ID: 1185376316

View in Genome Browser
Species Human (GRCh38)
Location 22:50484110-50484132
Sequence GTTCCTACCTCCAAGGGGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 151}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185376303_1185376316 21 Left 1185376303 22:50484066-50484088 CCGCAGCAGAGCTCAGGACATTC 0: 1
1: 0
2: 2
3: 22
4: 199
Right 1185376316 22:50484110-50484132 GTTCCTACCTCCAAGGGGGAGGG 0: 1
1: 0
2: 1
3: 13
4: 151
1185376307_1185376316 -4 Left 1185376307 22:50484091-50484113 CCACAGAGCTTGCCCCTCAGTTC 0: 1
1: 0
2: 1
3: 18
4: 224
Right 1185376316 22:50484110-50484132 GTTCCTACCTCCAAGGGGGAGGG 0: 1
1: 0
2: 1
3: 13
4: 151
1185376304_1185376316 -1 Left 1185376304 22:50484088-50484110 CCCCCACAGAGCTTGCCCCTCAG 0: 1
1: 0
2: 1
3: 25
4: 224
Right 1185376316 22:50484110-50484132 GTTCCTACCTCCAAGGGGGAGGG 0: 1
1: 0
2: 1
3: 13
4: 151
1185376305_1185376316 -2 Left 1185376305 22:50484089-50484111 CCCCACAGAGCTTGCCCCTCAGT 0: 1
1: 0
2: 0
3: 32
4: 193
Right 1185376316 22:50484110-50484132 GTTCCTACCTCCAAGGGGGAGGG 0: 1
1: 0
2: 1
3: 13
4: 151
1185376306_1185376316 -3 Left 1185376306 22:50484090-50484112 CCCACAGAGCTTGCCCCTCAGTT 0: 1
1: 0
2: 1
3: 10
4: 118
Right 1185376316 22:50484110-50484132 GTTCCTACCTCCAAGGGGGAGGG 0: 1
1: 0
2: 1
3: 13
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185376316 Original CRISPR GTTCCTACCTCCAAGGGGGA GGG Exonic
900004317 1:34741-34763 CTTCCCACCTCCAAGGAGCACGG - Intergenic
900024044 1:205257-205279 CTTCCCACCTCCAAGGAGCACGG - Intergenic
900495417 1:2973907-2973929 GGACCACCCTCCAAGGGGGACGG - Intergenic
901806034 1:11739197-11739219 GTCCCTACCTCCTAGGATGATGG + Intronic
904417504 1:30372322-30372344 GTCCCTGCCTTCAAGGGGGAGGG + Intergenic
904608509 1:31712277-31712299 TTCCCCACCTCCAAGTGGGAAGG - Intergenic
905797387 1:40823308-40823330 GCTCCTACCTCAGAGTGGGAAGG + Intronic
906033191 1:42736023-42736045 ATTCATACCTGCAAGGGGTAGGG + Exonic
910991865 1:93064858-93064880 GTTCTTACCTTCAAGGAGGTAGG - Intergenic
915165984 1:153948028-153948050 GTCTCTACCTGCCAGGGGGAAGG + Exonic
916392421 1:164344968-164344990 GTTCCTGCCTCCAAAGCAGATGG - Intergenic
916610260 1:166384941-166384963 TTTCCTACCTGCAAGGTGGCTGG + Intergenic
918428977 1:184438699-184438721 GCTCCTACCCTCAAGGGGCATGG - Intronic
919031144 1:192244356-192244378 CTTCCTACATTCAAGGGGGGAGG - Intergenic
920957938 1:210636305-210636327 GTTCCCACCTCCAAAGGAGAAGG - Intronic
1068590803 10:58851045-58851067 ATTCCTCCCTCCCAGAGGGAGGG + Intergenic
1068650384 10:59515714-59515736 TTGCCTACCTCCAACAGGGAGGG - Intergenic
1068726830 10:60312463-60312485 GTTCCTACCTTAAAGGGGTTTGG + Intronic
1069754181 10:70763258-70763280 GTTCCCACCCCCACGGGGGTAGG - Intergenic
1069845976 10:71371831-71371853 CTGCCAACCTCCAAGGGCGATGG - Intergenic
1071037764 10:81267566-81267588 GCTCCTGCCTCCCAAGGGGATGG + Intergenic
1077487678 11:2846546-2846568 GGTCCAACCTCCTAGGGAGAGGG + Intronic
1078058046 11:8023305-8023327 GCTCCTGCCTCCAAGAGGTAAGG - Intronic
1081850045 11:46269223-46269245 GTACCTGCCTCCAAGGGTTATGG + Intergenic
1083271317 11:61574242-61574264 GTTCTTACCTCCCAGGCGGTTGG - Intronic
1083400371 11:62419171-62419193 GTTCCTAAGTCCAGGAGGGAGGG - Intronic
1084326962 11:68406086-68406108 GCTCCTACCTCCAAGGTGAATGG + Intronic
1085300015 11:75452346-75452368 GTACCTACCTGGAAGGGGGTTGG + Intronic
1091377740 12:36789-36811 CTTCCCACCTCCAAGGAGCACGG - Intergenic
1091587780 12:1826142-1826164 GTTCCTCCCTCCAGAGGAGAGGG - Intronic
1097701916 12:62828985-62829007 GTTCCTACCAACAATGGAGAGGG - Intronic
1101589825 12:106115810-106115832 GTTCCTACCCTCAAGGAGGCTGG + Intronic
1102616145 12:114156065-114156087 ATGCCCATCTCCAAGGGGGATGG + Intergenic
1107838210 13:44429198-44429220 ACTCCTAACTCCAAGGGGGCGGG + Intergenic
1108579972 13:51819682-51819704 GTACCTGCCTCAAAGGGGCACGG + Intergenic
1113609440 13:111632912-111632934 GTTCCTAACTCCAAGTCAGAGGG + Intronic
1114437008 14:22714773-22714795 GTTCCTACTACCCAGGAGGAGGG + Intergenic
1115317766 14:32043892-32043914 TTTCCTTCCTCTAAGGGAGAAGG - Intergenic
1116146146 14:41071764-41071786 GTTGCTTCCTGCAAAGGGGAGGG + Intergenic
1116277861 14:42859964-42859986 GTTCCTACCTCCATGGTGTATGG + Intergenic
1116982749 14:51188827-51188849 GTTCCTCCCTCAAAGGTGCAGGG + Intergenic
1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG + Intronic
1122271522 14:100570467-100570489 GATACAGCCTCCAAGGGGGAGGG - Intronic
1122392429 14:101399385-101399407 AACCCTACCTCAAAGGGGGAGGG + Intergenic
1124623715 15:31295949-31295971 CATCCCACCTCCTAGGGGGAAGG - Intergenic
1125484160 15:40100823-40100845 CTCCATACCTCCAAGGGAGAAGG + Intronic
1128066200 15:64766152-64766174 CCTCCAACCTCCAAGGAGGACGG - Intronic
1128107222 15:65054017-65054039 GTTTCTACCTGCAGGGGGGCAGG + Exonic
1129166507 15:73781260-73781282 GCTCAGGCCTCCAAGGGGGAAGG - Intergenic
1129174058 15:73827167-73827189 GCTCCTACCTACCAGGTGGAGGG + Intergenic
1129208809 15:74053632-74053654 GTTCCTTTCTCCAGGGGGGTTGG - Intergenic
1132449187 15:101956203-101956225 CTTCCCACCTCCAAGGAGCACGG + Intergenic
1133489321 16:6251570-6251592 CCCCCTACCTCCAAGGGGTAGGG - Intronic
1134846853 16:17447631-17447653 ATTCCTACATCCCAGGGAGAAGG + Intronic
1138370634 16:56523886-56523908 GTGTCTCCCTCCAAGGGGGGTGG - Intergenic
1138374734 16:56555046-56555068 GTTGCTAACCCCATGGGGGATGG - Intergenic
1140093200 16:71853639-71853661 TTACCTACCTCCTGGGGGGAGGG + Exonic
1141131743 16:81442264-81442286 GTTCCTACCTCCTAGGCTGGTGG + Intergenic
1141995522 16:87634519-87634541 GTCCCTGCCTCCAGGTGGGAAGG + Intronic
1144127537 17:12217216-12217238 GATGCTTCCTCCAAAGGGGAAGG - Intergenic
1147319997 17:39640360-39640382 GTCCCAGCCTCCAAGGGGGCAGG + Intronic
1148497761 17:48064098-48064120 GTACATATCTCTAAGGGGGAGGG - Intergenic
1149569778 17:57664178-57664200 GTTCCTATCTCCAAGGAAAAGGG - Intronic
1149705797 17:58693183-58693205 GTTCCAAGATCCAAGGGGTAAGG + Intronic
1150007219 17:61477229-61477251 GGTCCTGCCTTCAATGGGGAGGG + Intronic
1151981193 17:77510248-77510270 GTTGCTACGTCCCAGGAGGAGGG - Intergenic
1152234591 17:79132160-79132182 GTTCCCAGCTCCCAGGGTGAGGG + Intronic
1152259718 17:79260413-79260435 GTTCCTAGCTCCAAGGTGCAGGG - Intronic
1159642557 18:70880715-70880737 ATTCCTATCTCCCAGGGTGACGG + Intergenic
1160512221 18:79459034-79459056 GGCCCCACCTCCAAGAGGGAAGG + Intronic
1160636069 19:76350-76372 CTTCCCACCTCCAAGGAGCACGG - Intergenic
1161722993 19:5914049-5914071 CTTCCTGGCTCCAAGGAGGAGGG - Intronic
1162444459 19:10713576-10713598 GTACCTCCCTCCAAGGTGGCTGG - Intergenic
1162916658 19:13877842-13877864 GTACCCACCTCCAAGGGTTAGGG + Intronic
1164892752 19:31839155-31839177 GTTCTTACATCCTAGTGGGAGGG + Intergenic
926366983 2:12142466-12142488 GTTTCTGCCCCAAAGGGGGACGG + Intergenic
927091475 2:19715886-19715908 GGTCCTAGCTTCTAGGGGGAGGG - Intergenic
927148751 2:20183889-20183911 GTTCCTGCATCCGAAGGGGAAGG - Intergenic
931441782 2:62295089-62295111 GTTCCTATTTCCCAGGGGAAAGG - Intergenic
935683940 2:105667207-105667229 CTGCCTACCCTCAAGGGGGAAGG + Intergenic
936738948 2:115480413-115480435 GTTCCTACTTCCTAGGGACATGG + Intronic
945121940 2:206466800-206466822 GATGCCAGCTCCAAGGGGGATGG + Intronic
947702340 2:232244852-232244874 GTTCTTACCTCCATGAGGGTTGG - Intronic
1173562493 20:44016196-44016218 GTTCCTACCTTAAAGGGTGCTGG - Intronic
1174341745 20:49901384-49901406 GCTTCTACTACCAAGGGGGAGGG + Intergenic
1175166362 20:57047357-57047379 TTTCCTTCCTCCAAAAGGGAAGG + Intergenic
1177127795 21:17217407-17217429 CTTGCTACCTCCACTGGGGAAGG + Intergenic
1178104476 21:29302298-29302320 TTTACTCCCTCCAAGGGGCACGG - Intronic
1181164896 22:20977937-20977959 GTTCCTCCAGGCAAGGGGGAAGG - Exonic
1181801769 22:25352346-25352368 GCTCCTAACTCCAAGGTGGATGG - Intronic
1182640259 22:31761352-31761374 GTTCTTACCTATAAGTGGGATGG - Intronic
1183190863 22:36321346-36321368 GTTCTCACCTTCAAGGGGCATGG + Intronic
1184295185 22:43518896-43518918 GTTCCTCCCTCCAGGGGGAGAGG - Intergenic
1185111683 22:48903649-48903671 GTACCTGCCTACACGGGGGAAGG - Intergenic
1185376316 22:50484110-50484132 GTTCCTACCTCCAAGGGGGAGGG + Exonic
949555818 3:5151722-5151744 GATCCTATCTCCAAGGGGGGGGG - Intronic
950436585 3:12983916-12983938 GCACCTACCTTCAAGGGGGCAGG + Intronic
952256384 3:31699149-31699171 GTTCCAAGCTCCAAGGAGAAGGG - Intronic
952985044 3:38771463-38771485 GTTCCTTCTTCCAGGAGGGAGGG + Intronic
958936182 3:100258594-100258616 GTTCCCACATCCAAATGGGAAGG - Intergenic
961600769 3:128059964-128059986 GATACTACCTCCAAGGGGCTCGG - Intronic
963523741 3:146389562-146389584 GTGGCTCCCTCCAAGGGAGAGGG - Intergenic
964693937 3:159485948-159485970 GTTCCTACCTCCCAGGTGCCAGG + Intronic
966157122 3:176928865-176928887 TTTCCTGTCTTCAAGGGGGAAGG + Intergenic
969288956 4:6226605-6226627 GTTACTAGGTCCATGGGGGATGG - Intergenic
978725950 4:111969574-111969596 GTGTCTACCTCTGAGGGGGAGGG + Intergenic
979398247 4:120216058-120216080 ATTTCTACATCAAAGGGGGAGGG + Intergenic
980278537 4:130687290-130687312 GACTCCACCTCCAAGGGGGATGG + Intergenic
983987095 4:174073080-174073102 GTTCCCACCTGCAAAGGGGCAGG - Intergenic
984435523 4:179705629-179705651 ATTCCTAGATTCAAGGGGGAGGG - Intergenic
984697414 4:182793257-182793279 TTTCCTACGTCAAAGGGGCACGG + Exonic
985994958 5:3592656-3592678 TTTCCTGCCTCCAAAGGGGGTGG - Intergenic
986782918 5:11083840-11083862 GTGCCTGCCCCCATGGGGGAAGG - Intronic
989538905 5:42596284-42596306 GTTCCTACCTCCAAAGGAGATGG + Intronic
992099702 5:73395356-73395378 GTGCCTACCTCCCATGTGGAAGG + Intergenic
992334653 5:75753282-75753304 GTTCATACCCCCAAGGAGCAGGG - Intergenic
992874537 5:81040645-81040667 GTTCTAACATCCAAGGGGGTGGG - Intronic
997336504 5:133112503-133112525 GTTCCTCCATCCAGGTGGGATGG - Intergenic
997631856 5:135374597-135374619 ATGCCTTCCTACAAGGGGGAGGG + Intronic
999259541 5:150229426-150229448 GTTCCTGCCTCCTAGAGTGAAGG + Intronic
999717872 5:154376473-154376495 TTGCCTCCCTCCAAGTGGGAGGG - Intronic
1001589192 5:172853830-172853852 GTGCCCACCTCCAAGGGGCCTGG + Intronic
1001878363 5:175220432-175220454 GCTCCTAACTCCAAGAGTGAAGG + Intergenic
1003562950 6:7198423-7198445 TTGTCTACATCCAAGGGGGAAGG + Intronic
1003703307 6:8494826-8494848 GTCCCTGCCTCAAAGGGAGAGGG - Intergenic
1006835380 6:36995744-36995766 GTACCTTCCTAAAAGGGGGAGGG - Intergenic
1007016932 6:38478139-38478161 CTTCCTACCAGGAAGGGGGAGGG + Intronic
1007295810 6:40819712-40819734 GTTAATAGCTCCAAGGTGGAAGG + Intergenic
1007421352 6:41721720-41721742 GTTCCTATCTCCTAGGGTGATGG - Intronic
1007834398 6:44663661-44663683 GTTCAGACCTGCAAGGGGCATGG + Intergenic
1011202305 6:84850525-84850547 ATTCCAACCTCCATGGGGTAGGG + Intergenic
1013766367 6:113578648-113578670 GTTTCTAGCTCCAAAGGGGGGGG - Intergenic
1018727050 6:166620997-166621019 AATCCTACCTCCACGGGGCAAGG + Intronic
1019544591 7:1567597-1567619 GTTCCTCCCTCCACCGGGGAGGG + Exonic
1028075274 7:86505148-86505170 AATCCTACCTCAAAGGTGGATGG - Intergenic
1029287580 7:99476459-99476481 GTTCCCACCAGCCAGGGGGAAGG + Exonic
1031539118 7:122971703-122971725 TTTCCTACCTATATGGGGGAAGG - Intergenic
1034776987 7:153836998-153837020 GTGCCTACATCCCAGGCGGAGGG + Intergenic
1037502560 8:19499720-19499742 GGTCCTACCTCCGAGGTGGAGGG - Intronic
1038115795 8:24553804-24553826 GTTCCTACCTCATAGGGCTATGG - Intergenic
1040455334 8:47592453-47592475 GTCCCTCCCTCAAAGGGGGAAGG + Intronic
1041124423 8:54621190-54621212 GTTCCTCACTCCAAAAGGGAGGG - Exonic
1042518257 8:69682595-69682617 GTTCATAGCACCAAGAGGGAGGG - Intronic
1045055102 8:98362083-98362105 GTTCCTTCCTCCCAGAAGGAAGG + Intergenic
1045398415 8:101785259-101785281 CTTCCTGCCTCCTCGGGGGATGG + Intronic
1045451723 8:102333499-102333521 AATCCTTCCTCAAAGGGGGAAGG + Intronic
1045991534 8:108314392-108314414 GTTCCTTCCTCCAGGGTGTAGGG - Intronic
1048424581 8:134311562-134311584 TTTCCCACCTCCAGGGGGGCTGG - Intergenic
1049463869 8:142742261-142742283 CTGCCCACCTCCTAGGGGGATGG - Intronic
1049887014 9:34524-34546 CTTCCCACCTCCAAGGAGCACGG - Intergenic
1050044165 9:1526121-1526143 GTTCCTACCCCCAGGGCTGAAGG - Intergenic
1052849777 9:33370698-33370720 TTTCCTACCATCATGGGGGACGG - Exonic
1057562641 9:96140276-96140298 CTTCCCACCTCCCAGGGTGATGG - Intergenic
1057730598 9:97605058-97605080 GATCTTGCCTCCTAGGGGGATGG + Intronic
1057759809 9:97863052-97863074 ATTCCTACATCCAGGGAGGAAGG - Intergenic
1059309850 9:113380778-113380800 GTTCCTGCCTGCATGGGGCATGG + Intergenic
1060229998 9:121819275-121819297 CTTCCAACCTCCTAGGGGGACGG - Intergenic
1062308238 9:135921568-135921590 GTTCCCACCTCCGTGGGGGGAGG + Intergenic
1190638050 X:52455752-52455774 GTTCTTTCCTCTAAGTGGGAGGG + Intergenic
1190750264 X:53356165-53356187 TTTCTTACCTATAAGGGGGAGGG + Intergenic
1190955299 X:55187126-55187148 GCTCTTTCCTCCAAGTGGGAGGG - Intronic
1192077481 X:68015087-68015109 GTTCCACCCACCAAGGGAGATGG - Intergenic
1193847125 X:86486519-86486541 GTTTCAATCTCCAAGGGAGATGG + Intronic
1194749366 X:97667359-97667381 CTTCCTACCTCCAAGAGTAAGGG - Intergenic
1196032801 X:111109286-111109308 GTGCCTACCTCAAAGGGCTATGG - Intronic
1198388345 X:136148366-136148388 GTTCTTCTGTCCAAGGGGGATGG + Intronic