ID: 1185375490

View in Genome Browser
Species Human (GRCh38)
Location 22:50481195-50481217
Sequence CCGGGCGGTCCCACCCTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185375490_1185375496 -10 Left 1185375490 22:50481195-50481217 CCCTGGAGGGTGGGACCGCCCGG No data
Right 1185375496 22:50481208-50481230 GACCGCCCGGACTCGGGAGGTGG No data
1185375490_1185375506 13 Left 1185375490 22:50481195-50481217 CCCTGGAGGGTGGGACCGCCCGG No data
Right 1185375506 22:50481231-50481253 TTGACGGGGTGGGCCCCGTCGGG No data
1185375490_1185375503 2 Left 1185375490 22:50481195-50481217 CCCTGGAGGGTGGGACCGCCCGG No data
Right 1185375503 22:50481220-50481242 TCGGGAGGTGGTTGACGGGGTGG No data
1185375490_1185375502 -1 Left 1185375490 22:50481195-50481217 CCCTGGAGGGTGGGACCGCCCGG No data
Right 1185375502 22:50481217-50481239 GACTCGGGAGGTGGTTGACGGGG No data
1185375490_1185375504 3 Left 1185375490 22:50481195-50481217 CCCTGGAGGGTGGGACCGCCCGG No data
Right 1185375504 22:50481221-50481243 CGGGAGGTGGTTGACGGGGTGGG No data
1185375490_1185375501 -2 Left 1185375490 22:50481195-50481217 CCCTGGAGGGTGGGACCGCCCGG No data
Right 1185375501 22:50481216-50481238 GGACTCGGGAGGTGGTTGACGGG No data
1185375490_1185375505 12 Left 1185375490 22:50481195-50481217 CCCTGGAGGGTGGGACCGCCCGG No data
Right 1185375505 22:50481230-50481252 GTTGACGGGGTGGGCCCCGTCGG No data
1185375490_1185375500 -3 Left 1185375490 22:50481195-50481217 CCCTGGAGGGTGGGACCGCCCGG No data
Right 1185375500 22:50481215-50481237 CGGACTCGGGAGGTGGTTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185375490 Original CRISPR CCGGGCGGTCCCACCCTCCA GGG (reversed) Intergenic
No off target data available for this crispr