ID: 1185366540

View in Genome Browser
Species Human (GRCh38)
Location 22:50439477-50439499
Sequence CCCATGGGGCGTGTGACCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 148}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185366540_1185366551 27 Left 1185366540 22:50439477-50439499 CCCCAGGTCACACGCCCCATGGG 0: 1
1: 0
2: 2
3: 8
4: 148
Right 1185366551 22:50439527-50439549 CTGTCCCCTGTTGCTCCTTGAGG 0: 1
1: 0
2: 1
3: 33
4: 217
1185366540_1185366553 29 Left 1185366540 22:50439477-50439499 CCCCAGGTCACACGCCCCATGGG 0: 1
1: 0
2: 2
3: 8
4: 148
Right 1185366553 22:50439529-50439551 GTCCCCTGTTGCTCCTTGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 145
1185366540_1185366548 -5 Left 1185366540 22:50439477-50439499 CCCCAGGTCACACGCCCCATGGG 0: 1
1: 0
2: 2
3: 8
4: 148
Right 1185366548 22:50439495-50439517 ATGGGTGTCGGCAGCTTGTCAGG 0: 1
1: 0
2: 2
3: 5
4: 91
1185366540_1185366552 28 Left 1185366540 22:50439477-50439499 CCCCAGGTCACACGCCCCATGGG 0: 1
1: 0
2: 2
3: 8
4: 148
Right 1185366552 22:50439528-50439550 TGTCCCCTGTTGCTCCTTGAGGG 0: 1
1: 0
2: 1
3: 13
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185366540 Original CRISPR CCCATGGGGCGTGTGACCTG GGG (reversed) Intronic
901510240 1:9714796-9714818 TCCATGGAGTGTGTGCCCTGGGG - Intronic
903467464 1:23561870-23561892 CCCATGGGCTGTGTGACATAAGG + Intergenic
903660386 1:24973467-24973489 CCCCTGGGGCGTGGGAGCTGGGG + Intergenic
904296340 1:29521926-29521948 CCCATGAGCTGTGTGACGTGGGG + Intergenic
904489072 1:30847166-30847188 CCTATGAGCTGTGTGACCTGGGG + Intergenic
906223888 1:44105226-44105248 AGAATGGGGTGTGTGACCTGAGG + Intergenic
907501664 1:54885961-54885983 CCCATGAGGCATAAGACCTGGGG - Intronic
915597145 1:156902239-156902261 GCCCTGGGGCCTGGGACCTGGGG - Exonic
915935901 1:160090097-160090119 CCCAGTGGCCCTGTGACCTGAGG - Exonic
922695721 1:227729923-227729945 TCCTTGGGGAGTGGGACCTGTGG - Intronic
924166199 1:241285828-241285850 AAGATGGGGCGTGTAACCTGAGG - Intronic
924561191 1:245156925-245156947 CCCGTGGGCCGTGAGGCCTGTGG - Intronic
1062898201 10:1121096-1121118 CCCATGGGACCTGTGGGCTGAGG + Intronic
1064050291 10:12054076-12054098 CCAATGGGGCAGATGACCTGAGG - Intergenic
1067776699 10:49169591-49169613 CACATGGGGCTTGTGATCTGTGG - Intronic
1069807014 10:71132469-71132491 CCCTGGGGGCTTGTGGCCTGGGG - Intergenic
1070813222 10:79308700-79308722 CCCATGGGGCTTGTGATTTCTGG + Intronic
1073766547 10:106688808-106688830 CCCTTGGGCAGTGTGACCTTAGG - Intronic
1076593627 10:131609424-131609446 CCCATGTGGCCTGTGCCCGGAGG - Intergenic
1076600931 10:131656545-131656567 CCCATGTGGTGTGTGACACGTGG - Intergenic
1077062605 11:624480-624502 CCCAAGGGAGGTGTGGCCTGAGG + Intronic
1077419924 11:2445271-2445293 CGCAGGGGGCGCGGGACCTGGGG - Exonic
1079079237 11:17402515-17402537 CCCTTGGGCCTTGGGACCTGAGG + Intronic
1081665608 11:44915417-44915439 ACCATGGGCATTGTGACCTGGGG + Intronic
1083312261 11:61790134-61790156 CTCATGAGCTGTGTGACCTGGGG - Intronic
1086304437 11:85464630-85464652 CCCAGGGGTCATGTGACCAGAGG - Intronic
1091001155 11:131911425-131911447 CCCGGGGGGCGTGTGCCGTGCGG + Intronic
1091290842 11:134438874-134438896 CCCCTGGGCAGTGCGACCTGTGG + Intergenic
1095049656 12:37544627-37544649 CCCATGGGGCTTTTGTCCTTGGG - Intergenic
1096464883 12:51842785-51842807 CACATAGGGCATGTGAGCTGGGG - Intergenic
1096974957 12:55694639-55694661 CCCATGTTGAGTGTGAGCTGGGG - Exonic
1096993278 12:55822103-55822125 CCCATTGGGCATCTGCCCTGGGG + Exonic
1105255955 13:18744268-18744290 CCCATGGTGTCTGTGGCCTGAGG - Intergenic
1108095212 13:46894140-46894162 CCCACGGGGCGTGGGGCATGGGG - Intronic
1119757317 14:77128254-77128276 TCCATGGGGAGCGTGGCCTGAGG + Intronic
1121588230 14:95078690-95078712 ACCAAGGGGTGTGGGACCTGGGG - Intergenic
1122009864 14:98737165-98737187 CCCAAGGCTCGTGTGAGCTGCGG - Intergenic
1122142781 14:99672815-99672837 CCCATGGGGCCTGGGACTGGGGG + Intronic
1122631856 14:103110918-103110940 CCCATGGAGTGTGTGTCCGGGGG + Intergenic
1122813850 14:104302552-104302574 CCCATGAGCTGTGTGACCTTGGG + Intergenic
1122930274 14:104929998-104930020 CCCATGGGGCGGCTCACCAGGGG + Exonic
1123037895 14:105478787-105478809 TCGATGGGGCCGGTGACCTGCGG - Exonic
1125667164 15:41440420-41440442 CCAAGGGGGCGGGTCACCTGAGG - Intronic
1126317560 15:47386669-47386691 CCTATGGGAAGTGTGACCTCTGG + Intronic
1126699677 15:51356653-51356675 CCCATCAGCCGTGTGACCTTCGG + Intronic
1129035531 15:72646444-72646466 CCCAGGGGGCAGGAGACCTGAGG - Intergenic
1129214353 15:74090772-74090794 CCCAGGGGGCAGGAGACCTGAGG + Intergenic
1129731495 15:77935122-77935144 CCCAGGGGGCAGGAGACCTGAGG + Intergenic
1134032487 16:11003524-11003546 CTCATGGGATGGGTGACCTGGGG + Intronic
1135382772 16:22008232-22008254 CCCATGGGGCGGGAGGCGTGAGG + Exonic
1137395673 16:48114952-48114974 CCCCTGGGGTGTGATACCTGGGG + Intronic
1138456739 16:57125358-57125380 ACCAAGGGGCCTGGGACCTGGGG - Intronic
1138651752 16:58464705-58464727 CCCATGGGGTCTCTGACCAGCGG + Intronic
1141315484 16:82958716-82958738 ACAATGGAGCCTGTGACCTGCGG - Intronic
1142093752 16:88228363-88228385 GCCCTGGGGTGTGTGTCCTGGGG + Intergenic
1144734113 17:17545329-17545351 ACCATGGGGCATGTGACCTCCGG - Intronic
1151383803 17:73743135-73743157 CCCATGGGGGCTGTAACCGGAGG - Intergenic
1151701437 17:75744590-75744612 CCCTTGGGGAGTCTGGCCTGGGG - Intronic
1152562000 17:81083255-81083277 CCTCTGGGGCGTGGGACCGGCGG + Intronic
1152911271 17:83006104-83006126 CCGCTGGGACTTGTGACCTGGGG - Intronic
1153961717 18:10145683-10145705 GCCCTGGGGCCTGAGACCTGGGG + Intergenic
1160222276 18:76985919-76985941 CTCATGGGCCGTGTGACCGCAGG + Intronic
1160226220 18:77013380-77013402 CCCATGGGGCGTGTACCATTTGG - Exonic
1160622581 18:80181236-80181258 CCCCAGGGGCGTGTGACCTGGGG - Intronic
1161029204 19:2050267-2050289 CCCAGGGGGCCTGTGCCGTGGGG - Intronic
1161847647 19:6720800-6720822 TCCATGGGGTGAGTAACCTGAGG + Intronic
1163285612 19:16345350-16345372 CCCCTGGAGAGTGTGACCTTGGG - Intergenic
1163617441 19:18337969-18337991 GCCACTGAGCGTGTGACCTGGGG + Intergenic
1163617806 19:18340229-18340251 CCCTTGAGGCGAGTGACCTCGGG + Intergenic
1164867476 19:31616842-31616864 CCCCTGGGACGTCTGATCTGGGG - Intergenic
926678092 2:15643241-15643263 ACCATGGGGAATGTGAGCTGGGG + Intergenic
927644863 2:24871315-24871337 CCCCTGGGCCCTGTGACCTGTGG - Intronic
927707013 2:25302618-25302640 CCCATGGGGCGTGTGCCCTTGGG - Intronic
929978318 2:46656017-46656039 CCAATGAGCTGTGTGACCTGGGG + Intergenic
931463990 2:62471086-62471108 CCCTTGGGCCCCGTGACCTGAGG + Intergenic
934490965 2:94761897-94761919 CCCATGGTGTCTGTGGCCTGAGG - Intergenic
935112796 2:100107539-100107561 CCTATAGTGCTTGTGACCTGAGG + Intronic
935277985 2:101492240-101492262 CCCCTGGGTCGTGAGCCCTGAGG - Intergenic
935306282 2:101740033-101740055 TCCCTGGGGCCTATGACCTGTGG - Intronic
935638845 2:105271561-105271583 CTCGTGGGCTGTGTGACCTGTGG + Intronic
937291676 2:120785647-120785669 CCCATGGAGAGGGTGACCTCAGG + Intronic
938329867 2:130441914-130441936 CCCATGGTGCCTCTGGCCTGAGG - Intergenic
938337676 2:130513690-130513712 GCCTTGGGGCTTGTGCCCTGTGG - Intergenic
938352163 2:130607045-130607067 GCCTTGGGGCTTGTGCCCTGTGG + Intergenic
938360078 2:130679589-130679611 CCCATGGTGCCTCTGGCCTGAGG + Intergenic
938758420 2:134401453-134401475 CCCAGGGTGTGTCTGACCTGAGG - Intronic
939639917 2:144627913-144627935 CCCATGTGGCGCTTGAACTGTGG + Intergenic
945407094 2:209461680-209461702 CCCAGGGGGCGGATCACCTGAGG - Intronic
947283745 2:228486316-228486338 CCTATGGGGTATGTGACCTTGGG - Intergenic
948874889 2:240820946-240820968 CCCGAGCGGCGTGTGACTTGGGG - Intergenic
1168811648 20:708699-708721 ACCCTGGGGAGTGTGACCTCAGG - Intergenic
1171880708 20:30616007-30616029 CCCATGGTGCCTGTGGCCTGAGG - Intergenic
1174068118 20:47880088-47880110 CCCATGCAGCGTGTCACCTCTGG - Intergenic
1174122962 20:48280784-48280806 CCCATGGGAAGTGAGACCAGAGG - Intergenic
1174522912 20:51145549-51145571 CCAATGGGGAATGTGAGCTGGGG + Intergenic
1175286453 20:57840028-57840050 CCACTGGGGCTTGTGAGCTGAGG + Intergenic
1175800971 20:61800830-61800852 ACCCTGGGGCGTGTAACCTCTGG + Intronic
1176302710 21:5106181-5106203 GCCATGTGGCGTGTGGCTTGTGG - Intergenic
1176841958 21:13849282-13849304 CCCGTGGTGCCTGTGGCCTGAGG - Intergenic
1176861397 21:14013274-14013296 TCCATGGGGTGTGTGAACTGGGG - Intergenic
1176935397 21:14860981-14861003 CCCATGAGGTGTGCAACCTGGGG - Intergenic
1179912851 21:44459556-44459578 CCCAAGGAGAGTGTGAACTGAGG + Exonic
1180206635 21:46265014-46265036 CCCCTGATGGGTGTGACCTGGGG - Intronic
1184818767 22:46893039-46893061 CCACTTGGGCGTTTGACCTGTGG + Intronic
1185366540 22:50439477-50439499 CCCATGGGGCGTGTGACCTGGGG - Intronic
1185414183 22:50700808-50700830 GCCATGGTGTGTGTGACCTGGGG + Intergenic
950013356 3:9739445-9739467 CCCATGTGGTGTGTGCCTTGTGG + Exonic
950461233 3:13123403-13123425 CCCATGGGGACGGTGGCCTGTGG + Intergenic
955063610 3:55515744-55515766 TCCCTGGGGCGTCTGTCCTGGGG - Intronic
958146499 3:89631459-89631481 CCCATGCTGTGTGTGACCTAGGG + Intergenic
961528866 3:127527203-127527225 CCCAGGAGGGGTGTGACCTTGGG - Intergenic
962378335 3:134877000-134877022 CCCATGGGGTGTAGGACCTGGGG - Intronic
968349941 3:198045838-198045860 CCCATGGTGTCTGTGGCCTGAGG - Intergenic
968684173 4:1945384-1945406 CCCATGGTGTGTGTGTCCAGAGG + Intronic
968884480 4:3320266-3320288 TCCTTGGGGCGGGTGACATGGGG + Intronic
969373152 4:6746870-6746892 CCCATGGGTAGCATGACCTGGGG - Intergenic
972243291 4:37217501-37217523 CCCCTGAGGCATGTAACCTGGGG + Intergenic
977203178 4:94140470-94140492 CCCATGGGCAATGTGACCTCTGG + Intergenic
978954195 4:114595345-114595367 CCAATGCGGGGTGTGACATGGGG - Intergenic
983992092 4:174131641-174131663 CCCAAGGTGTGAGTGACCTGAGG + Intergenic
987105610 5:14635489-14635511 CACATGGGGTGTGTGTGCTGTGG - Intergenic
989111192 5:37907936-37907958 TCCATGGGACGTGTGACATCTGG - Intergenic
989417339 5:41195142-41195164 CCCATAGGCTGTGTGACGTGTGG - Intronic
996824406 5:127665021-127665043 CACATGGACCATGTGACCTGGGG - Intergenic
1000214008 5:159137628-159137650 CCCATTGGGCATGTGAAATGTGG + Intergenic
1001497414 5:172199109-172199131 TCCATGGAGTGTGTGAGCTGGGG + Intronic
1002861680 6:1085060-1085082 CCCAGGGGACGTGTCACCAGAGG - Intergenic
1006130963 6:31869297-31869319 CCTAAGGAGCGAGTGACCTGTGG - Intronic
1007150507 6:39685752-39685774 CCCATGTGGGGTTGGACCTGTGG - Intronic
1007415538 6:41689268-41689290 TCCATGGGGCAAGTGATCTGGGG - Intronic
1010188653 6:73171244-73171266 CCCATAGGGTTTGTGACTTGAGG - Intronic
1020035869 7:4962805-4962827 CCCATAGGCCCTGTGACCTTGGG - Intergenic
1022822325 7:33973837-33973859 CCCATGGCCTGTGTGACATGGGG + Intronic
1026796172 7:73367339-73367361 CCCCTGAGGCTTGTGAACTGTGG - Intergenic
1027055780 7:75048460-75048482 CTCAGGGGCCGTGAGACCTGGGG + Intronic
1028941495 7:96526772-96526794 CCCCTGGGGCTTGTGTTCTGTGG + Intronic
1029114101 7:98228624-98228646 CCCGTGGGGCATGTGGGCTGCGG + Intronic
1029114317 7:98229491-98229513 CCCTTGGGGTCTGGGACCTGGGG + Intronic
1034125322 7:148666438-148666460 CCCATGTGGCCTGTGGGCTGTGG - Intergenic
1035406535 7:158602297-158602319 CCCATGGGGAGTGAGCACTGGGG - Intergenic
1037834756 8:22209386-22209408 GCCATGGGGCCTGGCACCTGCGG + Intronic
1043512851 8:80966771-80966793 CTGATGTGGCGTGTGATCTGCGG + Intergenic
1046029717 8:108768894-108768916 CCCATGGACCCTTTGACCTGAGG + Intronic
1048408406 8:134146331-134146353 CCCACGGGGCATTTGTCCTGAGG - Intergenic
1049573489 8:143380184-143380206 CCCATGGGTGGAGTGCCCTGGGG + Intronic
1049844165 8:144792110-144792132 GCCATGGGCCGTGTGATCCGTGG - Exonic
1053184334 9:36002701-36002723 CCCAGGGGGAGTGTGTCTTGAGG - Intergenic
1053495170 9:38544227-38544249 CCCATGGTGTCTGTGGCCTGAGG - Intronic
1053667025 9:40323792-40323814 CCCATGGTGTCTGTGGCCTGAGG + Intronic
1053916617 9:42948901-42948923 CCCATGGTGTCTGTGGCCTGAGG + Intergenic
1054378172 9:64463820-64463842 CCCATGGTGTCTGTGGCCTGAGG + Intergenic
1054517585 9:66052491-66052513 CCCATGGTGTCTGTGGCCTGAGG - Intergenic
1057128468 9:92637529-92637551 CCCATGGGGCCTTTGGACTGCGG - Intronic
1057675074 9:97131591-97131613 CCCATGGTGTCTGTGGCCTGAGG - Intergenic
1060111716 9:120911319-120911341 CCCCTGGGAGGTGTTACCTGGGG + Exonic
1060725371 9:126002656-126002678 CCCATGGGGCAGGTGCTCTGAGG - Intergenic
1062149950 9:135012979-135013001 ACCAAGGGGCAGGTGACCTGAGG - Intergenic
1062599525 9:137313620-137313642 CCCATGGGGGGTGTGGCAGGTGG + Intronic
1199004185 X:142675581-142675603 CCCATAGGGACTGTGCCCTGAGG - Intergenic