGATGG + Intergenic
912050606 1:105524294-105524316 CTTGGGAAGAGGAATGCAGATGG - Intergenic
912601126 1:110934293-110934315 CTCTGCTTGAGAAAAGCAGAAGG + Intergenic
912745609 1:112243267-112243289 CTATGGAAGAGGAAAGCAAGTGG - Intergenic
914443104 1:147724004-147724026 ATGTGGATGATTAAAGGAGATGG - Intergenic
914790394 1:150872451-150872473 CTGTGGATGAAGAATGTAGAAGG - Intronic
915752895 1:158228468-158228490 CTGTGCTTGAGGAAAGGGGAGGG + Intergenic
916046005 1:161000349-161000371 CTGTGGAAGAGAAAGACAGAAGG + Intronic
916156662 1:161856493-161856515 CTTCAGATGTGGAAAGCAGAAGG - Intronic
916502896 1:165401665-165401687 CTGTGAATGAGGGGAGCTGAGGG - Intronic
917231984 1:172847157-172847179 CTGTGAAGAAGGAAAGGAGAGGG + Intergenic
919514854 1:198510646-198510668 TTCTGCATGAGGAAAGGAGAGGG - Intergenic
919830324 1:201536394-201536416 CTGTGGAGGAGGGGAACAGAGGG + Intergenic
920185081 1:204154438-204154460 CAGTGGATAAGGACAGCTGAGGG + Intergenic
920976644 1:210792066-210792088 AAGTGGAGGAGGAAAGAAGATGG - Intronic
922188576 1:223297419-223297441 CTGTGGATGAGGACAAGTGACGG + Intronic
922345643 1:224694075-224694097 CTGTGGAGGAGGAGAGGAGAGGG + Intronic
922429048 1:225528906-225528928 GTGGGGATGAGGGAAGGAGAGGG - Intronic
922871446 1:228905186-228905208 AAGTAGATGAGGAAGGCAGAAGG + Intergenic
923068855 1:230544640-230544662 CAGTGGATGCTGAAAACAGATGG + Intergenic
923312701 1:232751182-232751204 CTGTGGAACAGGAAACCACAGGG - Intergenic
1063044485 10:2377655-2377677 CTGTGGCTGAGGTGAGCAGCAGG + Intergenic
1063529761 10:6819692-6819714 CTGGGGCTGAGGAGAGGAGAAGG + Intergenic
1064029533 10:11875144-11875166 TTGTGGATTTGGAATGCAGAGGG - Intergenic
1064501208 10:15975630-15975652 CTGTGAATGAGGGCAGCCGATGG + Intergenic
1065050324 10:21785423-21785445 CTGTGGAAGAAGAAAACTGAAGG + Intronic
1065072892 10:22045710-22045732 CTGTGGGTCAGGAATCCAGAAGG - Intergenic
1067045477 10:42982915-42982937 CTGTGGAGGATGACAGCTGAGGG - Intergenic
1067065455 10:43101707-43101729 CTGTGGAGGAAGAAACCACAGGG + Intronic
1067093754 10:43285231-43285253 CAGGAGATGAGGGAAGCAGATGG - Intergenic
1068395631 10:56457348-56457370 CTGGGGATGAGGATGCCAGATGG - Intergenic
1069286354 10:66720502-66720524 ATGTGACTGAGGAAAACAGAAGG + Intronic
1070059386 10:72967617-72967639 TTCTGTTTGAGGAAAGCAGAGGG - Intergenic
1070647715 10:78212957-78212979 ATGAGGAAGAGGAAAGAAGAGGG - Intergenic
1072058841 10:91788434-91788456 CTGTGCCTGGGGAAAGGAGAGGG + Intergenic
1072156530 10:92728953-92728975 CTGTGGATGAAAAAACAAGAAGG - Intergenic
1072638063 10:97190013-97190035 CTGGAGATGAGGAAGGCAGGTGG - Intronic
1073073105 10:100807281-100807303 CTGTGGGTGAGGGGAGCAGGTGG - Intronic
1073371270 10:102991495-102991517 CTGTAATGGAGGAAAGCAGATGG - Intronic
1074487814 10:113905187-113905209 CTCTTGATGAGTAAAGCAAATGG - Intronic
1074603367 10:114936855-114936877 CTGGGGGTGAGGGATGCAGAGGG - Intergenic
1074658487 10:115622003-115622025 GTGTGGAAGGGGAGAGCAGAGGG + Intronic
1075863312 10:125696322-125696344 ATGTGGGTGGGGAAAGGAGAGGG + Intergenic
1076157705 10:128216227-128216249 CTGAGGCTCAGGAAAGCAAAGGG - Intergenic
1076548267 10:131260445-131260467 CTGCGGAAGAGGGATGCAGAGGG + Intronic
1076893496 10:133296893-133296915 TTGGGGATGAGGAAAACAGGTGG + Intronic
1077824868 11:5795575-5795597 TTGTGGATGAGCAAAGAAAATGG + Intronic
1077970262 11:7181829-7181851 TTCTGCATGAGAAAAGCAGAGGG + Intergenic
1078398773 11:11004999-11005021 CTGTGGATGAGCAAAGAAAGAGG - Intergenic
1078402691 11:11042344-11042366 CTGTGGAAGAGGGAAACAAAAGG + Intergenic
1078432957 11:11301779-11301801 CTGGGCATTGGGAAAGCAGAGGG + Intronic
1078513792 11:12006880-12006902 ACCTGGATAAGGAAAGCAGATGG + Intronic
1079037922 11:17036891-17036913 TTGTGCTTGAGAAAAGCAGAGGG + Intergenic
1079069246 11:17328847-17328869 CCCTGTTTGAGGAAAGCAGAGGG - Intronic
1079139534 11:17798859-17798881 CTGTGGATGAGGAAACAGGCTGG + Intronic
1079532951 11:21477201-21477223 CTTTGCTTGAGGAAAGGAGAGGG + Intronic
1079571787 11:21952534-21952556 CTCTGCCTGAGGAAAGAAGAAGG + Intergenic
1079663548 11:23073671-23073693 CTGTAGATGAGGTATTCAGAGGG - Intergenic
1080068816 11:28053751-28053773 CTGGGGTGGAGGAAAGCAGATGG + Intronic
1080224297 11:29943389-29943411 AGGTGGATGAGGAGAGGAGAAGG - Intergenic
1080520515 11:33064500-33064522 GTGTGGCTGAGGGAAGGAGAAGG - Intronic
1081482669 11:43504161-43504183 CTGAGAATCAGGAATGCAGAGGG + Intergenic
1081884118 11:46480103-46480125 AAGTGGAAGAGGAAGGCAGAAGG - Intronic
1082262862 11:50090670-50090692 ATGTGGAAGAGGGAGGCAGAAGG + Intergenic
1082877316 11:58001433-58001455 CTGTGGTTCAGGAAAACAGGAGG - Intergenic
1083481280 11:62949215-62949237 CTGTGGATGGGGATGGCAGCAGG + Intronic
1085358984 11:75868391-75868413 TTGAGGATCAGGACAGCAGAGGG + Intronic
1085568631 11:77539536-77539558 CTGTGAATCAGGAAAACAAAAGG + Intronic
1085648798 11:78247902-78247924 GTGTGGATGAGGGAATGAGAGGG - Intronic
1086855440 11:91860106-91860128 ATGTGGAAGAGGAAAGTGGAGGG - Intergenic
1088046492 11:105458091-105458113 CTTTGCATGAGAAAAGGAGAGGG + Intergenic
1088154855 11:106790536-106790558 ATCTGGTTGAGAAAAGCAGAGGG - Intronic
1088551949 11:111022159-111022181 CTGTGCACTTGGAAAGCAGATGG - Intergenic
1088980480 11:114858647-114858669 CTCAGAATGAGGAAAGCTGATGG + Intergenic
1089230678 11:116972453-116972475 CTGGGGATGAAGAAAGAAGTTGG - Intronic
1089636240 11:119814281-119814303 CTGTGGGTGAGGAATGCAGCAGG - Intergenic
1090210315 11:124916460-124916482 CTCTGCTTGAGGAAAGGAGAGGG - Intergenic
1090673536 11:128969000-128969022 CTGTGGATGGGGAAAGCCAGGGG + Exonic
1090911861 11:131128610-131128632 CTGGGGATGAGGATACCAGGTGG + Intergenic
1091285201 11:134405041-134405063 CTGTGGATGAGGGAAGAGGAGGG + Intronic
1092283900 12:7117667-7117689 CTGTTGAAAAGGAGAGCAGATGG + Intergenic
1092980090 12:13786188-13786210 CTATGGATGATTAAAGCAGTAGG - Intronic
1093016389 12:14159132-14159154 AAGTGGATGGGGAAAGCAAAGGG - Intergenic
1093815964 12:23546894-23546916 CCTTGCATGAGGAATGCAGATGG - Intronic
1094311178 12:29085679-29085701 CTCTGGAAGGGGCAAGCAGAGGG + Intergenic
1094631585 12:32180660-32180682 GTGAGGATTAGGAAAGAAGAAGG - Intronic
1095038524 12:37419570-37419592 CAAAGGATGAGGGAAGCAGAGGG - Intergenic
1096353814 12:50923078-50923100 CTCAGGATTAGGAATGCAGAAGG + Intergenic
1096573892 12:52540736-52540758 CTGGGGCTGAGGAGAGCAGCAGG - Intergenic
1097040800 12:56154790-56154812 CTGTGGAAGAAAAAAGCAGGTGG - Intronic
1097233792 12:57526799-57526821 CTGTGGTTGAGCAATGGAGAAGG - Exonic
1097805579 12:63961373-63961395 CTGGGGGTGAGGAAAGAAGGGGG - Intronic
1098796999 12:74901978-74902000 GGTTGGATGAGGAAAGCAGCTGG - Intergenic
1099443579 12:82726995-82727017 CTGTGGCTCAGGAAAGAAAAGGG - Intronic
1100406757 12:94278640-94278662 CTGAGGATGTTGAAAGCGGAGGG + Intronic
1100638923 12:96462470-96462492 ATGTGGAATAGTAAAGCAGATGG + Intergenic
1101252037 12:102946158-102946180 CTCTGTTTGAGGAAAGGAGAGGG - Intronic
1101467314 12:104961096-104961118 ATGTGGAGGAGGAGATCAGAAGG + Intergenic
1101508309 12:105369171-105369193 CTGTGGTTGAGACAAGCTGAGGG - Intronic
1101838261 12:108310222-108310244 ATGTGGCTAAGGAAAGAAGAGGG + Intronic
1102123167 12:110458971-110458993 CTGAGGGTGAGGAAGGCAGAGGG - Intronic
1103080426 12:118019609-118019631 CTGAGGATCAGGAAGGAAGAAGG - Intronic
1103526233 12:121570555-121570577 GTGTGGAGGATGAAAGCAGCCGG - Intronic
1104242997 12:127008999-127009021 CTGTGAAGGAGGATAGCAGCAGG - Intergenic
1104247253 12:127055794-127055816 CTGTGCTTGATGAAGGCAGAGGG - Intergenic
1105250996 13:18698223-18698245 CTCTGGGGGCGGAAAGCAGAGGG + Intergenic
1105657778 13:22459120-22459142 TTGTGGATGTGTAAAGCAGTAGG - Intergenic
1106074715 13:26448311-26448333 CTCTGCTTGAGGAAAGGAGAAGG + Intergenic
1107528711 13:41260596-41260618 CTGTGAATGAGGAAAACCGAAGG - Exonic
1107845851 13:44511967-44511989 ATGAGAATGAGAAAAGCAGAAGG - Intronic
1107889545 13:44902384-44902406 CTGTCAATGGGGAAAGCACATGG + Intergenic
1108569005 13:51730857-51730879 CTGGGTATGAGGGAAGGAGAGGG + Intronic
1108835519 13:54542105-54542127 ATATGGATGAGATAAGCAGAAGG - Intergenic
1108962833 13:56257787-56257809 TTGTGGGTGAGTAAAGAAGATGG + Intergenic
1111133944 13:84014139-84014161 GAGTGGGTGAGGAAAGGAGAAGG + Intergenic
1111449125 13:88391030-88391052 TTCTGCTTGAGGAAAGCAGAGGG + Intergenic
1112844297 13:103618906-103618928 CTGTGGATTAGGAAACCATCAGG - Intergenic
1113791674 13:113032387-113032409 CTGTGGGGGAGGGAAGCAGGAGG - Intronic
1115145991 14:30226488-30226510 CTGTGGAGGAAGAAAGCATGGGG - Intergenic
1115573930 14:34693005-34693027 CTTTAGATGAGAAAAGAAGAGGG + Intergenic
1116042880 14:39707134-39707156 ATGTGGATGATGAAAGAAGATGG - Intergenic
1116354821 14:43914769-43914791 TTGTGCTTGAGGAAAGGAGAGGG + Intergenic
1116601764 14:46934858-46934880 CAGTGGGTGAGGAAAGCACAAGG + Intronic
1117053570 14:51887163-51887185 CTCTGAATAAGGAAAGCATAGGG - Intronic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117761689 14:59035661-59035683 CTCTGGTGGAGCAAAGCAGAAGG - Intergenic
1117871457 14:60205209-60205231 CTGGGGATCAGGAAGGGAGAGGG + Intergenic
1118693917 14:68365073-68365095 CTGGGTCTGAGGAAAGCACAGGG + Intronic
1119292864 14:73509509-73509531 CTGTGTGTGAGAAAAGCAAAGGG - Intronic
1119637129 14:76282948-76282970 CTGAGAATCAGGAAAGCTGATGG - Intergenic
1120375885 14:83706697-83706719 CTGTTGATGCAGAAAGCAGCAGG + Intergenic
1120484293 14:85091408-85091430 CTGTGGAAGAGTCAACCAGAGGG + Intergenic
1121047912 14:90801467-90801489 CACAGGATGAGGAAAGGAGAGGG + Intronic
1122057588 14:99115123-99115145 CTTAGGATGAGGAAATGAGATGG - Intergenic
1122973626 14:105162328-105162350 CTGGGGAGGAGGCAATCAGATGG - Intronic
1123499752 15:20868921-20868943 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1123593225 15:21879884-21879906 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1124016793 15:25883889-25883911 CAGTGGCTGGGGAAAGCATAAGG + Intergenic
1125883583 15:43212713-43212735 CCTAGGATGAGGAAAGCAGGAGG - Intronic
1126142591 15:45450224-45450246 CTGTGGATGAGAAGGGCAGGTGG + Intergenic
1126887383 15:53165306-53165328 CTGTGCAGGAGAAAAGCAGAGGG - Intergenic
1127665675 15:61144419-61144441 CTGTGCATGTGGGTAGCAGAAGG - Intronic
1127836514 15:62795077-62795099 CTCTGGAAGAGGAGAGCAGGGGG + Intronic
1128548343 15:68582011-68582033 GTGGAGAAGAGGAAAGCAGATGG + Intronic
1129067149 15:72914802-72914824 CTGTGGAAGGAGAAGGCAGAAGG - Intergenic
1130252312 15:82307540-82307562 CCGTGGTAGAGGGAAGCAGAAGG + Intergenic
1130919798 15:88334525-88334547 GTCTGGAAGAGGAAAGGAGAAGG + Intergenic
1132248022 15:100312225-100312247 CTTTAGATGAGGGAGGCAGAGGG + Intronic
1202965344 15_KI270727v1_random:169808-169830 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1132806031 16:1775546-1775568 CTGGGGAGGAGGCAAGCTGATGG - Intronic
1132902906 16:2268076-2268098 CGGCGGCTGAGGAAAGCAGGAGG - Intronic
1133045543 16:3086654-3086676 CGGGGGATGAGGACAGAAGAGGG - Intergenic
1133390496 16:5406258-5406280 TGGTGGATGAGTACAGCAGATGG + Intergenic
1133437768 16:5794629-5794651 CTGTGGATGGGGGATGCAGCTGG + Intergenic
1133620641 16:7522991-7523013 CTGGGGATGAGGCAAGGAGGAGG - Intronic
1134271937 16:12740557-12740579 CTGGGGATGAGGACAATAGAAGG + Intronic
1134332269 16:13261914-13261936 CTGTGGCTGAGGATATCAGTAGG + Intergenic
1135140120 16:19913974-19913996 CTCTTGGTGAGGACAGCAGATGG - Intergenic
1136012012 16:27369900-27369922 CTGTGGCTGAGGACAGGAGGTGG - Intergenic
1136276285 16:29181070-29181092 CCTTGGAAGAGGAAGGCAGAAGG + Intergenic
1136497773 16:30654612-30654634 CTGGGGCTGAGGAAAGGAGAGGG - Exonic
1136670777 16:31855058-31855080 GTGTGGATGAGGAGAGTAGTGGG - Intergenic
1137514423 16:49130645-49130667 CTTAGGATGAGGAAAGCAAGGGG - Intergenic
1137652074 16:50129153-50129175 CAGTGGCTGAGTAAAGCAGATGG - Intergenic
1140158134 16:72455333-72455355 CTCTGCTTGAGAAAAGCAGAAGG - Intergenic
1141177526 16:81730640-81730662 GTGAGGCTGAGGGAAGCAGAGGG + Intergenic
1141417245 16:83885341-83885363 TTGTGGATAAGAAAAACAGAGGG - Intergenic
1141464713 16:84197844-84197866 CTCTGGATGGGGAGAGAAGATGG + Intergenic
1141939296 16:87263950-87263972 CTAAGGATGAGGAACACAGAAGG + Intronic
1142025443 16:87810457-87810479 CTGTGGTTGGGCAAAGCCGAGGG - Intergenic
1142080666 16:88147129-88147151 CCTTGGAAGAGGAAGGCAGAAGG + Intergenic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1143046591 17:4085700-4085722 CTGTCGATTAGGAAAGAAGATGG + Exonic
1143101635 17:4507738-4507760 CTGTGCTTGGGGAAAGCAGGGGG + Intronic
1144107182 17:11997074-11997096 CTCTGGAAGAGGAAACCCGATGG - Exonic
1144171536 17:12664126-12664148 ATGTAGAAGAGGGAAGCAGAAGG + Intergenic
1144300118 17:13915556-13915578 CTGAGGTTGAGGAAAGAACAGGG - Intergenic
1144409629 17:14988071-14988093 CTGCGAGTGAGGAAAACAGAGGG + Intergenic
1144553437 17:16261168-16261190 CTGGGAATGTGGCAAGCAGAGGG - Intronic
1144619651 17:16809324-16809346 CTGAGCATGAGGAAGGCAGTTGG - Intergenic
1144621737 17:16822619-16822641 CTGTGGGTGATGAAAGCCAAGGG - Intergenic
1144884684 17:18450095-18450117 CTGTGGGTGATGAAAGCCAAGGG + Intergenic
1144893034 17:18506380-18506402 CTGAGCATGAGGAAGGCAGTTGG + Intergenic
1145117455 17:20224842-20224864 TTCTGCTTGAGGAAAGCAGAGGG - Intronic
1145139183 17:20437912-20437934 CTGAGCATGAGGAAGGCAGTTGG - Intergenic
1145147542 17:20494282-20494304 CTGTGGGTGATGAAAGCCAAGGG - Intergenic
1145889172 17:28402946-28402968 CTTTATAAGAGGAAAGCAGACGG + Exonic
1146937055 17:36818541-36818563 CTGTGAAGGAGGAAAGTAGGCGG - Intergenic
1147565286 17:41532518-41532540 GTGTCCATGAGCAAAGCAGAAGG + Intergenic
1147573723 17:41586961-41586983 CTGTGGGTGATGAAAGCCAAGGG - Intergenic
1149075621 17:52594265-52594287 CTCTGCTTGAGGAAAGGAGAGGG - Intergenic
1149445679 17:56711585-56711607 CTGTGGAAGAGGTGAGCAAAGGG - Intergenic
1149911971 17:60574997-60575019 CTTTGTAAGAGGAAAGCAGAAGG + Intronic
1150255694 17:63742332-63742354 CTGTGGATGAGGAAGGCTTCGGG - Intronic
1150600281 17:66645360-66645382 CTGTGAATCAAGAAAGGAGAGGG - Intronic
1151145233 17:72034405-72034427 CTGTGGATGGGGAGAGGAGGGGG - Intergenic
1151425715 17:74029851-74029873 CTGTGGGGGTGGAAAGCAGCTGG + Intergenic
1152054657 17:78014867-78014889 CTGCTGATGAGCACAGCAGATGG + Intronic
1152255574 17:79237498-79237520 CTGTGGGTGAGACAGGCAGATGG - Intronic
1153569999 18:6461150-6461172 TCGTGGATGAGCAAAGAAGATGG + Intergenic
1153641941 18:7165093-7165115 GTGAGGAAGAGGGAAGCAGAAGG - Intergenic
1153724827 18:7943773-7943795 CTATTTATGAGGAAGGCAGAAGG - Intronic
1154247550 18:12713122-12713144 CAGTGGAGGAGGAAAGAAGTCGG - Intronic
1154308915 18:13252780-13252802 CTGTGGATGTGGAGGGCCGACGG - Intronic
1154423913 18:14257701-14257723 CTGTGGTTGAGCACAGCAGCAGG - Intergenic
1155074593 18:22343539-22343561 AGGTGGATGGGGAGAGCAGAGGG - Intergenic
1155336627 18:24771738-24771760 CTGAGGATGAGGAAAGCCAATGG + Intergenic
1155401564 18:25445557-25445579 GTGTGGAGCAGGAAGGCAGAGGG + Intergenic
1156472206 18:37384384-37384406 CTGGGGATGAGGACAGGGGAGGG + Intronic
1156773432 18:40758097-40758119 CTGAGGATCAGGAAAACTGATGG - Intergenic
1157544147 18:48536209-48536231 CTGAGGATGTGGAAAACAGGAGG + Intergenic
1158024993 18:52885704-52885726 TTCTGTTTGAGGAAAGCAGAGGG - Intronic
1159928976 18:74293028-74293050 CTATGGAGGAGGTAAGCAGGGGG - Intergenic
1159979840 18:74764959-74764981 CTGAGGAGAAGGAAAGCAGGAGG + Intronic
1162203453 19:9038075-9038097 CTGAGGATGAGGGAAGAAGATGG - Intergenic
1163030288 19:14539710-14539732 CCAGGCATGAGGAAAGCAGAGGG - Intronic
1163376156 19:16931736-16931758 CTGGGGATGGGGAAGCCAGATGG - Intronic
1164292410 19:23880179-23880201 AGGTGGAGGAGGATAGCAGAAGG + Intergenic
1164378610 19:27711737-27711759 CTGTGGGAGAGGAAGGCTGAGGG + Intergenic
1164753976 19:30676339-30676361 CTGTGAATGTGTAAAGAAGATGG + Intronic
1165151612 19:33763928-33763950 CTGTGGATGGTGAAAGGAGCTGG + Intronic
1165985056 19:39761193-39761215 CTGGGGATGAGAGATGCAGATGG + Intergenic
1166266832 19:41689662-41689684 CTGAGGAGGAGGAAAGGAGAGGG - Intronic
1166709801 19:44929405-44929427 CTGTGGGGAAGTAAAGCAGAAGG + Intergenic
1167254692 19:48419986-48420008 TTGTGGATGAAGAAAGAACACGG + Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1167723600 19:51195994-51196016 CTGTTGAGGGGGAAAGCAGCTGG - Intergenic
1168685962 19:58349936-58349958 ACGTCGATGAGGAAATCAGAGGG + Intronic
925306138 2:2849264-2849286 CTGTGGAGGGGGCAGGCAGATGG - Intergenic
925353162 2:3217079-3217101 TTGTGGATGAGGAGAGAAAAGGG + Intronic
925696812 2:6589296-6589318 CTCTGGATGATTTAAGCAGAGGG + Intergenic
925712891 2:6758669-6758691 ATGTGGAAGAGGGAGGCAGAGGG + Intergenic
926706851 2:15843262-15843284 CTGTGGGTTGGGTAAGCAGAGGG + Intergenic
927038253 2:19203153-19203175 CCATGGATGAGGCCAGCAGAGGG + Intergenic
927332719 2:21884964-21884986 TTGAGGTTGAGGAAAGAAGAGGG - Intergenic
927951757 2:27175023-27175045 CTGAGGATGCAGAAGGCAGAGGG - Intergenic
928270293 2:29849372-29849394 CTGTGCATGTGGTAAGAAGAGGG + Intronic
928715481 2:34055631-34055653 CTCTGCTTGAGGAAAGGAGAGGG - Intergenic
928864040 2:35895936-35895958 CTCTGACTGAGGAAAGGAGAGGG - Intergenic
929299605 2:40288038-40288060 GTGAGGATCAGGACAGCAGAAGG - Intronic
930088285 2:47513910-47513932 GAGTGGAGGAGGAAAGCAGATGG - Intronic
930245891 2:48982993-48983015 ATGGGGTTGAGGAAAGAAGAAGG + Intronic
931600854 2:64001416-64001438 CTCTGCTTGAGAAAAGCAGATGG - Intronic
931736048 2:65195626-65195648 CTGAGGTGGAGAAAAGCAGATGG + Intergenic
931959179 2:67462873-67462895 CAGAGGATGGGGAAAGAAGAGGG + Intergenic
932435478 2:71700608-71700630 CTGAGAATGGAGAAAGCAGAGGG - Intergenic
932501039 2:72182824-72182846 GTGTCAATGAGGAAACCAGAAGG + Intronic
933370553 2:81410137-81410159 CTGTGGAGGAGGGTTGCAGAGGG + Intergenic
933653189 2:84865500-84865522 CTTTGCATGTGGAAAGCAGAGGG + Intronic
933721860 2:85402037-85402059 CTGGGGATGAGGAGAGCAGTGGG + Intronic
933812543 2:86042062-86042084 AGTTGGATGAGGAAAGCCGAAGG - Exonic
934860365 2:97759486-97759508 GTGTGGATGAGGGAGGAAGAGGG + Intronic
934898306 2:98138096-98138118 ATGTGGAAGAGGAAAGTGGATGG - Intronic
935106761 2:100052034-100052056 CTGAGGAGGAGGACTGCAGAGGG + Intronic
935386897 2:102509306-102509328 GTGTGGAAGAGGGAGGCAGAAGG - Intronic
935832161 2:107011533-107011555 CTGTGGATGAGAGAAGCTGAGGG - Intergenic
937762962 2:125627794-125627816 CTGTGCATGGGGAAAGCTGTTGG - Intergenic
937839408 2:126510829-126510851 CTGTGACTGAGGAAAGAGGAAGG - Intergenic
937840172 2:126517364-126517386 CTGCGGAAAAGCAAAGCAGAAGG + Intergenic
937863264 2:126729893-126729915 CTGTGGCTGAGCCATGCAGAGGG - Intergenic
938173073 2:129099977-129099999 CTATGGAAAAGGAAAGCACAAGG - Intergenic
938619323 2:133032370-133032392 CTATGGATTTGGAAAGAAGAGGG + Intronic
939325694 2:140685139-140685161 CTGTGAATGAAGAAAGTAGAGGG - Intronic
939539236 2:143473265-143473287 CAATGGCTAAGGAAAGCAGAGGG - Intronic
939715827 2:145582740-145582762 CTGTGGAAGAGGAAACAACATGG - Intergenic
939925810 2:148172466-148172488 CTGGGGTTGGGGAAGGCAGAGGG + Intronic
939955974 2:148527957-148527979 CTGTGGATCAGGAAAGAGCAGGG - Intergenic
941134765 2:161700423-161700445 CATTGGATGTGGAAAGAAGAAGG + Intronic
941296189 2:163741286-163741308 CTGTGCCTGTGGAAAGCAAAGGG - Intergenic
941707385 2:168674335-168674357 CTGTGGAAGAGGAAAAGGGATGG - Intronic
941771373 2:169349418-169349440 CTGTGCATGGGGAGAGGAGAAGG + Intronic
941778220 2:169415682-169415704 CAGAAGAGGAGGAAAGCAGAAGG - Intergenic
941812223 2:169766608-169766630 TTGGGGAAGAGAAAAGCAGAAGG - Intronic
941918611 2:170828344-170828366 AAGGGGATGAGGACAGCAGAGGG - Intronic
944972147 2:205005306-205005328 GTGAGGATGAAGAAAGCTGAAGG + Intronic
945141443 2:206690885-206690907 CTGTGGAGGAGGAATGAAGCTGG + Intronic
946022868 2:216653637-216653659 CTGGAGATGAGGAAGGCAGATGG - Intronic
946901400 2:224375934-224375956 TTGTGGATGAGCAAAGAAGGTGG + Intergenic
947126900 2:226878719-226878741 CTGTGGGTCAGGAATTCAGAAGG - Intronic
948170463 2:235897685-235897707 CTGTTGCTGAGGAAACCAGAGGG - Intronic
949058158 2:241940770-241940792 CTGTGGATGATGAAAGCTGCAGG - Intergenic
1168851542 20:980435-980457 GGATGGATGAGGAATGCAGAGGG - Intronic
1169300017 20:4433772-4433794 CTGAGGATGAAAAAAGGAGATGG - Intergenic
1169432860 20:5555086-5555108 TTATGGATGAGGAAAGAAAATGG + Intronic
1169735812 20:8836386-8836408 CTGAGAATGAGGAGAGCTGATGG + Intronic
1172800223 20:37571198-37571220 TTCTGGAGGAGGGAAGCAGAGGG + Intergenic
1172809859 20:37639667-37639689 CTGTGGATCAGGGATTCAGAAGG + Intergenic
1173007342 20:39150554-39150576 CTCAGGATGAGACAAGCAGAGGG - Intergenic
1173317062 20:41954587-41954609 ATCTGGATGAGGGGAGCAGATGG + Intergenic
1173531752 20:43775044-43775066 CAGTGGATGTGGAAAGAGGATGG + Intergenic
1174128798 20:48327440-48327462 CTGAGGATGAGGAGATAAGAAGG - Intergenic
1174756504 20:53163810-53163832 CTGTGGTTTAGGAAACTAGAAGG - Intronic
1175088710 20:56484223-56484245 CTGTAGCTGAGGAAATCAGATGG + Intronic
1175369753 20:58480344-58480366 CTGAGGATGTGAGAAGCAGAAGG + Intronic
1176217290 20:63954235-63954257 CTGTGGAAGTGGGGAGCAGAGGG - Intronic
1176311155 21:5150349-5150371 TTGTGGATGAGCAAAGCAAGTGG - Intronic
1177276023 21:18913791-18913813 CTCTGGATGAGGAGAGAAGAGGG - Intergenic
1178491837 21:33057507-33057529 CTGGGGATGCGGAGAGGAGAGGG - Intergenic
1179336301 21:40458534-40458556 ATATGCATGAGGAAAGCAAAAGG + Intronic
1179546040 21:42112813-42112835 CTCTGGATGTGTAGAGCAGATGG - Intronic
1179645808 21:42775284-42775306 CTGTGCCTGAGGAAAGCGGGGGG + Exonic
1179813950 21:43891317-43891339 TTATGGATGAGCAAAGCAAATGG - Intronic
1179845895 21:44111686-44111708 TTGTGGATGAGCAAAGCAAGTGG + Intronic
1180558454 22:16596537-16596559 CTGTGAGTGGGGAAAGCACAAGG + Intergenic
1180707573 22:17818701-17818723 CTGTGGATGAGGCCCTCAGACGG - Exonic
1181125403 22:20698935-20698957 CTGTAGAGGACCAAAGCAGAAGG + Intergenic
1181479993 22:23192724-23192746 CTGTTGGTGGGAAAAGCAGATGG - Intronic
1181651359 22:24260902-24260924 CTGTAGAGGACGGAAGCAGAGGG + Intergenic
1182034149 22:27184250-27184272 CCATGGATGAGGAGAGCAGCAGG + Intergenic
1182109027 22:27709921-27709943 TTGTGGAAGAGCAAAGGAGACGG - Intergenic
1182550923 22:31100373-31100395 CTGAGGGTGAGGTGAGCAGACGG - Intronic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1183390306 22:37541952-37541974 GTGGGGAGGAGGAAAGCAGAGGG - Intergenic
1183717152 22:39540201-39540223 CTGTGGCTGAGGAAACCCCAGGG - Intergenic
1184505546 22:44899155-44899177 CTGAGGATGAGGGAATCAGTTGG + Intronic
1184850149 22:47115274-47115296 CTGCGGATTAGCAATGCAGATGG - Intronic
1185210451 22:49567976-49567998 CTGTGGCCGTGGAAAGCTGAAGG + Intronic
1185363261 22:50422231-50422253 CTGTGGATGAGGAAAGCAGATGG - Intronic
949564997 3:5236206-5236228 CTGTGGATGCTGAAGACAGAAGG + Intergenic
950469846 3:13177749-13177771 TTGTGCATGTGGACAGCAGAGGG - Intergenic
950836882 3:15928891-15928913 TTTTGGTAGAGGAAAGCAGAAGG - Intergenic
951063822 3:18240900-18240922 GTGTGGAGGAGGAAAGGACAGGG - Intronic
951099366 3:18668848-18668870 AAGTGGAAGAGGAAGGCAGAAGG - Intergenic
952537113 3:34322681-34322703 CTGTGGAGCAGGAAAAGAGAGGG + Intergenic
952710477 3:36427005-36427027 TTGTGGATGAGGCAAGAAGGAGG - Intronic
953395907 3:42569603-42569625 CTGGTGACAAGGAAAGCAGAAGG + Intronic
954049358 3:47960384-47960406 CTGTTGATGAGGAAGACAGAGGG - Intronic
954841345 3:53514555-53514577 CTGTGGAAGAGGAAATAAAATGG + Intronic
955585184 3:60470448-60470470 CTCTGCTTGAGGAAAGGAGAGGG - Intronic
956345207 3:68270694-68270716 CTGTGGATGAAGGAACAAGAGGG + Intronic
958728299 3:97932838-97932860 CAGTGGATCTGGAAAGAAGATGG - Intronic
959725028 3:109533283-109533305 CTTTGCTTGAGAAAAGCAGAAGG - Intergenic
960108149 3:113819959-113819981 GTGTGGGTGGGGAAAACAGAGGG - Intergenic
960210425 3:114958348-114958370 TTATGGATGAGGATAGTAGATGG - Intronic
961821014 3:129575656-129575678 CTGGGGATGGGGGAACCAGAAGG + Intronic
962346550 3:134623329-134623351 CTGTGAATGAGGAAAGTGGGTGG - Intronic
962461241 3:135615253-135615275 TTGTGGATGAGCAAAGAAAATGG - Intergenic
962741745 3:138367138-138367160 CTGTGGATGGGGCAAGGAAATGG + Intronic
963070692 3:141302908-141302930 ATGTGAATGAGGAAAACAGGCGG + Intergenic
963510752 3:146245174-146245196 CTATGGATAAGGAAAGAAAATGG + Intronic
963757831 3:149254269-149254291 CTGTGGATGAGAACAGAAAAAGG + Intergenic
963933974 3:151033942-151033964 CTGTGGATCAGGTTTGCAGAGGG - Intergenic
964804089 3:160587780-160587802 CTCTGCTTGAGAAAAGCAGAGGG + Intergenic
965146830 3:164915577-164915599 CTATGGATGAGCAAAGGAAATGG - Intergenic
967341334 3:188401755-188401777 TTGGGGAACAGGAAAGCAGATGG + Intronic
967611512 3:191511468-191511490 ATGTCTATGAGGAAAGCAGGAGG - Intergenic
967636028 3:191804325-191804347 CTCTGTATGGGGAAAGAAGAGGG + Intergenic
967948271 3:194821035-194821057 CTGTGGTTGAGGGAAGCAGAGGG + Intergenic
967983070 3:195077200-195077222 CTGGGGAAGGGAAAAGCAGAGGG + Intronic
968334539 3:197901637-197901659 CTCCGCATGTGGAAAGCAGATGG + Intronic
968754700 4:2409261-2409283 CTCTGGATGGAGAAAGTAGATGG - Intronic
969396779 4:6926932-6926954 CTGAGGACAAGGAAACCAGAAGG - Intronic
969760268 4:9176119-9176141 CTGAGGAGGAGGAAACCTGAAGG - Exonic
970001287 4:11368618-11368640 CGGCGGCTGAGGAAAGCAGGAGG + Intergenic
970097967 4:12486712-12486734 TTCTGATTGAGGAAAGCAGAAGG - Intergenic
970262534 4:14243379-14243401 CTGGGTATGAGGGAACCAGAAGG + Intergenic
970699714 4:18721348-18721370 CTCAAGCTGAGGAAAGCAGAAGG + Intergenic
972802569 4:42492522-42492544 CTGTGCATGATGGAAGAAGAAGG - Intronic
973981772 4:56313989-56314011 CTGTGGGTGGAGAAAGCAAAAGG + Intronic
974353005 4:60773872-60773894 CTCTGATTGAGAAAAGCAGAGGG - Intergenic
974884555 4:67802639-67802661 GTGTGAATGAGGAAACCACAGGG + Intergenic
975314290 4:72933505-72933527 TTGTGGTTGAGGAAAGAAGAGGG - Intergenic
975589475 4:75986034-75986056 CTGTAGAGAAGGAAAGCACAGGG - Intronic
975737103 4:77391769-77391791 CTGTGGTTGAGCAAAATAGATGG + Intronic
976016420 4:80560412-80560434 CTTTGGCTTGGGAAAGCAGAGGG + Intronic
977835794 4:101645024-101645046 CTGGGGATGATGAAAATAGATGG + Intronic
978878849 4:113675825-113675847 CTGTGAATGAATAAAGCATAGGG - Intronic
979174151 4:117641116-117641138 TTGTTCAGGAGGAAAGCAGAAGG - Intergenic
979696655 4:123620435-123620457 GAGTGGATGAGGGAAGAAGAAGG + Intergenic
979813645 4:125071142-125071164 TTGTTTATTAGGAAAGCAGAAGG + Intergenic
980415427 4:132482755-132482777 CTGTGGTTGGAGAGAGCAGATGG + Intergenic
980640571 4:135573149-135573171 CTATGGATGAGGAAAGAATGCGG - Intergenic
981895649 4:149796029-149796051 TTGTGCTTGAGAAAAGCAGAGGG + Intergenic
983995575 4:174177301-174177323 CTGTGGATGAGGTCAGCTGGTGG - Intergenic
984759014 4:183348062-183348084 CGGAGGTGGAGGAAAGCAGATGG - Intergenic
984782875 4:183541839-183541861 CTGTGCAAGGGGAATGCAGAAGG - Intergenic
984847163 4:184117693-184117715 CTGTGGAGGAGACAAACAGAGGG + Intronic
984887893 4:184467115-184467137 CTGGGGATGAGAAAGGCTGATGG - Intronic
985330580 4:188827836-188827858 TTGTGGATGAGCAAAGAAGATGG + Intergenic
985375241 4:189329663-189329685 CTGTGGGTGAGAAAAAGAGAAGG + Intergenic
985902205 5:2805296-2805318 CTGTGGACCAGGAAACCACAGGG + Intergenic
985918615 5:2948473-2948495 ATGTGGATCAGGAAAGCAATTGG + Intergenic
985960306 5:3297415-3297437 CTGTGGAGAAGGAAAGGATAGGG - Intergenic
986045842 5:4036883-4036905 AAATGGATGAGGAAAGGAGAGGG - Intergenic
987206854 5:15636269-15636291 CTGTAGATGAGGAGAGTTGAGGG - Intronic
987846845 5:23297588-23297610 ATGGGGATAAAGAAAGCAGAGGG + Intergenic
988398870 5:30734692-30734714 CTGAGAATGAGGAGAGCAGAGGG + Intergenic
988888986 5:35593814-35593836 TTGTGGATGAGCAAAGAAAATGG - Intergenic
989001265 5:36762999-36763021 CTGTGCATCAGGAACACAGATGG + Intergenic
989709113 5:44375236-44375258 CTGTTTATGAGGAAACTAGATGG + Intronic
990197822 5:53338215-53338237 CTGGGGAAGAGGCAAGTAGATGG + Intergenic
990596067 5:57313660-57313682 CTGTGAATGAGGCATCCAGAGGG - Intergenic
992357978 5:76005191-76005213 CTGTGAATGAGGCAAAGAGAAGG - Intergenic
994471122 5:100209542-100209564 CTGTGGAAGAGGAAAACAAGTGG + Intergenic
994569566 5:101498303-101498325 CTATGCATGAGAAATGCAGAAGG - Intergenic
995922899 5:117334704-117334726 CTGTGGATGAAGCCAGCACAGGG + Intergenic
996636375 5:125694034-125694056 CTGTGAAGGAGGAAAGAATATGG - Intergenic
997544340 5:134693008-134693030 CTGTGAATCAGAAAAGCAAAGGG - Intronic
998432795 5:142080941-142080963 CTATGGGTCAGGAAAGCAGATGG + Intergenic
998667101 5:144309843-144309865 CTGAGGAACAGGGAAGCAGAAGG + Intronic
998936705 5:147236647-147236669 CTGTGGAAGGGGGAAGCAGATGG - Intronic
999084304 5:148873596-148873618 CTGTTGATGAGGAAAGAAAATGG + Intergenic
999944746 5:156582709-156582731 CTAGGGATAAGGAAATCAGAAGG - Intronic
1000648670 5:163787737-163787759 ATGTGGAAGAGGAAGGCAGAAGG - Intergenic
1000862012 5:166467133-166467155 GTGTGGATGAAAAAAGTAGATGG - Intergenic
1001612097 5:173011083-173011105 CTGAGGATGCGAAAAGGAGATGG - Intronic
1001682226 5:173566681-173566703 TTACAGATGAGGAAAGCAGAGGG - Intergenic
1002462304 5:179380468-179380490 CTGAGGCTGAGGACACCAGAGGG + Intergenic
1002779041 6:352574-352596 CTGTGGCTGGCGAAAGCAGCTGG + Intergenic
1003036067 6:2641263-2641285 GTGTTGAGGAGGAAACCAGATGG - Intergenic
1003314259 6:4997501-4997523 CTGAGAATCAGGAAAGAAGATGG - Intronic
1004321352 6:14633973-14633995 CTTTGGTTGATGAAAGCAGGTGG - Intergenic
1004321562 6:14635387-14635409 CTGTGGCTGAGGGAAGCAGCAGG - Intergenic
1005356988 6:24994571-24994593 CTGTAGAAGAGCAAAGAAGAAGG + Intronic
1005404900 6:25476215-25476237 CTCAGGAGTAGGAAAGCAGAGGG - Intronic
1006108647 6:31731004-31731026 CTGAGGATGGGGAGAGGAGAGGG + Intronic
1006606714 6:35262666-35262688 ATGTGGCTGAGGATGGCAGAAGG - Intronic
1006980748 6:38145918-38145940 ATGTGAATGAGAAAAGCAGGAGG - Intronic
1008475555 6:51932019-51932041 ATGGAAATGAGGAAAGCAGAGGG + Intronic
1009771227 6:68145126-68145148 CTCTGCTTGAGAAAAGCAGATGG - Intergenic
1011457408 6:87566873-87566895 ATGTGGACAAGGAAAGCAGACGG + Intronic
1012824175 6:104126417-104126439 CTCTGCATGAGGAAAGGAGAGGG - Intergenic
1012953688 6:105545659-105545681 GTGTGGATGAGGAGAGCAGAAGG - Intergenic
1014424960 6:121292856-121292878 CTGGGCAGGAGCAAAGCAGAAGG + Intronic
1014582984 6:123161588-123161610 TTCTGCTTGAGGAAAGCAGAGGG - Intergenic
1015030309 6:128586739-128586761 CTCTGCTTGAGAAAAGCAGAGGG + Intergenic
1016079860 6:139842959-139842981 ATTTTGATGAGGAAAGGAGATGG - Intergenic
1016360744 6:143265133-143265155 CTTTGCAGGAGGAAAGGAGAAGG - Intronic
1016363461 6:143291740-143291762 CTGTGTTCAAGGAAAGCAGAAGG + Intronic
1016986887 6:149901691-149901713 CTGTGGATGAGGAAGGCATCAGG - Intergenic
1017410625 6:154163918-154163940 CAGTGCAGTAGGAAAGCAGAGGG + Intronic
1020607383 7:10356265-10356287 TTCTGTTTGAGGAAAGCAGAGGG - Intergenic
1021088478 7:16452106-16452128 GTCTGGATGGGGAAAGCACAGGG - Intergenic
1021471208 7:21003789-21003811 CAGTGGGTGAGGTAAGCAGGGGG - Intergenic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1022819712 7:33947339-33947361 CTCTATATGAGGAAAGAAGATGG - Intronic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1023956600 7:44891650-44891672 CTGAGGCTGAGGAGAGGAGAGGG + Intergenic
1024548783 7:50543260-50543282 CTGTGGAAGCGTAAAGCTGAAGG + Intronic
1024596386 7:50941119-50941141 CTGTGGATGAAGAGAGGAAACGG - Intergenic
1024777396 7:52803509-52803531 CTGAGGATAAGGAAAGGGGATGG - Intergenic
1024854333 7:53760129-53760151 CAGTGGATGGGGAATGCAGCAGG + Intergenic
1025910589 7:65825438-65825460 ATGTGGAAGAGGGAGGCAGAAGG - Intergenic
1026044765 7:66899383-66899405 ATGTGGAAGAGGGAGGCAGAAGG - Intergenic
1026644294 7:72154449-72154471 CTCTGGATTATAAAAGCAGAAGG + Intronic
1026792071 7:73340615-73340637 CTGTGGAGAGGGAAGGCAGATGG - Intronic
1028505504 7:91566075-91566097 CGGTGTATGAGGAAAGTGGAAGG - Intergenic
1028775648 7:94673240-94673262 CTGGGGAGGAGGAAAGGAGTAGG - Intergenic
1029266652 7:99347312-99347334 CTTTGGAAGACCAAAGCAGAAGG - Intronic
1029529704 7:101117258-101117280 CTGTGTTGGAGGAAAGCAGGAGG + Intergenic
1031374396 7:121006508-121006530 CTAAGGAAGAGGAAAGCAGAGGG + Intronic
1031934443 7:127721717-127721739 CTGTGAATAAGGAGAGGAGAAGG + Intronic
1032222574 7:130005891-130005913 CAGTGGAAGGGGAAAGCAGCTGG - Intergenic
1033468055 7:141615337-141615359 CTAAGGATGTGGAAAGGAGATGG + Intronic
1033646495 7:143308836-143308858 CTCTGGCAGAGGTAAGCAGAAGG - Intergenic
1034299302 7:150001310-150001332 CTGTGTAGGATCAAAGCAGAGGG - Intergenic
1034560310 7:151876043-151876065 CGGTGGGTGGGGAAAGCAGCGGG - Intronic
1034618864 7:152441459-152441481 CTGTGAGTGGGGAAAGCACAAGG - Intergenic
1034806712 7:154095463-154095485 CTGTGTAGGATCAAAGCAGAGGG + Intronic
1035084891 7:156249672-156249694 CTGTGGATGGGAAATGCAGTGGG - Intergenic
1036089828 8:5653404-5653426 CAGTGTCTGAGGAAAGGAGAGGG + Intergenic
1036263891 8:7259866-7259888 CTGAGGAGGAGGAAACCTGAAGG - Intergenic
1036265187 8:7267488-7267510 CTGAGGAGGAGGAAACCTGAAGG - Intergenic
1036266488 8:7275110-7275132 CTGAGGAGGAGGAAACCTGAAGG - Intergenic
1036267794 8:7282732-7282754 CTGAGGAGGAGGAAACCTGAAGG - Intergenic
1036269097 8:7290354-7290376 CTGAGGAGGAGGAAACCTGAAGG - Intergenic
1036270391 8:7297976-7297998 CTGAGGAGGAGGAAACCTGAAGG - Intergenic
1036297494 8:7549079-7549101 CTGAGGAGGAGGAAACCTGAAGG + Intergenic
1036298798 8:7556726-7556748 CTGAGGAGGAGGAAACCTGAAGG + Intergenic
1036300103 8:7564376-7564398 CTGAGGAGGAGGAAACCTGAAGG + Intergenic
1036301407 8:7572021-7572043 CTGAGGAGGAGGAAACCTGAAGG + Intergenic
1036302704 8:7579670-7579692 CTGAGGAGGAGGAAACCTGAAGG + Intergenic
1036315931 8:7718405-7718427 CTGAGGAGGAGGAAACCTGAAGG - Intergenic
1036317238 8:7726053-7726075 CTGAGGAGGAGGAAACCTGAAGG - Intergenic
1036318546 8:7733701-7733723 CTGAGGAGGAGGAAACCTGAAGG - Intergenic
1036319855 8:7741348-7741370 CTGAGGAGGAGGAAACCTGAAGG - Intergenic
1036321162 8:7748996-7749018 CTGAGGAGGAGGAAACCTGAAGG - Intergenic
1036322471 8:7756644-7756666 CTGAGGAGGAGGAAACCTGAAGG - Intergenic
1036323779 8:7764292-7764314 CTGAGGAGGAGGAAACCTGAAGG - Intergenic
1036325081 8:7771940-7771962 CTGAGGAGGAGGAAACCTGAAGG - Intergenic
1036350963 8:8012368-8012390 CTGAGGAGGAGGAAACCTGAAGG + Intergenic
1036352261 8:8020014-8020036 CTGAGGAGGAGGAAACCTGAAGG + Intergenic
1036353560 8:8027662-8027684 CTGAGGAGGAGGAAACCTGAAGG + Intergenic
1036576912 8:10036237-10036259 CTGTGGAAGAGGAGAGCTGTAGG - Intergenic
1036846247 8:12172787-12172809 CTGAGGAGGAGGAAACCTGAAGG + Intergenic
1036867613 8:12415106-12415128 CTGAGGAGGAGGAAACCTGAAGG + Intergenic
1036960659 8:13241422-13241444 CTGAGGAAAAGGAAACCAGAGGG - Intronic
1037173491 8:15921297-15921319 CTGTGAATCAGGGAAGCTGATGG + Intergenic
1038695408 8:29801980-29802002 CTTTGGATTAGGACATCAGAAGG - Intergenic
1039407332 8:37324846-37324868 CTGAGGTTCAGGGAAGCAGAAGG + Intergenic
1040934557 8:52768715-52768737 CTGTTGCTGAGGATAGCAGGAGG + Intergenic
1042104884 8:65315797-65315819 CTGTGGAAGAGGATGGCAGAAGG - Intergenic
1042649727 8:71025996-71026018 CAGAGGATGAGGAGAGGAGATGG - Intergenic
1042980158 8:74518120-74518142 TTCTGTATGAGGAAAGGAGAGGG - Intergenic
1042980208 8:74518430-74518452 TTCTGCATGAGGAAAGGAGAGGG + Intergenic
1043437355 8:80247630-80247652 CCCTGGAGGAGGAAAGCAGTAGG + Intergenic
1044182207 8:89209865-89209887 CTGAGGAGGAGGCATGCAGATGG - Intergenic
1044429429 8:92091154-92091176 TTGTAGAAGAGGAATGCAGAGGG - Intronic
1044875782 8:96665039-96665061 CTTTGAAGGAGGTAAGCAGAGGG + Intronic
1045620637 8:103973839-103973861 CTGAGGATGAGTAAACCAGCTGG - Intronic
1045643492 8:104278257-104278279 CTGTTGAATAGGAAAGCAGGAGG - Intergenic
1046150736 8:110221237-110221259 GTGTGGGTAAAGAAAGCAGAGGG - Intergenic
1046708412 8:117481095-117481117 ATGTGGATGTGGAAAGAAGAAGG + Intergenic
1047050553 8:121106928-121106950 CTGTTGATTAGGAAACCATAAGG - Intergenic
1047356116 8:124123770-124123792 CAGTAGATGAGGGAAGCGGAGGG + Intergenic
1047898906 8:129397941-129397963 CTGGGGAAGAGGACACCAGATGG - Intergenic
1048150521 8:131889134-131889156 CAGTAGATAAGTAAAGCAGATGG + Intergenic
1048286397 8:133145173-133145195 CAGAGGAAGAGGAAGGCAGAAGG + Intergenic
1048990182 8:139756276-139756298 TTGGGGATGAGGACAGCAGGTGG + Intronic
1049040352 8:140108094-140108116 CTGTGGAGGATGAATGGAGAAGG + Intronic
1049113406 8:140664595-140664617 CAGTGGATGAGGAAGGCACATGG - Intronic
1049151603 8:141038590-141038612 CTGGGGAGGAGGAGAGCAGCGGG - Intergenic
1049165540 8:141123411-141123433 TTGTGAATGATGACAGCAGAGGG + Intronic
1050238826 9:3612880-3612902 TTCTGGTTGAGGAAAGGAGAAGG - Intergenic
1050483153 9:6106850-6106872 CTGGGGCTGGGGATAGCAGAGGG + Intergenic
1050944566 9:11500840-11500862 CAGTAGATGAGGAAGCCAGAAGG + Intergenic
1051465059 9:17367946-17367968 CCCTGCATGAGAAAAGCAGAGGG + Intronic
1052154899 9:25173534-25173556 CAGTGGAGGAAGAAAGCAGTGGG - Intergenic
1052162381 9:25280742-25280764 CTGGGGATGGGGAAAGGAGGAGG + Intergenic
1052342265 9:27375365-27375387 CTGGGGATGATGAAGGCACATGG + Intronic
1052774984 9:32724169-32724191 CTGTGGATCAGGAATGCGGGTGG + Intergenic
1054882210 9:70155742-70155764 CATTGGAGGAGGAAGGCAGAGGG - Intronic
1055073856 9:72194179-72194201 TTCTGCTTGAGGAAAGCAGAGGG - Intronic
1055935091 9:81597380-81597402 GTGGGGATCAGGAAAGCACAAGG + Intronic
1057217390 9:93236643-93236665 CTGTGCATGAAGGGAGCAGAGGG - Intronic
1057842462 9:98497025-98497047 CTATGGATGTGAAAAGCAAAGGG + Intronic
1058473464 9:105305285-105305307 CTAAGAATGAGGAAAGAAGAAGG - Intronic
1059328151 9:113517238-113517260 CTGGGGCTGAGGACTGCAGAGGG + Intronic
1059418630 9:114177416-114177438 GTGTGGAGGAGGACTGCAGAGGG + Intronic
1059687405 9:116650838-116650860 CTGTGGAAGGGGAAAGAACAGGG - Intronic
1060882142 9:127124675-127124697 TTGTGGCTGAGGAGAGAAGATGG + Intronic
1060925864 9:127454696-127454718 CTGTGGGTGGGGGAGGCAGATGG - Intronic
1061207939 9:129175187-129175209 CTGTGGCCGGGGAAAGCAGCCGG - Intergenic
1061498881 9:130991126-130991148 CTGAGGCTCAGGGAAGCAGAGGG - Intergenic
1062000142 9:134211806-134211828 CTGTGGAGAAAGAAGGCAGAGGG + Intergenic
1062448038 9:136603972-136603994 CTGGGGATGAGGAGAGGAGGAGG + Intergenic
1186192999 X:7084337-7084359 ACGAGGATGAGGAAAACAGACGG - Intronic
1186248468 X:7640212-7640234 CTGTGTATGAAGAGAGTAGAGGG + Intergenic
1186997658 X:15140862-15140884 CTGGGGATGGGGAACCCAGAAGG + Intergenic
1187326601 X:18295765-18295787 CTGTGGATGAGGACGCCAGGTGG - Intronic
1187612869 X:20961382-20961404 CTCTGCATGAGAAAAGCAGAGGG + Intergenic
1188469313 X:30519488-30519510 GTGTGGATGAGCAAAGAAAATGG + Intergenic
1190210434 X:48442370-48442392 CTGAGGCTGAGGCAAGAAGAGGG - Intergenic
1190330402 X:49231830-49231852 CTGTGGAAGGTGAAAGCAGTGGG - Exonic
1190515924 X:51223519-51223541 GGGAGGATGAGGAAAGAAGAGGG + Intergenic
1190801605 X:53794567-53794589 CAGAGGATGAGGAAAGAAGGTGG + Intergenic
1190831560 X:54063492-54063514 TTGTGGATGAGGAAAGAATCTGG + Intergenic
1193213903 X:78840033-78840055 CTGTGCTTGAGGAAAGGAGATGG + Intergenic
1193247342 X:79244391-79244413 TTCTGCTTGAGGAAAGCAGAGGG + Intergenic
1194239293 X:91423868-91423890 CTGTGGATGAGGGATGGACAAGG + Intergenic
1194692923 X:97009469-97009491 TTTTGCTTGAGGAAAGCAGAGGG - Intronic
1195702110 X:107713409-107713431 CTGTGGATGAGGGATGAACAAGG - Exonic
1195823384 X:108970822-108970844 CTCTGCATGAGGAAAGGGGAGGG + Intergenic
1196558154 X:117115959-117115981 CAGGGGATGGAGAAAGCAGAAGG - Intergenic
1197167176 X:123391489-123391511 CTGGGGATGGGGACATCAGATGG + Intronic
1197637579 X:128932371-128932393 CTCTGGAAGAAGAAAGAAGAGGG - Intergenic
1197831007 X:130642377-130642399 CTATGGATGAGCAAAGAAAATGG + Intronic
1198078419 X:133215957-133215979 GTGTGGCTGGGGACAGCAGAGGG - Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1199409477 X:147504017-147504039 CTATGGATGAGCAAAGAAGTTGG + Intergenic
1199623363 X:149718331-149718353 CTGGAGATGAGGAAAGAACATGG + Intergenic
1199685262 X:150259796-150259818 CTCTGCATGAGGATAGCAGAAGG - Intergenic
1199767804 X:150953615-150953637 CTGTGAATGAGGAGAGGACATGG - Intergenic
1199811335 X:151352812-151352834 CTGTGAATGGGGAAAGCAGAAGG + Intergenic
1199854651 X:151750607-151750629 CAGTGGATGAAGAAAAGAGAAGG - Intergenic
1200366462 X:155670957-155670979 CTGTGGATGTGGAAAGATTATGG - Intergenic
1201361932 Y:13161430-13161452 TTGATGATGAGGAAAGCTGAAGG + Intergenic
1201564937 Y:15355784-15355806 ATGAGGATGAGGAAAACAGAGGG - Intergenic
1201757518 Y:17502432-17502454 CTGGGGAAGAGAAAAGGAGAGGG - Intergenic
1201844036 Y:18403550-18403572 CTGGGGAAGAGAAAAGGAGAGGG + Intergenic