ID: 1185369520

View in Genome Browser
Species Human (GRCh38)
Location 22:50454611-50454633
Sequence CTGAACCCCCAGAGGAAGAA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 324}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185369520_1185369538 19 Left 1185369520 22:50454611-50454633 CCGTTCTTCCTCTGGGGGTTCAG 0: 1
1: 0
2: 3
3: 31
4: 324
Right 1185369538 22:50454653-50454675 CCAGTCATAGGGAGGGCCCTCGG 0: 3
1: 0
2: 1
3: 19
4: 129
1185369520_1185369532 8 Left 1185369520 22:50454611-50454633 CCGTTCTTCCTCTGGGGGTTCAG 0: 1
1: 0
2: 3
3: 31
4: 324
Right 1185369532 22:50454642-50454664 TGGGCCAGTTCCCAGTCATAGGG 0: 2
1: 0
2: 1
3: 10
4: 106
1185369520_1185369535 12 Left 1185369520 22:50454611-50454633 CCGTTCTTCCTCTGGGGGTTCAG 0: 1
1: 0
2: 3
3: 31
4: 324
Right 1185369535 22:50454646-50454668 CCAGTTCCCAGTCATAGGGAGGG 0: 3
1: 0
2: 2
3: 10
4: 143
1185369520_1185369533 11 Left 1185369520 22:50454611-50454633 CCGTTCTTCCTCTGGGGGTTCAG 0: 1
1: 0
2: 3
3: 31
4: 324
Right 1185369533 22:50454645-50454667 GCCAGTTCCCAGTCATAGGGAGG 0: 3
1: 0
2: 1
3: 15
4: 309
1185369520_1185369531 7 Left 1185369520 22:50454611-50454633 CCGTTCTTCCTCTGGGGGTTCAG 0: 1
1: 0
2: 3
3: 31
4: 324
Right 1185369531 22:50454641-50454663 CTGGGCCAGTTCCCAGTCATAGG 0: 2
1: 0
2: 2
3: 15
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185369520 Original CRISPR CTGAACCCCCAGAGGAAGAA CGG (reversed) Exonic
901219344 1:7574329-7574351 CTGAACCCACCCAGGAAGGAAGG + Intronic
901828787 1:11879671-11879693 CTGGGCCCCTGGAGGAAGAACGG + Intergenic
902548644 1:17206237-17206259 CTGAGTCCCAAGAGGGAGAAAGG - Intronic
903050052 1:20593968-20593990 CTGGACACCCAGAGGAAGCCTGG + Intronic
903360530 1:22774190-22774212 CAGGAAACCCAGAGGAAGAAGGG - Intronic
904360924 1:29971287-29971309 CTGACCCTGCAGAGGAGGAAGGG - Intergenic
904494387 1:30878462-30878484 CTGGATCCCCAGAACAAGAAGGG - Intronic
904605267 1:31694721-31694743 CTGGACCCCCATAGGAAGGCTGG + Intronic
904758044 1:32780121-32780143 CTGAAACCCCAGAAGATGAGAGG - Exonic
904792127 1:33030581-33030603 ATGAATCCTCAGCGGAAGAAGGG - Intronic
906059789 1:42941056-42941078 GCAAACCCTCAGAGGAAGAATGG - Intronic
907337521 1:53710126-53710148 CTGAACCCCCAGAGAATCCAGGG + Intronic
907750400 1:57257728-57257750 CAGAGCCCCCAGAGGGAGTATGG - Intronic
908047018 1:60181875-60181897 CTGAAGTCCCAGAAAAAGAAAGG - Intergenic
909791069 1:79679397-79679419 CTGAATCACAAGAAGAAGAATGG - Intergenic
910195981 1:84640112-84640134 CTGAATTCCAAGAGGAAGGAGGG + Intergenic
911973086 1:104461630-104461652 CTGGACCCCCAATGGAAGACAGG - Intergenic
914346950 1:146808084-146808106 CTGGACACCCAGAGGAATAAGGG + Intergenic
915747300 1:158173232-158173254 CTGAAATCTCAAAGGAAGAATGG + Intergenic
916009731 1:160693835-160693857 CTGAAAACCCTGAGGAACAAAGG - Intronic
916196851 1:162232365-162232387 CTGATCCCCAAGAGGAAAAAAGG - Intronic
917078120 1:171227313-171227335 ATGAAGCCCTAGAGGAAGAGTGG - Intergenic
919586619 1:199447862-199447884 CTCCACCCACTGAGGAAGAATGG + Intergenic
919690648 1:200525626-200525648 CTAAATCCTCAGAGTAAGAATGG - Intergenic
920051702 1:203168277-203168299 CAGAACCACCAGGGGAAGGAAGG + Intronic
920055483 1:203187756-203187778 CAGAACTCCAAGAGGCAGAATGG + Intergenic
920363904 1:205438148-205438170 CTGAAGCCCAAGAGGGAAAATGG + Intronic
920629637 1:207639004-207639026 CTGAAAACCCTGAGGAACAAAGG + Intronic
922455146 1:225768329-225768351 TTGCAGCCCCAGGGGAAGAAGGG + Intergenic
923017774 1:230140134-230140156 CCGACCCCCAAGGGGAAGAAAGG - Intronic
923412181 1:233721542-233721564 ATGAACCTTCAGAGGATGAAGGG - Intergenic
1063530927 10:6830626-6830648 CTGAAAACCCTGAGGAACAAAGG + Intergenic
1063972425 10:11390494-11390516 ATGAACCTCCAGAGGGTGAAGGG + Intergenic
1064564325 10:16624571-16624593 CTGCAACCCCAGAGCAGGAAGGG + Intronic
1064749139 10:18508369-18508391 CTGAATCCACAGAGGAAGGGAGG + Intronic
1064936922 10:20688493-20688515 CTCACCCCCCAGTGGAATAATGG + Intergenic
1066731473 10:38440766-38440788 CTGAACTCCAGGAGGAAGAGGGG - Intergenic
1067297369 10:44982507-44982529 GTGGACCCCCACAGGAAGAAGGG + Exonic
1067679098 10:48416163-48416185 CTGAACCCCCAAGGGATGAAAGG - Intronic
1068175197 10:53448115-53448137 CAGAAGCCTAAGAGGAAGAATGG - Intergenic
1069610613 10:69770154-69770176 CACAACCCCCAGAGAGAGAATGG + Intergenic
1069773556 10:70914143-70914165 TTGCTCCCCCAGAGGAAGCAGGG + Intergenic
1070920633 10:80183383-80183405 CTGAGATCCCAGAGGAAGGAAGG - Intronic
1072597142 10:96884514-96884536 CTGCACCCCCAGGTGCAGAAAGG - Intronic
1073440119 10:103547567-103547589 CAGAATCCCCAGAGGAAGGAGGG + Intronic
1074249972 10:111735268-111735290 CAGAACCTCCAGAAGAAGCATGG - Intergenic
1075095282 10:119467201-119467223 CTGTTCTCCCAGCGGAAGAAAGG - Intergenic
1075646931 10:124102800-124102822 CTGAAGCCACAGGGGAAGGATGG + Intergenic
1075679643 10:124323075-124323097 GTGAACTCCCAGAGGGAGAGGGG + Intergenic
1078349173 11:10578725-10578747 ATGAAACCCCAGGGGAAGTAAGG - Intronic
1078399337 11:11010432-11010454 CTGAGCCCCCAAGGGAAGAAAGG - Intergenic
1078407118 11:11079974-11079996 CTAGACCACTAGAGGAAGAAAGG - Intergenic
1078668740 11:13346711-13346733 CTGGACCGCCAGAGAAAGCAGGG - Intronic
1079251498 11:18791150-18791172 CTGAAGCCCCTGAGGGAGATTGG - Intronic
1079289051 11:19169869-19169891 CTAAATCTGCAGAGGAAGAAAGG - Intronic
1081503661 11:43692457-43692479 CTGATACCACAGATGAAGAAAGG - Intronic
1081626683 11:44660065-44660087 CTGATTCCCCAGAGCTAGAAGGG - Intergenic
1082262237 11:50085492-50085514 CTGAACTCCAGGAGGAAGAGAGG + Intergenic
1082273094 11:50193179-50193201 CTGAAGGATCAGAGGAAGAAAGG + Intergenic
1083314480 11:61805979-61806001 TCCAACCCCCAGAGGAACAAAGG - Intronic
1083394385 11:62379796-62379818 CTGAAAACCCTGAGGAACAAAGG + Intronic
1083541608 11:63515484-63515506 CTCAGCCCCCAGGGGAAGGATGG - Intronic
1083691748 11:64413498-64413520 CTGAGCAACCAGAGGAAGGATGG + Intergenic
1084245000 11:67850962-67850984 CGGTCCCCCGAGAGGAAGAATGG - Intergenic
1084483955 11:69437369-69437391 TTCATCCCCCAGGGGAAGAAAGG + Intergenic
1084670388 11:70603365-70603387 CTGCTGCCCCAGAGGAGGAAGGG - Intronic
1084827689 11:71743616-71743638 CGGTCCCCCGAGAGGAAGAATGG + Intergenic
1086160587 11:83718026-83718048 ATGGACCCCCAGAGGGAGTACGG - Intronic
1086259638 11:84923600-84923622 TTAAACCTCCAAAGGAAGAAGGG - Intronic
1089662471 11:119994384-119994406 CTTAACCCCCAGAATCAGAATGG + Intergenic
1090155698 11:124436288-124436310 CTGAAACCCAAGAGGAAGACAGG + Intergenic
1090534280 11:127623816-127623838 CTGAAGCCCTGGAGGGAGAAAGG + Intergenic
1091284794 11:134402559-134402581 CTGACACCCCAGAGGAGGGAGGG - Intronic
1092658727 12:10716133-10716155 CTGAATCTCCGGAGGAGGAAAGG + Intronic
1093044054 12:14421421-14421443 CAGCACCCTCAGAGGGAGAATGG - Intronic
1093081806 12:14821360-14821382 CAGAGCCCCCAGAGGGAGAGAGG - Intronic
1093575871 12:20729438-20729460 CCAAACCCTCAAAGGAAGAATGG - Intronic
1093881200 12:24406186-24406208 CTGAAGCCCAAGAGGATCAACGG + Intergenic
1094131933 12:27083903-27083925 GTGAAGCCCCAGAGTAAGTAGGG + Intergenic
1094734169 12:33214934-33214956 CTGAAACCACAGAAGTAGAAAGG + Intergenic
1094874566 12:34626423-34626445 CTGAAAACCCTGAGGAACAAAGG + Intergenic
1095599964 12:44002769-44002791 CTGAACCCACAGTGGTAGGAAGG + Intronic
1096088219 12:48880648-48880670 GCGAACCCTTAGAGGAAGAAGGG + Intergenic
1100715584 12:97302004-97302026 CTGAAAGCCCAGAGGAGGCAGGG - Intergenic
1101522100 12:105493571-105493593 CACAACCCCCAAAGCAAGAATGG + Intergenic
1102722856 12:115033098-115033120 CTGCACCCCCAGAGAAAGTGAGG + Intergenic
1104201383 12:126593119-126593141 CTGAACCCCCAGGGGAAGACTGG + Intergenic
1104450211 12:128863005-128863027 GTGAACCCTCAGAGGGGGAAAGG - Intronic
1104528466 12:129547072-129547094 CTAGAGCCCCAGAGGAAGCAAGG - Intronic
1104613750 12:130251695-130251717 CTCTTCCCCCAGAGGGAGAACGG - Intergenic
1105349758 13:19604408-19604430 CTGCACCCACAGAGGACCAAAGG - Intergenic
1108173091 13:47763829-47763851 ATGAACCTACAGAAGAAGAATGG + Intergenic
1108736610 13:53290521-53290543 CTAACCGCCCAGAGGAAAAAAGG - Intergenic
1109442880 13:62398058-62398080 CTGAATTCCCAAAGGAAGGAGGG - Intergenic
1111741194 13:92207548-92207570 CTGATCCTCCAGAGGAAGAAAGG + Intronic
1112560675 13:100510925-100510947 CTGCACCTCCAAAGGAAGGACGG + Intronic
1113811894 13:113147714-113147736 CTGGACACCCAGTGGGAGAAGGG - Intronic
1114069182 14:19094659-19094681 CTGCATCCCCAGAGTAAGATGGG + Intergenic
1114731827 14:25001042-25001064 GTGAACCTTCAGAGGAAAAAGGG + Intronic
1114940671 14:27606603-27606625 CTGAACTCCAAAAGGGAGAAGGG - Intergenic
1115338951 14:32272179-32272201 CTCAGCCCCCAGATGAAGATGGG - Intergenic
1117756248 14:58977416-58977438 CTGCACCCACAGAGCTAGAATGG - Intergenic
1118180025 14:63483442-63483464 CAGAATCACAAGAGGAAGAAGGG + Intronic
1120838077 14:89058898-89058920 CTCATCACCCAAAGGAAGAAAGG - Intergenic
1121961895 14:98267819-98267841 CTGAACAAGCAAAGGAAGAAGGG - Intergenic
1122905200 14:104798366-104798388 CTGAACCTTCAGAGCAAGTAGGG - Intergenic
1202847273 14_GL000009v2_random:191056-191078 CTTATTCCCAAGAGGAAGAATGG - Intergenic
1202916738 14_GL000194v1_random:181618-181640 CTTATTCCCAAGAGGAAGAATGG - Intergenic
1202876057 14_KI270722v1_random:1579-1601 CTTATTCCCAAGAGGAAGAATGG + Intergenic
1124819413 15:33029765-33029787 GTTAAGCCCCTGAGGAAGAAGGG + Intronic
1125519526 15:40340209-40340231 CTGAGCCCCCTGAGGAGGCAGGG - Intronic
1125545556 15:40501648-40501670 ATGAATCACCAGAGGAGGAAAGG - Intergenic
1125736385 15:41929295-41929317 CATATCCCCCAGAGGAAGGAGGG - Intronic
1126448192 15:48774264-48774286 CTGAACTCCCAGAAGAGGAGAGG + Intronic
1129699080 15:77757301-77757323 CTGAGCCCCCAGAACAAGAGTGG + Intronic
1131590206 15:93740581-93740603 CTGAAGCCCCATGGGTAGAATGG + Intergenic
1132367794 15:101270120-101270142 CTGAGGCCCCTGGGGAAGAAGGG - Intergenic
1132556971 16:576812-576834 CTGAAGGCCCAGAGGCAGCATGG - Intronic
1132995183 16:2819043-2819065 CTGCACCCCCAGACCAAGCAGGG - Intronic
1136271912 16:29153567-29153589 CAGAGCCCCCAGAGGGAGTACGG - Intergenic
1136271923 16:29153601-29153623 CAGAGCCCCCAGAGGGAGTACGG - Intergenic
1136271934 16:29153635-29153657 CAGAGCCCCCAGAGGGAGTACGG - Intergenic
1136271944 16:29153669-29153691 CAGAGCCCCCAGAGGGAGTACGG - Intergenic
1136271977 16:29153771-29153793 CAGAGCCCCCAGAGGGAGTACGG - Intergenic
1137036828 16:35575239-35575261 CAGGGCCCCCAGAGGAAGCAGGG + Intergenic
1138224961 16:55285212-55285234 CAGAACCCCCAGAGAAGGGAAGG + Intergenic
1139020204 16:62739338-62739360 CAGAAACTCCAGAGGAAGCAGGG - Intergenic
1139512988 16:67437842-67437864 CTGAGCCTCCAGCAGAAGAAGGG + Intergenic
1139987032 16:70907186-70907208 CTGGACACCCAGAGGAATGAGGG - Intronic
1140143750 16:72285563-72285585 CTGTAGCCCCAGAGGTAGAGCGG + Intergenic
1140351336 16:74264553-74264575 CATAACCCCCAGAAGAAGGACGG + Intergenic
1142473983 17:179369-179391 CTGAACCCACAAAGCAAGGAGGG - Intronic
1142815276 17:2420258-2420280 CGGAACCCACGGAGGATGAAAGG - Exonic
1143587871 17:7860066-7860088 CTGAAACCCAAGGGAAAGAAAGG + Exonic
1143665857 17:8359673-8359695 CTGCACCTACAGATGAAGAAGGG + Intergenic
1143840973 17:9731471-9731493 CTGAGCTTCCAGAGGAAGAATGG - Intergenic
1143956277 17:10672095-10672117 CTGAACCTCCAGAGAAAGAAAGG + Intergenic
1145006522 17:19341702-19341724 CTGAGCCCCCAGAGCCACAACGG - Intronic
1146742248 17:35297031-35297053 TGGAAGCCCCAGAGGAAGACAGG + Intergenic
1147818709 17:43228881-43228903 TGGAACCCTCTGAGGAAGAATGG - Intergenic
1147831992 17:43303583-43303605 TGGAACCCTCTGAGGAAGAATGG - Intergenic
1149115104 17:53084458-53084480 CTGTAACCCCAGATGAAAAATGG + Intergenic
1149664175 17:58354281-58354303 CTCAACCCCCAGAGGAACCAAGG + Exonic
1151341429 17:73473407-73473429 CAGGACCCTCAGAGGAAGAAGGG + Intronic
1151882314 17:76903112-76903134 CTGAACCCCCTGAGGAGGCCGGG + Intronic
1156905902 18:42351741-42351763 GTGAACCTTCAGAGGATGAAAGG - Intergenic
1159270865 18:66148392-66148414 CTGAAACCCCAGAAAAAGAGTGG - Intergenic
1159965855 18:74595751-74595773 CTAAACCCCCAAGGTAAGAAAGG + Intergenic
1161598833 19:5167752-5167774 CTGAAGAGCCAGGGGAAGAATGG + Intronic
1162189482 19:8933508-8933530 GTGAACCCCCACAATAAGAAGGG - Intronic
1162806182 19:13139051-13139073 CTGAGGCCCCAGAGGACCAAAGG - Exonic
1163920029 19:20279667-20279689 CTGAAAACCCTGAGGAACAAAGG - Intergenic
1165169253 19:33879689-33879711 CGGAACCCCCAGGGGAAGCAGGG + Intergenic
1165606839 19:37113051-37113073 CTGAAAACCCTGAGGAACAAAGG + Intronic
1165924444 19:39318587-39318609 CTGAAACCCCAGAGGACAAAGGG - Intergenic
1167172753 19:47844112-47844134 CTGAAAGGCAAGAGGAAGAATGG - Intergenic
1202674605 1_KI270710v1_random:31231-31253 CTTATTCCCAAGAGGAAGAATGG - Intergenic
925616561 2:5749261-5749283 CTGAACTCCCAGCAGGAGAAAGG + Intergenic
925720174 2:6820083-6820105 CTGAACACCGGGAGGAAGGAAGG + Intergenic
926704210 2:15825392-15825414 CTGACCCAGCAGAGGAAGGAAGG - Intergenic
926988179 2:18646879-18646901 CTGAAGACCCAGAGAAAGAAAGG - Intergenic
929977282 2:46647139-46647161 GTGAAGCCCCAGAGGAGAAATGG + Intergenic
931823035 2:65971724-65971746 GAGAAGCCGCAGAGGAAGAAGGG - Intergenic
932703835 2:74008547-74008569 ATCAACCCCCAGGGGAAAAAGGG - Intronic
933429226 2:82153614-82153636 CTGAGCCCTCAGAATAAGAATGG + Intergenic
933577638 2:84087691-84087713 GTGAAAGCCCTGAGGAAGAAAGG - Intergenic
933810203 2:86028311-86028333 CTGAAACCCCAAAGGCAGGATGG + Intronic
933861077 2:86468707-86468729 CTAGACCCCAAGTGGAAGAAAGG - Intronic
935345788 2:102106997-102107019 ATAAATCCCCAGAGGTAGAATGG + Intronic
935801919 2:106706322-106706344 GTGAACCTTCAGAGGAAGAATGG - Intergenic
937116333 2:119407513-119407535 CGGAGACCCTAGAGGAAGAAGGG + Intergenic
937972735 2:127563250-127563272 CTGAAACCCAAGAGGAGGAAAGG - Intronic
939508807 2:143081497-143081519 CTGATGACCCAAAGGAAGAAAGG - Intergenic
939818543 2:146927241-146927263 CCGACTTCCCAGAGGAAGAAGGG - Intergenic
939846357 2:147251220-147251242 CTGATCCCCCAGAAGGACAAAGG + Intergenic
942718453 2:178921862-178921884 CTGAACAGACAGAAGAAGAAAGG - Intronic
947230865 2:227884925-227884947 CTGATCCCCCAGTGGAAGCTTGG - Intronic
1168888180 20:1274969-1274991 GTGCAGCCCCAGAGGGAGAAGGG + Intronic
1169145973 20:3252561-3252583 CTGAAGCCCTAGAGGAAGGCTGG - Exonic
1169226999 20:3863178-3863200 CTCAGTCCCCAGAGGAAGTAAGG + Intronic
1170478914 20:16745640-16745662 GTGAAATCCCAGAGGTAGAAGGG + Intergenic
1170734348 20:19001259-19001281 CTGCACCCATGGAGGAAGAAAGG + Intergenic
1172184784 20:33024627-33024649 CTGAACCCTCACAGGAAGAGTGG - Intergenic
1172233629 20:33354215-33354237 CTCAGCCCCCAAAGGGAGAATGG + Intergenic
1172771444 20:37384658-37384680 CTTAAGCCCAAGAAGAAGAAGGG + Intronic
1172882384 20:38210566-38210588 CTGCATCCCCTGGGGAAGAAGGG - Exonic
1173495079 20:43513047-43513069 CTGAATCCCCAGAGGGAGGAGGG + Intronic
1174127395 20:48317053-48317075 CTGAAGCCACGGAGGAAGCATGG + Intergenic
1174726886 20:52871747-52871769 CTGCACCCCCAAAAGAAGAGAGG - Intergenic
1175598679 20:60255543-60255565 CCCAACCCCCAGAGGAAAGAGGG + Intergenic
1176637329 21:9258953-9258975 CTTATTCCCAAGAGGAAGAATGG + Intergenic
1177801108 21:25829898-25829920 CAGAACACCCAGAAGAAGGAAGG - Intergenic
1178601000 21:33994053-33994075 CTGTGCCCTCAGAGGAGGAAGGG - Intergenic
1180192723 21:46173784-46173806 GTGAACCCCCACAGGAAGGCAGG + Intronic
1180487655 22:15817222-15817244 CTGCATCCCCAGAGTAAGATGGG + Intergenic
1181235328 22:21445001-21445023 CTGAACCAGCAGAGGACCAAGGG + Exonic
1181437933 22:22921198-22921220 CTTCACCCCCAGAGGGAGAGGGG - Intergenic
1183068397 22:35379558-35379580 GGGAACCTTCAGAGGAAGAAGGG + Intergenic
1183238472 22:36638065-36638087 ATGAACCCACAGAGGAGTAAAGG - Intronic
1183724087 22:39578808-39578830 CTGGACCCCAAGGGAAAGAACGG - Intronic
1184335724 22:43851990-43852012 CTGAACTCCCAGAGCAGGAGAGG - Intronic
1184634616 22:45817154-45817176 CCGCCCCTCCAGAGGAAGAAAGG - Intronic
1184999837 22:48238617-48238639 CTGAAGCCTGAGAGGGAGAATGG + Intergenic
1185341399 22:50292918-50292940 CTGAACCCCCAGTGCAGGGAGGG - Intronic
1185369520 22:50454611-50454633 CTGAACCCCCAGAGGAAGAACGG - Exonic
949461784 3:4302550-4302572 CTGAATTCCAAAAGGAAGAAGGG + Intronic
949511228 3:4768817-4768839 CTGAACCATCAGAGGAAGGCAGG - Intronic
950030759 3:9851583-9851605 CTGAAAACCCTGAGGAACAAAGG + Intronic
950187179 3:10952381-10952403 ATGAACCCTCAGAGGAAGGAGGG + Intergenic
950705366 3:14776218-14776240 CTGAAACACAAGAGGAAGGAGGG + Intergenic
950736466 3:15012892-15012914 GAGAACTCCCAGAGGAATAAGGG + Intronic
953203767 3:40801647-40801669 CTGAAACCGCAGGGGATGAAAGG - Intergenic
953645885 3:44754336-44754358 CTCAGCCCCCAGATGAAGATGGG - Exonic
953798178 3:46001463-46001485 CTCAAGCCCCAGAGGAACCAAGG + Intergenic
955396985 3:58564556-58564578 ATGAAGCCCCAGAGGTAGAAGGG - Intronic
959221263 3:103523335-103523357 TTTAACCCCCATATGAAGAATGG - Intergenic
959780684 3:110229512-110229534 CAGAAGATCCAGAGGAAGAAGGG - Intergenic
960697261 3:120408244-120408266 CAGAGCCCTTAGAGGAAGAATGG - Intronic
961893115 3:130146701-130146723 CGGTCCCCCGAGAGGAAGAATGG - Intergenic
962028421 3:131573153-131573175 CTGAAACCCTACAGGAGGAAGGG + Intronic
963001632 3:140687156-140687178 CTGAACCACAAGAGGGACAAAGG + Intronic
963080424 3:141387593-141387615 TTGAACTCTCAGAGGAGGAAGGG + Intronic
965247482 3:166292166-166292188 CTGAACATCCAGAGGAACAGAGG - Intergenic
966126623 3:176584784-176584806 CTGAAGCAACAGAGGAAGAATGG + Intergenic
967796237 3:193601844-193601866 CTGAAACCCCAAGGGAAGAATGG - Intronic
967863245 3:194169366-194169388 CTGAACCCACAGAAAGAGAATGG - Intergenic
1202749565 3_GL000221v1_random:146066-146088 CTTATTCCCAAGAGGAAGAATGG - Intergenic
969327859 4:6454086-6454108 CTGAACAGTCACAGGAAGAACGG - Intronic
969346145 4:6571322-6571344 CTGAACCATCAGAGGAGGTAGGG + Intergenic
969707390 4:8819227-8819249 CTGTAGCCCAAGAGGGAGAAGGG + Intergenic
969749645 4:9100436-9100458 CCGTCCCCCCAGAGGAGGAATGG + Intergenic
970278979 4:14433258-14433280 CTCAACCGCCAGAAGAATAAAGG - Intergenic
971338876 4:25749507-25749529 CAAACCCCCCAGTGGAAGAAGGG - Intronic
972712599 4:41612624-41612646 CTGAAACTCCAGCAGAAGAAAGG - Intronic
972766198 4:42153609-42153631 GTGAACCCCCAGAAGAAAATGGG - Intergenic
974237099 4:59196102-59196124 CTGACACCTCAGAGGAAGAGTGG + Intergenic
975735093 4:77373068-77373090 CTCAATCCCCAGAGTAAGGAGGG + Intronic
979257855 4:118623376-118623398 CTGAACTCCAGGAGGAAGAGGGG - Intergenic
979330494 4:119417186-119417208 CTGAACTCCAGGAGGAAGAGGGG + Intergenic
979585520 4:122410890-122410912 CAGAACTCTCTGAGGAAGAAGGG + Intronic
979797470 4:124864119-124864141 GTGAACCTCCAGAGGATGGAGGG + Intergenic
980564893 4:134526909-134526931 CTGAATCTCCAAAGGAAGAGTGG - Intergenic
980710256 4:136557205-136557227 CTGTATGCCCACAGGAAGAAGGG - Intergenic
981934779 4:150227969-150227991 CAAAACCCCCAAAGGAAGCATGG - Intronic
981949183 4:150385583-150385605 ATGAACAGACAGAGGAAGAAGGG + Intronic
983215496 4:164998663-164998685 CTGAAAACCCTGAGGAACAAAGG - Intergenic
983705298 4:170650834-170650856 CAGAACTCCGAGAGGATGAATGG - Intergenic
984264997 4:177487739-177487761 CTGAACCGACAAAGGAACAAGGG - Intergenic
1202752221 4_GL000008v2_random:17373-17395 CTTATTCCCAAGAGGAAGAATGG + Intergenic
985734035 5:1566878-1566900 CTAGACCCCCACTGGAAGAAAGG - Intergenic
985779994 5:1865558-1865580 CGGAAGCCCCAGAGGAGGAGAGG + Intergenic
986029264 5:3880338-3880360 CTGAGCCCCAAGAGAAAGAATGG + Intergenic
986498174 5:8368431-8368453 CTGAACTGCCAGAGGAGAAAAGG + Intergenic
986736005 5:10667750-10667772 CTGAGGCCCCAGAGGGAGCATGG - Intergenic
989346063 5:40430695-40430717 ATGAACAACCAAAGGAAGAAGGG - Intergenic
992261899 5:74978963-74978985 GTGAACCTTCAGAGGATGAAGGG + Intergenic
992939416 5:81749566-81749588 CTGAACCCCCTCAGAAAGACAGG + Intronic
994012972 5:94929158-94929180 ATGTACCTACAGAGGAAGAAAGG - Intronic
995905950 5:117123282-117123304 CTGAGCTCCCAGAGAAGGAAAGG - Intergenic
997643785 5:135466957-135466979 GGGAGCCCCCAGAGGAAGCAGGG + Intergenic
998383577 5:141742942-141742964 CTGAGCTCCCTGAGGAATAAGGG + Intergenic
998471947 5:142390342-142390364 CAGAGCCCCCAGAGGAAGTGAGG - Intergenic
998787874 5:145731827-145731849 CTGAACCCTCAGGAGTAGAAGGG + Intronic
999320909 5:150614476-150614498 CTGACCCCTCAGAGGGAGCAGGG + Intronic
999446686 5:151646022-151646044 CTGAAGCAGCAGAGGATGAATGG + Intergenic
1002022933 5:176376391-176376413 CTGAAACCCCAAAGGAAGAGTGG - Exonic
1002436368 5:179234352-179234374 CTGCACCCCCACAGGAAGTGGGG + Intronic
1002636125 5:180609646-180609668 CAGAAACCCCAGTGGAAGGACGG - Intronic
1002701426 5:181127817-181127839 CAGATCCCCCAGCAGAAGAAGGG + Intergenic
1003425385 6:5995257-5995279 CAGAACCCCCAGAGAAGAAAAGG - Intergenic
1004887780 6:20068532-20068554 CTGAGCGCCCAAAGGAAGAGGGG + Intergenic
1005335622 6:24793297-24793319 CTCACTCCCCAGAAGAAGAAGGG - Intergenic
1005893943 6:30162533-30162555 CTGATCACCCAGTGGGAGAATGG + Intergenic
1006271380 6:32969316-32969338 CTGTACCCCCAGGGGACGAATGG - Intronic
1006447918 6:34090338-34090360 TTGAAGCCACAGAGGAGGAAAGG + Intronic
1006653437 6:35569881-35569903 CTGATCCCTCAGTGGGAGAAGGG + Intergenic
1009741169 6:67747960-67747982 CTGAACCATCAGACAAAGAAGGG + Intergenic
1010996685 6:82541334-82541356 CTCAACCCCAAGAGAAAAAATGG + Intergenic
1011424591 6:87212970-87212992 GTGAACCTTCAGAGGATGAAGGG - Intronic
1013179425 6:107705855-107705877 CTGAACCCTGAGATGAAGCAGGG - Intronic
1013490814 6:110644750-110644772 CTAAAACACCAGAGGAAGGAGGG - Intronic
1013491208 6:110647342-110647364 CTAAAACACCAGAGGAAGGAGGG - Intronic
1013990819 6:116252566-116252588 ATGAAGGCCCAGAGGAAGAATGG + Exonic
1015803882 6:137089501-137089523 CTCACTCCCAAGAGGAAGAAAGG + Intergenic
1016233621 6:141835515-141835537 GTGAACCTTCAGAGGAGGAAGGG - Intergenic
1016326374 6:142907226-142907248 CTGAACTCCCATAGAAATAATGG - Intronic
1017166596 6:151413647-151413669 CTGAAGATCCAGAGGAGGAAAGG - Intronic
1017237427 6:152131551-152131573 CTGAACACAAAGAGGATGAAAGG - Intronic
1017590972 6:155977633-155977655 CTGAAACAGTAGAGGAAGAAAGG + Intergenic
1018489032 6:164272768-164272790 CTCAAGGCCCAGAGGAAGCAAGG - Intergenic
1018795746 6:167184376-167184398 CTGAACACCCAGAGGAAAGGGGG - Intronic
1018820569 6:167370688-167370710 CTGAACACCCAGAGGAAAGGGGG + Intronic
1019128351 6:169856693-169856715 CTCAACTCCCAGATGAAGAGCGG + Intergenic
1022109409 7:27219428-27219450 AGGAACCCCCAGAAGAGGAAAGG + Intergenic
1023058590 7:36309251-36309273 CAGCACCCCCAGGGGAGGAAGGG - Intergenic
1023192427 7:37597085-37597107 CTGGGCCCCTAGAGGATGAAAGG + Intergenic
1023399844 7:39784662-39784684 CTGAACTCCAGGAGGAAGAGGGG - Intergenic
1023601355 7:41884621-41884643 CAGAAGCCCCAGAGGAAGAGGGG + Intergenic
1023801471 7:43838789-43838811 CAGAACCCCCAGTAGAGGAAGGG - Intergenic
1024072781 7:45800446-45800468 CTGAACTCCAGGAGGAAGAGGGG - Intergenic
1024125518 7:46290782-46290804 CTGAACCACCACTGGAAGAAAGG - Intergenic
1024623448 7:51183813-51183835 CGGAACACCCACAGGCAGAAGGG + Intronic
1024650559 7:51399734-51399756 CTGAACTCCAGGAGGAAGAGGGG + Intergenic
1025054677 7:55755318-55755340 CTGAACTCCAGGAGGAAGAGGGG + Intergenic
1025087374 7:56034242-56034264 CTGAGCCCCCGGAGGAGGAGGGG - Intronic
1025184395 7:56845950-56845972 CTGAACTCCAGGAGGAAGAGGGG + Intergenic
1025625143 7:63214541-63214563 CTGAAGGATCAGAGGAAGAAAGG + Intergenic
1025899412 7:65731849-65731871 CTGAGCCCCCGGAGGAGGAGGGG - Intergenic
1025911242 7:65830530-65830552 CTGAACTCCAGGAGGAAGAGGGG - Intergenic
1026467089 7:70663439-70663461 GTGGAGCCCCACAGGAAGAAAGG + Intronic
1030698884 7:112617018-112617040 CTGAACCCAGAGGGGAAGCAGGG + Intergenic
1031681453 7:124680456-124680478 CTGAACATCAAGAGGAGGAAAGG + Intergenic
1032050158 7:128644135-128644157 CTGAACTCCAGGAGGAAGAGGGG - Intergenic
1032428730 7:131843293-131843315 CAGAACTCACAGAGGAATAAAGG + Intergenic
1032433211 7:131879854-131879876 GTGATCCCCCAGATGAAGGATGG + Intergenic
1032642399 7:133784482-133784504 CGGACCCCAGAGAGGAAGAAAGG - Intronic
1033392497 7:140941108-140941130 CTGAACCAACAGACTAAGAAGGG + Intergenic
1034963345 7:155375577-155375599 CTGGAGCTCCAGAGAAAGAAGGG + Intergenic
1035923950 8:3707665-3707687 CTGCACCTGCAGAGAAAGAAGGG + Intronic
1036575912 8:10027551-10027573 CTGAAGACCCAGAGGTACAAGGG + Intergenic
1037305552 8:17499419-17499441 CTGAACACACAGAGAGAGAAGGG - Intronic
1038235517 8:25749681-25749703 CAGAACAGCCAGAGGAAAAAAGG + Intergenic
1039092400 8:33846175-33846197 CTGAAGCCACAGAGAAAAAAGGG + Intergenic
1039577442 8:38634695-38634717 CTGGACCCCAAAAGGAAGGAGGG - Intergenic
1041005204 8:53491453-53491475 CAGAGCCCCCAGAGGGAGTATGG - Intergenic
1041153073 8:54956456-54956478 TTGAACCTCCAGAGAAAGTATGG - Intergenic
1045065969 8:98444564-98444586 CTGAACTGGCAGAGGTAGAATGG + Intronic
1045391425 8:101718782-101718804 CTGAATTCCAAGAGGAAGGAGGG - Intronic
1047974623 8:130117479-130117501 TTGAACCCATAGAGGAAAAATGG - Intronic
1048273254 8:133046158-133046180 CTGGAACCCCAGAGCAAGAGAGG - Intronic
1049277371 8:141726506-141726528 GGGATCCCCCAGAGGAAGAAGGG + Intergenic
1049328543 8:142037713-142037735 CTGAACCTCCTGAGGAGGACAGG + Intergenic
1050682140 9:8124133-8124155 CAGCACTCCCAGAGGAAGGAGGG - Intergenic
1051349903 9:16189259-16189281 CTCAACCCCCAGAGCAAGCTTGG - Intergenic
1051677637 9:19574043-19574065 CCCAAGTCCCAGAGGAAGAAGGG - Intronic
1052530335 9:29674931-29674953 CTGAACCGCCAGAAGAAGCAAGG + Intergenic
1053071731 9:35105975-35105997 CTGAACCCCTTGGGGAGGAAGGG - Exonic
1056097482 9:83270300-83270322 CTGAAACCAAAGAAGAAGAATGG + Intronic
1056681982 9:88727369-88727391 CTGAATTCCAAGAGGAAGGAGGG + Intergenic
1060045445 9:120336796-120336818 CTGAGGCCCCAGAGGAGGCAGGG - Intergenic
1060249609 9:121975107-121975129 AAGTACCCCCAGAGGAAGAGGGG - Intronic
1061925567 9:133804565-133804587 CTGAAGCCCTGGAGGAGGAATGG - Intronic
1062276819 9:135735322-135735344 TTGGACCCCCAGAGGGAGCAGGG + Intronic
1203718207 Un_KI270742v1:176158-176180 CTTATTCCCAAGAGGAAGAATGG - Intergenic
1203533010 Un_KI270743v1:2069-2091 CTTATTCCCAAGAGGAAGAATGG + Intergenic
1186257893 X:7742378-7742400 CTGCAGTCCCAGGGGAAGAAGGG + Intergenic
1188631840 X:32373027-32373049 ATGATCCCACAGAGAAAGAATGG - Intronic
1189254694 X:39628917-39628939 AGGAACCTGCAGAGGAAGAAAGG + Intergenic
1189664814 X:43342766-43342788 GTGAACCTTCAGAGGATGAAGGG + Intergenic
1191250733 X:58259020-58259042 AGGAACCCCCTCAGGAAGAAGGG + Intergenic
1191908089 X:66117057-66117079 CTGAGCCCCCAGAAAAAGAAAGG - Intergenic
1192173692 X:68873046-68873068 CTGAGGCCCCAGAGGGAGAAAGG - Intergenic
1192410736 X:70930465-70930487 CAGACCCCCCAGAGGGAGAGGGG + Intronic
1193393431 X:80956535-80956557 CTGAAACTCCAAGGGAAGAATGG - Intergenic
1193741304 X:85220494-85220516 CTTCACCTCAAGAGGAAGAAAGG - Intergenic
1195670620 X:107466725-107466747 CTGGACCCTCAGAGCAGGAATGG + Intergenic
1197165250 X:123369990-123370012 CTGAACACCTAGAGGATAAAAGG - Intronic
1198688550 X:139253973-139253995 TTGAAGCTCGAGAGGAAGAAGGG + Intergenic
1201172359 Y:11281006-11281028 CTTATTCCCAAGAGGAAGAATGG - Intergenic