ID: 1185379956

View in Genome Browser
Species Human (GRCh38)
Location 22:50503741-50503763
Sequence CTGGGTTTACCCCGGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185379944_1185379956 19 Left 1185379944 22:50503699-50503721 CCTGTGGGAGGGAGGGAGGGAGG 0: 2
1: 15
2: 73
3: 311
4: 1370
Right 1185379956 22:50503741-50503763 CTGGGTTTACCCCGGGAGGCTGG 0: 1
1: 0
2: 2
3: 15
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185379956 Original CRISPR CTGGGTTTACCCCGGGAGGC TGG Intronic
903132845 1:21290536-21290558 TTGGGGTCTCCCCGGGAGGCCGG - Intronic
903569973 1:24297158-24297180 CTTGCTTTACCCTGAGAGGCTGG + Intergenic
904343661 1:29854146-29854168 CTGGGCTCACCCTGTGAGGCGGG - Intergenic
904884396 1:33725445-33725467 CGGGGTTTACCACGGGACCCAGG - Exonic
907230011 1:52988769-52988791 ATGGCTTGAACCCGGGAGGCAGG - Intronic
909922549 1:81400450-81400472 GTGATTTTACCCCGGGAGACTGG + Intronic
912496429 1:110094923-110094945 CTGGGATATCCCCAGGAGGCTGG - Intergenic
914937495 1:151993678-151993700 CAGGGTTTTCCCCGGGCAGCAGG + Intronic
915900978 1:159846653-159846675 CTAGGTTTACCCCTGAGGGCCGG - Intronic
916019210 1:160777855-160777877 CTGGGTCTGGCCTGGGAGGCTGG - Intergenic
916259054 1:162822520-162822542 CTGGGCTGGGCCCGGGAGGCTGG + Intergenic
917806575 1:178619004-178619026 CAGGGTCTACCCCTGGAGGTGGG - Intergenic
920386955 1:205576151-205576173 TTGGGGTGACCCTGGGAGGCTGG - Intronic
920849785 1:209620979-209621001 CTGGGTTTCCCCCTGGGGCCAGG + Intronic
924151616 1:241135586-241135608 CTGGGTTTACCTAGGGAGAAAGG + Intronic
924254206 1:242166115-242166137 CTGGGTTTTCCCTGGGACACTGG + Intronic
924904197 1:248434033-248434055 CTCGGTTTACCACTGGAGGCCGG + Intergenic
924923699 1:248658018-248658040 CTCGGTTTACCACTGGAGGCCGG - Intergenic
1063609882 10:7553318-7553340 CTGAGTTTCCCCTGCGAGGCGGG - Intergenic
1063661160 10:8035918-8035940 CAGGGGTCCCCCCGGGAGGCAGG - Intergenic
1064022646 10:11822392-11822414 CTGGGTTTAACTCAGTAGGCAGG - Intergenic
1069709036 10:70477752-70477774 CTGGGGTTGCCCCAGGATGCAGG - Intergenic
1071329200 10:84543626-84543648 CTTGGATAACCCTGGGAGGCTGG - Intergenic
1073203293 10:101753575-101753597 CTGGGATTACCCAGACAGGCTGG - Intergenic
1073729193 10:106270035-106270057 CTGGGTGGACCCAGTGAGGCAGG - Intergenic
1075180230 10:120204562-120204584 CTGGATTTATGCCGGGGGGCAGG + Intergenic
1075344660 10:121673371-121673393 CTGGGCTTACCCAGGGAGGAGGG - Intergenic
1077008046 11:368481-368503 CTGGGCTCACCCCGGGTGGTTGG - Intergenic
1077191853 11:1258985-1259007 CTGGGTGTCCCCAGAGAGGCAGG - Exonic
1078061276 11:8046476-8046498 CTGGGTTTCCCCCAGGAGATAGG - Intronic
1078658688 11:13266509-13266531 ATGGCTTGAACCCGGGAGGCAGG + Intergenic
1080307354 11:30851127-30851149 GTGGGGTTACCCAGTGAGGCTGG + Intronic
1081968762 11:47184939-47184961 CTGTGTTTGCTCTGGGAGGCCGG - Intronic
1084477377 11:69396585-69396607 CTGGGTGTGCCCTTGGAGGCTGG - Intergenic
1084564485 11:69921394-69921416 CTGGGGTGACCCAGAGAGGCTGG + Intergenic
1089390904 11:118100967-118100989 CTGGATTTGTCCCAGGAGGCTGG + Intronic
1090199906 11:124846475-124846497 CTGGGTCACCCCGGGGAGGCTGG - Intergenic
1090837089 11:130461653-130461675 CTGGGTTTGCCTGGGGAGCCTGG + Intronic
1091804616 12:3346849-3346871 CTGGGTATACCCTGGAAGGAAGG - Intergenic
1092264272 12:6969344-6969366 CTGCTTTGACCCCAGGAGGCAGG + Intronic
1094026821 12:25968426-25968448 ATTGGTTGAGCCCGGGAGGCGGG - Intronic
1097219297 12:57437869-57437891 ATGGCTTGAACCCGGGAGGCGGG - Intronic
1102405392 12:112669149-112669171 CTCCGTTTACCACAGGAGGCAGG + Intronic
1103729818 12:123020020-123020042 CTGGGTGTAGCCTGCGAGGCAGG + Intronic
1103969927 12:124664092-124664114 CTGGGGTTTGCCCGGGAGCCTGG + Intergenic
1104928833 12:132327927-132327949 CTGGGGTTACGCGGGCAGGCGGG - Intronic
1105471585 13:20700100-20700122 ATAGCTTTAACCCGGGAGGCAGG + Intergenic
1106716354 13:32392502-32392524 ATGGCTTGAACCCGGGAGGCGGG + Intronic
1110533403 13:76623128-76623150 CTGGGGTTTCCCCTGGAAGCAGG - Intergenic
1120810446 14:88798040-88798062 ATCGCTTGACCCCGGGAGGCAGG + Intergenic
1121218175 14:92264524-92264546 CACGGTTAACCCAGGGAGGCTGG - Intergenic
1122155704 14:99749163-99749185 CTGGGTGCACACCGGGAAGCGGG + Intronic
1123753755 15:23380323-23380345 CTCGCTTGAGCCCGGGAGGCTGG + Intergenic
1124369594 15:29096312-29096334 ATGGGTTTTCCACTGGAGGCTGG + Intronic
1125744454 15:41989108-41989130 CTGGGTTGGCCCCTGGAAGCAGG + Intronic
1126274092 15:46855882-46855904 CTGGGTTTACCCAGGACTGCAGG + Intergenic
1129845755 15:78767072-78767094 AGGGGCTTACCCTGGGAGGCAGG + Intronic
1135624539 16:23982512-23982534 ATTGGTTGAACCCGGGAGGCTGG - Intronic
1135952763 16:26930673-26930695 CAGGGTTTCCCCCGAAAGGCAGG + Intergenic
1137980657 16:53066563-53066585 CTGGGTTTCCCCTGTGAGACCGG - Intronic
1138557533 16:57781227-57781249 ATGGCTTGAGCCCGGGAGGCAGG + Intronic
1139232329 16:65295978-65296000 ATGGCTTGAACCCGGGAGGCGGG - Intergenic
1141013928 16:80429657-80429679 CTGAGATTACCCCGGGGGGCGGG + Intergenic
1142962061 17:3557345-3557367 CTGGGTCAGCCTCGGGAGGCAGG + Intronic
1144872225 17:18378367-18378389 CTGGGATGACCCCTGGAGCCTGG + Intronic
1145197632 17:20908620-20908642 CAGGGGTTAGCCCGGGTGGCGGG + Intergenic
1145245123 17:21263869-21263891 ATCGCTTTAGCCCGGGAGGCAGG + Intergenic
1146677296 17:34782262-34782284 ATGGGTTTATCCTGGGAGGCGGG + Intergenic
1148158700 17:45437694-45437716 CTGGGCTTTCTCTGGGAGGCCGG + Exonic
1150564848 17:66329581-66329603 CAGGGTTTGCCCAGAGAGGCAGG + Intronic
1151749044 17:76026655-76026677 CTGGGATGACCCCTGGAGCCTGG - Intronic
1155296680 18:24391012-24391034 ATGGCTTGAGCCCGGGAGGCAGG + Intronic
1160813151 19:1021980-1022002 ATGGCTTGAACCCGGGAGGCGGG - Intergenic
1161844121 19:6702091-6702113 CTGGCTGGTCCCCGGGAGGCAGG - Intronic
1162630339 19:11922778-11922800 CAGGGTTTCCCCGGGGAGTCTGG + Intergenic
1163588959 19:18179968-18179990 ATGGCTTGAACCCGGGAGGCAGG + Intergenic
1164503670 19:28840512-28840534 CAGGGTTTACTCCTGGAGGAAGG + Intergenic
1166709934 19:44930354-44930376 CTGGGCATACGCAGGGAGGCTGG + Intergenic
1167381973 19:49143456-49143478 ATGGCTTGAACCCGGGAGGCAGG - Intronic
1167621302 19:50562521-50562543 CTGCGTTTACCCCCTGGGGCTGG + Intronic
926128400 2:10285772-10285794 CTGGGCGGACCCAGGGAGGCTGG - Intergenic
929599044 2:43193634-43193656 CTGGGTTCAGCCCTGGAGCCTGG + Intergenic
933996599 2:87674600-87674622 CTGGGTGAACCCCAGGAGGAGGG - Intergenic
934853978 2:97717829-97717851 CTGCCTTTACCCAGGGAGGCTGG + Intronic
936297253 2:111276310-111276332 CTGGGTGAACCCCAGGAGGAGGG + Intergenic
937928657 2:127187944-127187966 CCAGTTTTACCCTGGGAGGCAGG - Intronic
937928788 2:127188707-127188729 CCAGTTTTACCCTGGGAGGCAGG - Intronic
942662581 2:178281994-178282016 CTGTGTGTACTCCGGGAAGCAGG - Intronic
944661176 2:201923247-201923269 CTGGGATTCTCCTGGGAGGCTGG - Intergenic
945368254 2:208983366-208983388 CTGGCTTGAACCTGGGAGGCTGG + Intergenic
946053123 2:216880498-216880520 ATGTCTTTGCCCCGGGAGGCAGG - Intergenic
947661459 2:231872156-231872178 ATTGCTTTAACCCGGGAGGCAGG - Intergenic
1168767084 20:388947-388969 CTTAGTTTACCCCAGGAGCCAGG - Intronic
1169921539 20:10739571-10739593 TTGGGATTATGCCGGGAGGCTGG - Intergenic
1171147488 20:22798132-22798154 CTGGGTTAACCCTGGGAAGCAGG - Intergenic
1171372073 20:24668610-24668632 GTGGGGGTACCCGGGGAGGCGGG - Intergenic
1172226629 20:33309726-33309748 CTGGGTTTCCACAAGGAGGCTGG - Exonic
1173648116 20:44646211-44646233 CTGTGTTCACACAGGGAGGCAGG - Intronic
1173874934 20:46364332-46364354 CTGGGAGTGCGCCGGGAGGCCGG + Intronic
1174567961 20:51480552-51480574 CTGGTGTTACCCGGGGAGGCGGG - Intronic
1178755374 21:35344643-35344665 CTGGGTTTTCCTCTGGAGACTGG + Intronic
1179149746 21:38799754-38799776 ATCGCTTTAGCCCGGGAGGCAGG - Intergenic
1179710619 21:43211083-43211105 CTCTGTTCACTCCGGGAGGCAGG + Intergenic
1180137071 21:45868740-45868762 CTGGGAAGAACCCGGGAGGCAGG + Intronic
1180737323 22:18027072-18027094 CTGGGTTAAGCCAGGGATGCCGG + Intergenic
1181495356 22:23284490-23284512 CTGGGTGAACCCAGGGAGGAGGG - Intronic
1183811287 22:40259845-40259867 CTGACGTTACCCTGGGAGGCAGG + Intronic
1183952587 22:41359856-41359878 CTGTGTTCCCCCCGGCAGGCAGG + Exonic
1184122055 22:42458039-42458061 ATGGCTTGAACCCGGGAGGCGGG + Intergenic
1184640717 22:45868560-45868582 CTTGGCTTAGCCCGGGAGGCCGG - Intergenic
1184924391 22:47626768-47626790 CTAGGTTCACCCCAGAAGGCTGG - Intergenic
1185039579 22:48497479-48497501 CTGGGTTTAGGCCTGGGGGCGGG + Intronic
1185088337 22:48752661-48752683 CTGGGTTTCTCCTGGGAGGGAGG + Intronic
1185221098 22:49629644-49629666 CTGGGTTCAAACAGGGAGGCTGG + Intronic
1185221119 22:49629708-49629730 CTGGGTTCAAACAGGGAGGCTGG + Intronic
1185272424 22:49935429-49935451 CTGGGCTTTCCCCGGCGGGCGGG + Intergenic
1185279042 22:49962167-49962189 CTGGGTCTGCGCCGGGAGCCTGG + Intronic
1185342960 22:50299770-50299792 CAGAGTTCAGCCCGGGAGGCGGG + Intronic
1185379956 22:50503741-50503763 CTGGGTTTACCCCGGGAGGCTGG + Intronic
1185395051 22:50582553-50582575 GAGGGTTTACCCCGTGAGGTGGG - Exonic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
950650124 3:14402121-14402143 CTCGGTATGCCCCGGGAGGGTGG - Intergenic
953016127 3:39078502-39078524 ATGGCTTGAACCCGGGAGGCAGG - Intronic
953850372 3:46462049-46462071 CTGGGATTTCCCCGGGATGAGGG - Intronic
957228323 3:77477487-77477509 CTGGGTGTCCCCGGGGAGGCTGG - Exonic
961906140 3:130264603-130264625 CTGGCTTTTCCCAGGGATGCTGG - Intergenic
962594448 3:136926358-136926380 ATGGCTTGAACCCGGGAGGCGGG - Intronic
963864626 3:150347198-150347220 CTGGGTTTTCTCCTGAAGGCAGG + Intergenic
967202224 3:187082276-187082298 ATCGCTTGACCCCGGGAGGCGGG - Intergenic
968453806 4:687285-687307 CGGGGCTCACTCCGGGAGGCAGG + Intronic
969430412 4:7150639-7150661 CTGGGTTTCTCCCGGGATGGGGG + Intergenic
971132766 4:23831779-23831801 GTGAGTTGACCCTGGGAGGCAGG + Intronic
972287686 4:37664299-37664321 CCGGGTTGAACCTGGGAGGCAGG + Intronic
972852099 4:43063149-43063171 CTTGCTTGAACCCGGGAGGCAGG - Intergenic
984577908 4:181472771-181472793 CCAGGTTTAACCCGGCAGGCTGG - Intergenic
985559263 5:574250-574272 CTGGGTAGACCCCGGGAGGTGGG - Intergenic
987703802 5:21437166-21437188 CTGGGTTTATTCAGGCAGGCAGG - Intergenic
990626502 5:57618591-57618613 CTGGGTTTTCCCCAGGTGGCTGG - Intergenic
991702032 5:69325238-69325260 ATGGCTTGAACCCGGGAGGCAGG + Intronic
998085275 5:139316631-139316653 ATAGCTTTAACCCGGGAGGCAGG - Intronic
999279138 5:150353459-150353481 CTGAGTTTAGGCCTGGAGGCAGG - Intergenic
999297047 5:150466206-150466228 CTGGGTTTCCCCTCGGAGGAAGG - Intergenic
999777388 5:154822001-154822023 ATGGCTTGAACCCGGGAGGCGGG + Intronic
1002640789 5:180629695-180629717 CTGGGACTACCCAGGGAAGCAGG - Exonic
1006720297 6:36145677-36145699 CTGGGTGTGCCCGGGAAGGCTGG + Intergenic
1006902908 6:37514488-37514510 CTGGGCCTCCCCAGGGAGGCAGG - Intergenic
1007284261 6:40736424-40736446 CTGGGCCTGCCCTGGGAGGCAGG - Intergenic
1007641251 6:43341562-43341584 ATGGGGTGAACCCGGGAGGCGGG + Intronic
1008914503 6:56772772-56772794 CTGGGATTCCTCCTGGAGGCTGG - Intronic
1013441428 6:110174227-110174249 CTGGATTTACACTGGGAGTCAGG - Intronic
1019299895 7:297629-297651 CTGGGCTGACCCCGGGACACTGG - Intergenic
1019335520 7:480843-480865 CTGGGGCTTCTCCGGGAGGCTGG - Intergenic
1023016004 7:35968953-35968975 CTGGGGGAACCCCGGGAGCCAGG + Intergenic
1024671592 7:51600477-51600499 CTGGGTGTCCCTGGGGAGGCTGG + Intergenic
1025615384 7:63113076-63113098 CTGGGTCTACCCGGCCAGGCGGG + Intergenic
1027054191 7:75038860-75038882 CTGGGTTTCCCCCCGGAGGCAGG - Intronic
1031966672 7:128032187-128032209 CGGCGTTAACCCCGCGAGGCAGG - Intronic
1033676616 7:143546430-143546452 ATGGCGTTAACCCGGGAGGCGGG - Intergenic
1033695217 7:143783003-143783025 ATGGCGTTAACCCGGGAGGCGGG + Intergenic
1035670877 8:1416307-1416329 CTGGGCTGACCACGGGAAGCTGG - Intergenic
1036024995 8:4896925-4896947 TTGGGTTTGCCCAGGGAGACAGG - Intronic
1036170089 8:6475475-6475497 CTGGGTTTTCCCCGGGATGCTGG - Intronic
1037765686 8:21770905-21770927 CTGGTTTCACCTGGGGAGGCAGG - Intronic
1037920723 8:22803576-22803598 ATGGCTTGAACCCGGGAGGCAGG + Intronic
1040355826 8:46617481-46617503 CTGGGGCTGCCCCGGGAGGAAGG - Intergenic
1045095651 8:98794980-98795002 ATGGCTTGAACCCGGGAGGCAGG + Intronic
1045162524 8:99564487-99564509 CTGGGGTAAGGCCGGGAGGCTGG + Intronic
1045683598 8:104688651-104688673 CTGGGTCTCCCCCTGGAGGTAGG - Intronic
1048291438 8:133184661-133184683 CTAGGTCTACTCTGGGAGGCTGG - Intergenic
1049186315 8:141256046-141256068 CTGGGTTTGTCACTGGAGGCAGG - Intronic
1050554911 9:6781137-6781159 CTGAATTTACCCCTGTAGGCTGG + Intronic
1054678565 9:67884802-67884824 ATGGCTTGAACCCGGGAGGCGGG + Intronic
1057773173 9:97984491-97984513 CTGCCCTTGCCCCGGGAGGCTGG + Intronic
1060764223 9:126281862-126281884 CTGGGGTCAGCCTGGGAGGCAGG - Intergenic
1062120429 9:134831151-134831173 CTGTGTCCACCCAGGGAGGCTGG - Intronic
1062125032 9:134855619-134855641 CTGGGATGCCCCCGGGAGGGAGG - Intergenic
1185454550 X:302113-302135 CTGGGTTTGGCTCGGGAGGCAGG - Exonic
1185530776 X:816648-816670 ATGGCTTGAACCCGGGAGGCGGG + Intergenic
1185701689 X:2235655-2235677 ATGGCTTGAACCCGGGAGGCAGG + Intronic
1186360238 X:8833499-8833521 CTGAGTTTTCCCCGTGAGGGAGG + Intergenic
1197705274 X:129630284-129630306 CTGTGTCTACCCCAGCAGGCAGG + Intergenic
1199342215 X:146694312-146694334 ATCGGTTGAACCCGGGAGGCCGG - Intergenic
1199760148 X:150898784-150898806 CTGGGGTTAGGCCGGGGGGCGGG + Intronic
1200094777 X:153652261-153652283 CTGGGGTTAGCCCAGGAGCCAGG + Intergenic
1200714284 Y:6520294-6520316 GTAGGCTTACCCCGGGAGGCTGG + Intergenic
1201019538 Y:9640863-9640885 GTAGGCTTACCCCGGGAGGCTGG - Intergenic