ID: 1185371129

View in Genome Browser
Species Human (GRCh38)
Location 22:50461433-50461455
Sequence GAGAAAAGGGAGAGGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2820
Summary {0: 1, 1: 2, 2: 25, 3: 296, 4: 2496}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185371114_1185371129 6 Left 1185371114 22:50461404-50461426 CCCGTTTCCCACGGGCACCCAGA 0: 1
1: 0
2: 1
3: 13
4: 128
Right 1185371129 22:50461433-50461455 GAGAAAAGGGAGAGGGAGGCAGG 0: 1
1: 2
2: 25
3: 296
4: 2496
1185371116_1185371129 -1 Left 1185371116 22:50461411-50461433 CCCACGGGCACCCAGAACCCCCG 0: 1
1: 0
2: 1
3: 7
4: 250
Right 1185371129 22:50461433-50461455 GAGAAAAGGGAGAGGGAGGCAGG 0: 1
1: 2
2: 25
3: 296
4: 2496
1185371115_1185371129 5 Left 1185371115 22:50461405-50461427 CCGTTTCCCACGGGCACCCAGAA 0: 1
1: 0
2: 2
3: 10
4: 163
Right 1185371129 22:50461433-50461455 GAGAAAAGGGAGAGGGAGGCAGG 0: 1
1: 2
2: 25
3: 296
4: 2496
1185371117_1185371129 -2 Left 1185371117 22:50461412-50461434 CCACGGGCACCCAGAACCCCCGA 0: 1
1: 0
2: 0
3: 15
4: 122
Right 1185371129 22:50461433-50461455 GAGAAAAGGGAGAGGGAGGCAGG 0: 1
1: 2
2: 25
3: 296
4: 2496

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185371129 Original CRISPR GAGAAAAGGGAGAGGGAGGC AGG Intronic
Too many off-targets to display for this crispr