ID: 1185373614

View in Genome Browser
Species Human (GRCh38)
Location 22:50471941-50471963
Sequence CAGCTGAGTGTGCATCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 207}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185373614_1185373618 -2 Left 1185373614 22:50471941-50471963 CCAGGCAGATGCACACTCAGCTG 0: 1
1: 0
2: 2
3: 19
4: 207
Right 1185373618 22:50471962-50471984 TGCTGGAGATGGAAGGCCGATGG 0: 2
1: 0
2: 2
3: 23
4: 208
1185373614_1185373620 8 Left 1185373614 22:50471941-50471963 CCAGGCAGATGCACACTCAGCTG 0: 1
1: 0
2: 2
3: 19
4: 207
Right 1185373620 22:50471972-50471994 GGAAGGCCGATGGCCAGGTCAGG 0: 1
1: 0
2: 1
3: 38
4: 1095
1185373614_1185373617 -9 Left 1185373614 22:50471941-50471963 CCAGGCAGATGCACACTCAGCTG 0: 1
1: 0
2: 2
3: 19
4: 207
Right 1185373617 22:50471955-50471977 ACTCAGCTGCTGGAGATGGAAGG 0: 1
1: 0
2: 1
3: 27
4: 307
1185373614_1185373621 9 Left 1185373614 22:50471941-50471963 CCAGGCAGATGCACACTCAGCTG 0: 1
1: 0
2: 2
3: 19
4: 207
Right 1185373621 22:50471973-50471995 GAAGGCCGATGGCCAGGTCAGGG 0: 1
1: 0
2: 0
3: 26
4: 190
1185373614_1185373619 3 Left 1185373614 22:50471941-50471963 CCAGGCAGATGCACACTCAGCTG 0: 1
1: 0
2: 2
3: 19
4: 207
Right 1185373619 22:50471967-50471989 GAGATGGAAGGCCGATGGCCAGG 0: 1
1: 0
2: 0
3: 12
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185373614 Original CRISPR CAGCTGAGTGTGCATCTGCC TGG (reversed) Intronic
900759262 1:4460208-4460230 GGGCTGTGTGTGCATCTGCCGGG + Intergenic
902185700 1:14723600-14723622 CAGTTGGCTGTCCATCTGCCGGG + Intronic
903424755 1:23245497-23245519 CAGCTGAGGCTGCAAATGCCAGG + Intergenic
904684704 1:32251626-32251648 CACCTGACTGTCCATGTGCCTGG - Intronic
905853451 1:41291083-41291105 CAGATGAGGGTCCAGCTGCCAGG + Intergenic
906448331 1:45922522-45922544 CAGCTGAGTGTGCACATGCTCGG - Intronic
909197709 1:72648580-72648602 CAGCTGGGTGTGCATGCGCTCGG + Intergenic
910864762 1:91777873-91777895 CAGCTGACTGTCCAACTGCCTGG + Intronic
911657522 1:100461669-100461691 CAGCTGACTGTGTAGCTCCCAGG + Intronic
911935224 1:103961021-103961043 CAGCTGGGTGTGCACATGCATGG - Intergenic
913332135 1:117676579-117676601 CAGATGTGTGTGCATCTTTCTGG - Intergenic
913498892 1:119452602-119452624 CAGCTGAGTGGGCAAGTGCCGGG - Intergenic
913506090 1:119517272-119517294 CAGCTGAGTGGGCAAGTGCCGGG - Intergenic
913517624 1:119617918-119617940 CAGCTGAGTGGGCAAGTGCCAGG - Intergenic
916718661 1:167465938-167465960 CAGGAGTGTGTGCATGTGCCTGG - Intronic
918194378 1:182207764-182207786 TCCCTGAGTGTCCATCTGCCTGG + Intergenic
918439413 1:184551601-184551623 CAGCTGTGTCTGCATCTTTCTGG + Intronic
919297152 1:195717467-195717489 CAGAGGAGTCTGCATCTGCTGGG + Intergenic
922014481 1:221631303-221631325 CATGTGAGTGTGCATTTTCCAGG - Intergenic
922699669 1:227751350-227751372 CAGCTGAGAGTGCACCTGGCCGG - Intronic
923685011 1:236147714-236147736 CAGCTCAGCAAGCATCTGCCCGG + Intronic
923879682 1:238089998-238090020 CAGATGTGTGTGCATCTCTCTGG + Intergenic
1062858524 10:791971-791993 CAGATGTGTGCGCATCTACCTGG + Intergenic
1064015154 10:11765818-11765840 CCCCTGAGTGTGCATCAGCTTGG - Intergenic
1064274591 10:13894137-13894159 AAGCTGAGTGAGCAACTGCTGGG + Intronic
1065664835 10:28047544-28047566 CTGCTTTGTTTGCATCTGCCTGG + Intergenic
1066442035 10:35448663-35448685 CAGCAGAGTGGGCATGCGCCTGG + Intronic
1067017974 10:42771838-42771860 TAGCTGGGTGTGCACCTGCTTGG + Intergenic
1067528907 10:47056161-47056183 CAGCTGAGAGTTGATATGCCTGG - Intergenic
1068635120 10:59339780-59339802 CAGCTCAGTGTGCATAGGGCAGG + Intronic
1069565526 10:69461055-69461077 GCGCTGAGTGGGCATCTGGCTGG + Intronic
1072676219 10:97468318-97468340 CAGCTGCAGGTGCATCTGCCCGG - Exonic
1074851730 10:117444571-117444593 ATGCTGAGTCTGCCTCTGCCAGG - Intergenic
1074940980 10:118235939-118235961 CAGCTTTGTGTCCAGCTGCCTGG - Intergenic
1075090758 10:119442954-119442976 TACCTGTGTGTGCATTTGCCTGG + Intronic
1075516039 10:123109104-123109126 CAGCTGAGTAATCATCTGCGAGG + Intergenic
1076929962 10:133525622-133525644 CACCTGAGTGTGCACATCCCAGG - Intronic
1077159075 11:1104441-1104463 AGGCTGGGTGTCCATCTGCCAGG + Intergenic
1078054166 11:7993629-7993651 CAGCTGTTAGTGCATCTGTCAGG + Intronic
1079924761 11:26480242-26480264 CAGCTGACTGAGCCTCTGCTGGG + Intronic
1080228191 11:29984812-29984834 CAGCTGTGTGGGCAACTGTCAGG + Intergenic
1080746811 11:35115660-35115682 CAGCTGAGAGTGTGTCTGGCAGG - Intergenic
1082709982 11:56542828-56542850 CAGGAGAGTTTGCATCTGCTTGG - Exonic
1082717263 11:56629350-56629372 CAGAGCAGTTTGCATCTGCCTGG + Intergenic
1083603888 11:63965488-63965510 CAGCTGAGTCTGCTAGTGCCAGG - Intergenic
1084795536 11:71502268-71502290 CAGCTGAGGGTGAATTTCCCAGG + Intronic
1084930141 11:72548804-72548826 CAGCTGAGTGTGTATGTGATTGG + Intergenic
1085403878 11:76250286-76250308 CAGCTGGGTGTGCACATGCTTGG + Intergenic
1088741256 11:112769349-112769371 CAGCTGCCTCTGCAGCTGCCAGG + Intergenic
1088917038 11:114235256-114235278 CTGCTGTGTGTGCATGTGCTGGG - Intronic
1089591820 11:119546660-119546682 CAGCTGGGTGTGCACATGCTTGG + Intergenic
1091894412 12:4089500-4089522 CAGCTTGGTCTGCATCCGCCAGG - Intergenic
1093654324 12:21677351-21677373 CAGCTGCTTGTGTCTCTGCCTGG - Intronic
1096745162 12:53722040-53722062 CAGCTCCGTGTGCTCCTGCCTGG + Exonic
1097711550 12:62923030-62923052 CAACTGAGTGAGCATTTGCAGGG + Intronic
1099049829 12:77768527-77768549 CAGCTGGATGTGCATGTGCTTGG - Intergenic
1101407394 12:104440902-104440924 CCACTGAGTGTGCAGCTGACAGG - Intergenic
1102149025 12:110676048-110676070 CAGCTGGGTGTGCTGCTTCCTGG + Intronic
1102797597 12:115702348-115702370 CAGCAGAGTGAGCAGCTGACAGG + Intergenic
1104441815 12:128799394-128799416 CAGCTGAGTATGCAAATTCCAGG + Exonic
1104598075 12:130133446-130133468 CACCTGAGTGAGACTCTGCCAGG + Intergenic
1105954650 13:25269016-25269038 TAGCTGGGTGTGCATGTGCTTGG + Intronic
1106087355 13:26555539-26555561 CAGTTGGGTCTGCATCTTCCTGG - Intergenic
1106645274 13:31627582-31627604 CACGTGAGTGTGCATCTGTAGGG - Intergenic
1107170911 13:37341373-37341395 CAGCTGAGTGTGCACACACCTGG + Intergenic
1107333265 13:39324827-39324849 CATGTGTGTGTGCATGTGCCTGG - Intergenic
1110762096 13:79241936-79241958 TAACTTAGTGTGTATCTGCCAGG - Intergenic
1112971310 13:105266603-105266625 TTGCTGAGTGGTCATCTGCCAGG - Intergenic
1112976389 13:105323923-105323945 AAGATGAGTGTCCCTCTGCCAGG - Intergenic
1113320737 13:109229685-109229707 CAGCTGAGACTGCCTCAGCCTGG + Intergenic
1116197754 14:41751601-41751623 CCTCAGAGTGTGCATCTGCTTGG - Intronic
1120612681 14:86661672-86661694 CAGCTTAGTGTGCATCAGAGAGG - Intergenic
1121422485 14:93825156-93825178 CAGCTGAGTCAGGAGCTGCCTGG - Intergenic
1121618465 14:95330039-95330061 CTGCTGTGTGTGAAACTGCCTGG + Intergenic
1122296504 14:100709111-100709133 CAGCTGTCTGTGCAGCTCCCGGG + Intergenic
1122737821 14:103853904-103853926 TTGCTGTGTGTGCACCTGCCTGG + Intergenic
1122779529 14:104137866-104137888 GAGCTGAGTTCCCATCTGCCAGG + Intergenic
1127171846 15:56311049-56311071 CAGCTGTGGGTGCAAATGCCAGG - Intronic
1127707644 15:61562842-61562864 CAGATGAGCGTGAACCTGCCCGG - Intergenic
1128868410 15:71134123-71134145 CAGCTGAGTTTGGATATGACAGG + Intronic
1130766839 15:86879391-86879413 CTGCTGAGTGTGCATCTTAGAGG + Intronic
1132265233 15:100464436-100464458 CAGCTGAGTGTGCAGGGGGCAGG - Intronic
1133263693 16:4569938-4569960 CAGCTGAGTTGGCACCTTCCTGG - Intronic
1135588303 16:23688016-23688038 CAGCTCTGTGAGCATCTCCCTGG + Intronic
1136070550 16:27784606-27784628 CAGGGGAGTGGGCAGCTGCCAGG - Intergenic
1137012354 16:35335481-35335503 AAGCTGAGTGAGCTTCTCCCAGG + Intergenic
1137748558 16:50841615-50841637 CAGCGGGGTGTGCTTCTGCCGGG + Intergenic
1137891495 16:52167416-52167438 CAGCAGCATGTGCATCAGCCAGG + Intergenic
1138656930 16:58496726-58496748 CAGCTGAGTGTCCATATGAGGGG - Intronic
1142033588 16:87850497-87850519 CACCAGAGCGTGCATCCGCCGGG + Intronic
1143728403 17:8865820-8865842 CAGCTGTGTCTGCTTCTGGCTGG + Intronic
1145815096 17:27789538-27789560 CTGCTATGTCTGCATCTGCCTGG + Intronic
1146684364 17:34830843-34830865 AAGCTCATTGTGCATGTGCCTGG - Intergenic
1148485617 17:47988912-47988934 GAGCTGAGTGTGCTTCTGGAAGG + Intergenic
1148818968 17:50349283-50349305 GAGCTGAGTGTGCATCAGCCTGG - Intronic
1150315153 17:64162997-64163019 CATCTGACTGAGCCTCTGCCTGG + Intronic
1151692392 17:75694589-75694611 AAGCAGAGTGTGCATCTGCTGGG + Intronic
1152180884 17:78821096-78821118 GAGCTGGGAGTGCCTCTGCCAGG - Intronic
1155165409 18:23228242-23228264 CAGCTGGCTGGGCCTCTGCCAGG + Intronic
1155786785 18:29912643-29912665 AAGCTCAGTGTGCATGTGGCAGG - Intergenic
1158116555 18:54002597-54002619 CCATTGAGTGTGCATCTTCCTGG + Intergenic
1160032410 18:75273907-75273929 CAGGTGAGTGTGTATGTGCATGG - Intronic
1160232256 18:77057289-77057311 CAGATGAGGGTGCAGCTGCCAGG - Intronic
1160874772 19:1291859-1291881 CTGCTGGGTGAGCCTCTGCCTGG + Intronic
1161781744 19:6297642-6297664 CAGCTGGGTGTGCACATGCTTGG + Intergenic
1162131643 19:8529722-8529744 CAGGTGAGGGTGTATCTGACAGG + Intronic
1162478497 19:10914979-10915001 CAGCTGTGTGTGCGTGTGGCAGG + Intronic
1163512167 19:17741771-17741793 CACCTCAGGGTGCATCTGACTGG - Intergenic
1163614465 19:18318472-18318494 CGGCTGGGTGTGCATCTGACTGG + Intronic
1163766130 19:19164491-19164513 CAGGTGAGGGTGCCTGTGCCAGG - Intronic
925023167 2:587754-587776 CAGCTGGGTCTGCAGCTCCCAGG - Intergenic
925072480 2:981912-981934 CATGTGAGTGTGCATCTGTGTGG - Intronic
929857523 2:45649928-45649950 AAGCTGAGTGTTCATCTGGCGGG - Intergenic
929905043 2:46038096-46038118 CAGTTGAGTGTGGCCCTGCCTGG + Intronic
931464669 2:62475738-62475760 CAGCTGGGTCTGCAGCTGGCTGG + Intergenic
935720029 2:105971818-105971840 CAGCTCAGTGGGCTTCTGCATGG - Intergenic
936055862 2:109261506-109261528 CACCTGTGTGTGCAGCAGCCAGG + Intronic
937839035 2:126507089-126507111 CAGTTGAGTTGGCATCTTCCTGG - Intergenic
940001492 2:148970765-148970787 CAGCTGAGTGGGCAGGGGCCGGG - Intronic
942062973 2:172244859-172244881 CATATGAGTGTGCATGTGACAGG + Intergenic
944318471 2:198308581-198308603 CAGCAAAGTGTGCACCAGCCAGG - Intronic
946546080 2:220745425-220745447 CAGATGTGTATACATCTGCCTGG - Intergenic
946631772 2:221677193-221677215 CAGATGTGTGTGCAGCTCCCCGG - Intergenic
948414703 2:237794560-237794582 CAGTTGAGGGGGCCTCTGCCAGG + Intronic
1170232914 20:14070048-14070070 CAGCTGACTGTAGAACTGCCTGG + Intronic
1172115651 20:32572015-32572037 GAGTTGGGTGTGAATCTGCCTGG - Intronic
1172880005 20:38193778-38193800 TAGCTGAGTTTGGCTCTGCCAGG + Intergenic
1173553371 20:43948705-43948727 CAGATGTGTGAACATCTGCCAGG - Intronic
1173793126 20:45840988-45841010 CAGCTGGGCTTGCAGCTGCCAGG - Exonic
1174083615 20:47989182-47989204 CAGTGGAGTGTGTATCTGCTCGG + Intergenic
1175622201 20:60457465-60457487 CAGATGAGTGTTCATCTCTCTGG + Intergenic
1176066271 20:63197771-63197793 CAGATGAGGGTGGATGTGCCTGG - Intronic
1179115775 21:38490639-38490661 CTGCTGACTGTGCTGCTGCCAGG - Intronic
1179236918 21:39555640-39555662 CAGGTGTGTGTCCATATGCCTGG + Intergenic
1179513576 21:41891519-41891541 CAGCTGGGGGTTCCTCTGCCTGG - Intronic
1179903227 21:44405875-44405897 GAGATGTGTGTGCTTCTGCCCGG + Intronic
1181091357 22:20474789-20474811 ATGCTGAGTATGCATATGCCAGG + Intronic
1181137556 22:20779241-20779263 CAGCGGGGTGTGGATCAGCCAGG + Intronic
1181675094 22:24446108-24446130 CGGCTCAGTGTGCATCAGCAAGG - Intergenic
1182150797 22:28025899-28025921 CTGCTGTGTGTGCGTCTGCATGG - Intronic
1184210263 22:43031177-43031199 CAGCTCCGCGTGCCTCTGCCTGG - Intergenic
1184310447 22:43637801-43637823 CGGCTGTGTGTGCTTCTGCGGGG - Intronic
1185372437 22:50467242-50467264 CAGCTGTGTGTGGCTCTGGCTGG + Intronic
1185373614 22:50471941-50471963 CAGCTGAGTGTGCATCTGCCTGG - Intronic
950227055 3:11244363-11244385 CAGCTGAGTATACAGCTGCCTGG - Intronic
952261866 3:31747939-31747961 CAGCAGAGTGTGCACCAGGCGGG - Exonic
953089467 3:39709458-39709480 CAGCAGAATCTGCATCTGGCAGG + Intergenic
953538756 3:43795943-43795965 CTGATGTGTGTGCATCTTCCAGG + Intergenic
953861259 3:46545855-46545877 CAGCTGTGTGGGCATCTGAAGGG - Intronic
957136343 3:76294066-76294088 CAGCTGGGTGTGCACATGCATGG - Intronic
958089820 3:88862359-88862381 CAGCTGAGACTGCATATGCTGGG + Intergenic
962986426 3:140540377-140540399 CAGCTGTGTGAGCATCCCCCGGG + Intronic
963972692 3:151447013-151447035 CAGCTGTGTGTGGATCTGAAGGG + Exonic
967641474 3:191869929-191869951 CAGGTGAGTGAGCCTCAGCCTGG - Intergenic
967968826 3:194984701-194984723 AAGTTTAGGGTGCATCTGCCAGG + Intergenic
969576388 4:8038475-8038497 CAGCTTAGGGTGAAGCTGCCAGG - Intronic
971508648 4:27396434-27396456 CAGTCGAGTGTGTATCTGTCAGG - Intergenic
973651282 4:52999563-52999585 CAGCTGACTGTGTGTCTGACAGG + Intronic
974096286 4:57368106-57368128 CAGCTAAGTGCTCTTCTGCCAGG + Intergenic
978940844 4:114434630-114434652 CATCTGTGTGTGCATTTGCATGG + Intergenic
979083741 4:116378940-116378962 GGGCTGAGTGTGCATGTGCAGGG + Intergenic
980839568 4:138241454-138241476 AAGCTAAGTGTACAACTGCCCGG + Intronic
982313518 4:154009350-154009372 AAGCTGAGTGTGGTTCTCCCTGG - Intergenic
985487508 5:159757-159779 TAGCTCAGTGTTCACCTGCCAGG + Intronic
986274906 5:6265398-6265420 AAGCAGAGTGTGCATCTTCATGG - Intergenic
988157498 5:27473758-27473780 CTGCTGAGTTTTCTTCTGCCTGG + Intergenic
990358221 5:54991615-54991637 CAGCTGAGGGTGCCTGTGACGGG + Intronic
991130986 5:63122134-63122156 AGGCTGAGTGTGAATGTGCCAGG + Intergenic
993295926 5:86140349-86140371 CAGCTGTGTGTGAATCTGCCAGG - Intergenic
993961085 5:94297134-94297156 CAGCCGAGTTTCCATGTGCCTGG - Intronic
994916146 5:105982576-105982598 CAGCTGGGTGTGCATATGACGGG + Intergenic
997384880 5:133464726-133464748 CAGCTGGGTGAGCAACTCCCTGG - Intronic
998052672 5:139049071-139049093 CAGCTGAGTGACCTTCTGACAGG + Intronic
998457337 5:142283516-142283538 GTGCTGAGCGTGCATCTGGCAGG + Intergenic
1002469938 5:179429116-179429138 CAGCTGCCAGTGCAGCTGCCTGG - Intergenic
1003313709 6:4992001-4992023 AAGCACAGTGGGCATCTGCCTGG - Intergenic
1005397707 6:25400351-25400373 TAGATGAATGTGCATCTTCCTGG + Intronic
1009492163 6:64304245-64304267 CAGCTAAGTGTTTATATGCCAGG - Intronic
1012368372 6:98470994-98471016 CAGTTGGGTGTGCAGATGCCAGG - Intergenic
1013087287 6:106867152-106867174 CAGCTGGTGGTGCCTCTGCCCGG - Intergenic
1013353087 6:109323459-109323481 CAGCTCACTGGACATCTGCCAGG + Intergenic
1014824527 6:126033729-126033751 CAGCAGACCATGCATCTGCCAGG - Intronic
1017234348 6:152104057-152104079 GAGATGACAGTGCATCTGCCTGG + Intronic
1017523208 6:155220213-155220235 CAGCTGGCTGTGCCTTTGCCAGG + Intronic
1018461169 6:163999934-163999956 CACTTCAGTGTGCATCTGCTGGG + Intergenic
1021412533 7:20344688-20344710 CAGCTCAGGGTGCGTCTCCCTGG - Intronic
1022541146 7:31136378-31136400 CAGCTGGGAGTGACTCTGCCTGG + Intergenic
1024452453 7:49563582-49563604 GAGCTGACGGGGCATCTGCCTGG + Intergenic
1024564415 7:50669702-50669724 CAGGTGAGTGTGCCCCTGGCTGG - Exonic
1029665745 7:101993946-101993968 CAGCTCTGTATCCATCTGCCTGG + Intronic
1030043964 7:105477946-105477968 TAGCTGAGTGTGCTGCTGCCTGG - Intronic
1032858673 7:135858239-135858261 CAGCTGGGTGTACACATGCCAGG - Intergenic
1034333125 7:150300425-150300447 CAGCTGATTGTTCATGTTCCAGG - Intronic
1034664918 7:152809464-152809486 CAGCTGATTGTTCATGTTCCAGG + Intronic
1036974316 8:13393935-13393957 CAGCTGAGTGTGCATTGGAAAGG + Intronic
1038090753 8:24250387-24250409 GATCTGAGAATGCATCTGCCAGG + Intergenic
1038685202 8:29710275-29710297 AGGCTGAATGTGCATCTCCCTGG + Intergenic
1042004863 8:64169193-64169215 CAGCTGAGTGTGCACATGCTTGG + Intergenic
1045011334 8:97961446-97961468 CAGCTCTGTGTGAATGTGCCGGG + Exonic
1046556228 8:115776637-115776659 AAGCTGAGTTTCCACCTGCCAGG + Intronic
1046832650 8:118763310-118763332 GAGCAGAGTGTGGAGCTGCCTGG + Intergenic
1049378888 8:142302298-142302320 CAGCTGGGAGAGCACCTGCCTGG - Intronic
1049404234 8:142444545-142444567 AAGCTGGCTGTGCATCTGCCCGG + Intergenic
1049748931 8:144274492-144274514 CAGAGAAGTGCGCATCTGCCTGG - Intronic
1049815954 8:144600331-144600353 TACCTGAGTGTGCATGTGCGTGG + Intronic
1051445570 9:17135536-17135558 AAGCAGGGTGTGCATCTGCCAGG - Intronic
1051733136 9:20168830-20168852 CACCTGAGAGTGAAACTGCCGGG - Intergenic
1052199728 9:25763852-25763874 TAGCTGAGTGAGAATCTGCAGGG - Intergenic
1053270204 9:36744493-36744515 TAGCTGAGTGAGCACTTGCCAGG - Intergenic
1053279811 9:36812623-36812645 CAGGTGGGTGTTCTTCTGCCTGG + Intergenic
1055706119 9:79006376-79006398 CAGCTTAAAGTGCATCTGACTGG - Intergenic
1057307924 9:93923023-93923045 CTGCTGCGTGTGCACCTGCATGG - Intergenic
1057391244 9:94643078-94643100 CAGCTGAGCCTGTATTTGCCTGG + Intergenic
1057425522 9:94946381-94946403 AAGCTGAGTGGCCATCTGTCAGG - Intronic
1058077592 9:100667080-100667102 CAGCCAAGTGTGCATGTGCTCGG + Intergenic
1060528703 9:124334906-124334928 CTGCTCACTGTGGATCTGCCTGG - Intronic
1060595893 9:124848708-124848730 CAGATCAGGGTGCAGCTGCCTGG + Intergenic
1060996319 9:127876534-127876556 CTGCTGAGTGTGCTTCAGCGGGG + Intronic
1061451920 9:130672025-130672047 CAGCAGGGCGTGCATCTGGCTGG + Intronic
1061487670 9:130928611-130928633 CAGCTGAGTGACCAAATGCCTGG + Intronic
1203790649 EBV:149815-149837 CAGCTGAATGTCGCTCTGCCCGG + Intergenic
1187690477 X:21861337-21861359 CAGTTAAGTATGCATCTGCAAGG - Intronic
1187871307 X:23767168-23767190 CAGCTGGGTGTGCGTGCGCCTGG - Intergenic
1188147327 X:26630101-26630123 CAGCTGAGTGTGCAGCAGTGGGG + Intergenic
1193534741 X:82699695-82699717 CATCTGAGGCTACATCTGCCTGG - Intergenic
1196573934 X:117296454-117296476 TGGCTGAGTGTGCATCTGTGTGG + Intergenic
1197030660 X:121809978-121810000 CAGATGAGTATGCATAAGCCTGG - Intergenic
1197703240 X:129615761-129615783 CAGCTGAGTGTGCAAGCACCTGG + Intergenic
1199559411 X:149147008-149147030 CGGCTGAGTGTGCACATGCTTGG + Intergenic