ID: 1185379662

View in Genome Browser
Species Human (GRCh38)
Location 22:50502626-50502648
Sequence CGGAAGGGCCAGAGTGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185379662_1185379679 26 Left 1185379662 22:50502626-50502648 CCTTGCCCACTCTGGCCCTTCCG No data
Right 1185379679 22:50502675-50502697 GCAGGAGGGAAGTGAGGGACCGG No data
1185379662_1185379678 21 Left 1185379662 22:50502626-50502648 CCTTGCCCACTCTGGCCCTTCCG No data
Right 1185379678 22:50502670-50502692 TGGGAGCAGGAGGGAAGTGAGGG No data
1185379662_1185379675 12 Left 1185379662 22:50502626-50502648 CCTTGCCCACTCTGGCCCTTCCG No data
Right 1185379675 22:50502661-50502683 GCCAAGAAGTGGGAGCAGGAGGG No data
1185379662_1185379670 1 Left 1185379662 22:50502626-50502648 CCTTGCCCACTCTGGCCCTTCCG No data
Right 1185379670 22:50502650-50502672 CCTTTCCTGAGGCCAAGAAGTGG No data
1185379662_1185379677 20 Left 1185379662 22:50502626-50502648 CCTTGCCCACTCTGGCCCTTCCG No data
Right 1185379677 22:50502669-50502691 GTGGGAGCAGGAGGGAAGTGAGG No data
1185379662_1185379674 11 Left 1185379662 22:50502626-50502648 CCTTGCCCACTCTGGCCCTTCCG No data
Right 1185379674 22:50502660-50502682 GGCCAAGAAGTGGGAGCAGGAGG No data
1185379662_1185379673 8 Left 1185379662 22:50502626-50502648 CCTTGCCCACTCTGGCCCTTCCG No data
Right 1185379673 22:50502657-50502679 TGAGGCCAAGAAGTGGGAGCAGG No data
1185379662_1185379665 -10 Left 1185379662 22:50502626-50502648 CCTTGCCCACTCTGGCCCTTCCG No data
Right 1185379665 22:50502639-50502661 GGCCCTTCCGTCCTTTCCTGAGG No data
1185379662_1185379671 2 Left 1185379662 22:50502626-50502648 CCTTGCCCACTCTGGCCCTTCCG No data
Right 1185379671 22:50502651-50502673 CTTTCCTGAGGCCAAGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185379662 Original CRISPR CGGAAGGGCCAGAGTGGGCA AGG (reversed) Intergenic
No off target data available for this crispr