ID: 1185372895

View in Genome Browser
Species Human (GRCh38)
Location 22:50469135-50469157
Sequence GCATCCTTCGGTGGTCGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185372895_1185372904 21 Left 1185372895 22:50469135-50469157 CCAGGACGACCACCGAAGGATGC No data
Right 1185372904 22:50469179-50469201 TGGACCCCAGCAGCTCTCAGAGG No data
1185372895_1185372908 28 Left 1185372895 22:50469135-50469157 CCAGGACGACCACCGAAGGATGC No data
Right 1185372908 22:50469186-50469208 CAGCAGCTCTCAGAGGAGAGTGG No data
1185372895_1185372901 1 Left 1185372895 22:50469135-50469157 CCAGGACGACCACCGAAGGATGC No data
Right 1185372901 22:50469159-50469181 CAGATGGCTTCCTGAGCACCTGG No data
1185372895_1185372909 29 Left 1185372895 22:50469135-50469157 CCAGGACGACCACCGAAGGATGC No data
Right 1185372909 22:50469187-50469209 AGCAGCTCTCAGAGGAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185372895 Original CRISPR GCATCCTTCGGTGGTCGTCC TGG (reversed) Intronic