ID: 1185377780

View in Genome Browser
Species Human (GRCh38)
Location 22:50489991-50490013
Sequence CAGGCACAAGTTGCCGTGAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2006
Summary {0: 1, 1: 0, 2: 3, 3: 122, 4: 1880}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185377780_1185377789 26 Left 1185377780 22:50489991-50490013 CCCCTCACGGCAACTTGTGCCTG 0: 1
1: 0
2: 3
3: 122
4: 1880
Right 1185377789 22:50490040-50490062 TGTGCTTCTGAAGCCCCACTGGG 0: 1
1: 0
2: 1
3: 24
4: 215
1185377780_1185377786 -1 Left 1185377780 22:50489991-50490013 CCCCTCACGGCAACTTGTGCCTG 0: 1
1: 0
2: 3
3: 122
4: 1880
Right 1185377786 22:50490013-50490035 GGCGTCAATAAAGACCTGGAAGG 0: 1
1: 0
2: 0
3: 5
4: 65
1185377780_1185377788 25 Left 1185377780 22:50489991-50490013 CCCCTCACGGCAACTTGTGCCTG 0: 1
1: 0
2: 3
3: 122
4: 1880
Right 1185377788 22:50490039-50490061 TTGTGCTTCTGAAGCCCCACTGG 0: 1
1: 0
2: 0
3: 11
4: 184
1185377780_1185377784 -5 Left 1185377780 22:50489991-50490013 CCCCTCACGGCAACTTGTGCCTG 0: 1
1: 0
2: 3
3: 122
4: 1880
Right 1185377784 22:50490009-50490031 GCCTGGCGTCAATAAAGACCTGG 0: 1
1: 0
2: 0
3: 1
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185377780 Original CRISPR CAGGCACAAGTTGCCGTGAG GGG (reversed) Exonic
Too many off-targets to display for this crispr