ID: 1185379957

View in Genome Browser
Species Human (GRCh38)
Location 22:50503742-50503764
Sequence TGGGTTTACCCCGGGAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185379944_1185379957 20 Left 1185379944 22:50503699-50503721 CCTGTGGGAGGGAGGGAGGGAGG 0: 2
1: 15
2: 73
3: 311
4: 1370
Right 1185379957 22:50503742-50503764 TGGGTTTACCCCGGGAGGCTGGG 0: 1
1: 0
2: 3
3: 8
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185379957 Original CRISPR TGGGTTTACCCCGGGAGGCT GGG Intronic
900411696 1:2515484-2515506 TGGCTTTGCCCCCGGAGCCTTGG + Intronic
903569974 1:24297159-24297181 TTGCTTTACCCTGAGAGGCTGGG + Intergenic
907230010 1:52988768-52988790 TGGCTTGAACCCGGGAGGCAGGG - Intronic
909922550 1:81400451-81400473 TGATTTTACCCCGGGAGACTGGG + Intronic
913123113 1:115760062-115760084 TGGGAGAACCCCGGGAGGCCTGG + Intronic
917586061 1:176426947-176426969 TGGGTATACCCAGGAAAGCTTGG + Intergenic
919942240 1:202296192-202296214 TGGGGTCATCCTGGGAGGCTAGG + Intronic
924254207 1:242166116-242166138 TGGGTTTTCCCTGGGACACTGGG + Intronic
1073203292 10:101753574-101753596 TGGGATTACCCAGACAGGCTGGG - Intergenic
1076434023 10:130427324-130427346 TGGATTGACCCAGGGAGGATGGG + Intergenic
1076527144 10:131119006-131119028 TGGGTCTCCCCCAGGAGGTTTGG + Intronic
1078658689 11:13266510-13266532 TGGCTTGAACCCGGGAGGCAGGG + Intergenic
1079802429 11:24887144-24887166 TGGGTTTTCCCCAGGATGCCAGG - Intronic
1082076860 11:47981245-47981267 GAGGCTTTCCCCGGGAGGCTCGG - Intronic
1084564486 11:69921395-69921417 TGGGGTGACCCAGAGAGGCTGGG + Intergenic
1089314955 11:117585332-117585354 TTGCTTGAACCCGGGAGGCTGGG - Intronic
1090199905 11:124846474-124846496 TGGGTCACCCCGGGGAGGCTGGG - Intergenic
1090432406 11:126656965-126656987 TGGCTTGAACCCAGGAGGCTAGG + Intronic
1091585727 12:1815426-1815448 TGGCTTTATCTCGGGAGGCCAGG - Intronic
1092531654 12:9350136-9350158 TGGCCTTCGCCCGGGAGGCTTGG + Intergenic
1094026820 12:25968425-25968447 TTGGTTGAGCCCGGGAGGCGGGG - Intronic
1094502524 12:31033944-31033966 TGGCCTTCGCCCGGGAGGCTTGG + Intergenic
1097219296 12:57437868-57437890 TGGCTTGAACCCGGGAGGCGGGG - Intronic
1097475256 12:60047334-60047356 GGGTTTTACTCCGGCAGGCTTGG + Intergenic
1105471586 13:20700101-20700123 TAGCTTTAACCCGGGAGGCAGGG + Intergenic
1106716355 13:32392503-32392525 TGGCTTGAACCCGGGAGGCGGGG + Intronic
1109422719 13:62134749-62134771 TGGCGTGAACCCGGGAGGCTGGG - Intergenic
1115851870 14:37595497-37595519 TTGGTTTAGGCCCGGAGGCTAGG + Intronic
1119057925 14:71442086-71442108 TGGCTTGAACCTGGGAGGCTGGG + Intronic
1120810447 14:88798041-88798063 TCGCTTGACCCCGGGAGGCAGGG + Intergenic
1123753756 15:23380324-23380346 TCGCTTGAGCCCGGGAGGCTGGG + Intergenic
1124369595 15:29096313-29096335 TGGGTTTTCCACTGGAGGCTGGG + Intronic
1128182892 15:65620613-65620635 TGGGTTTACCCCCAGCGGGTAGG + Intronic
1130995396 15:88900628-88900650 TGGGTTTACACCTGGATGTTGGG - Intronic
1131160703 15:90102834-90102856 TGGGTTCAGCCCGGCAGGCGAGG - Intergenic
1134516669 16:14893114-14893136 TGAGTTTACCCAGTGAGGCCTGG + Intronic
1134704338 16:16291767-16291789 TGAGTTTACCCAGTGAGGCCTGG + Intronic
1134963205 16:18420347-18420369 TGAGTTTACCCAGTGAGGCCTGG - Intronic
1134967500 16:18502946-18502968 TGAGTTTACCCAGTGAGGCCTGG - Intronic
1135624538 16:23982511-23982533 TTGGTTGAACCCGGGAGGCTGGG - Intronic
1138557534 16:57781228-57781250 TGGCTTGAGCCCGGGAGGCAGGG + Intronic
1139232328 16:65295977-65295999 TGGCTTGAACCCGGGAGGCGGGG - Intergenic
1140087520 16:71809991-71810013 TTGCTTGACCCCGGGAGGCAAGG - Intergenic
1142173325 16:88634062-88634084 TGGGTTTTCCCCGGCAGGAGTGG - Intergenic
1142340464 16:89518855-89518877 TGGGATGACCCCGGGGAGCTTGG + Intronic
1144872226 17:18378368-18378390 TGGGATGACCCCTGGAGCCTGGG + Intronic
1145245124 17:21263870-21263892 TCGCTTTAGCCCGGGAGGCAGGG + Intergenic
1145975078 17:28979169-28979191 TGAGATAACCCAGGGAGGCTGGG + Intronic
1145990760 17:29078099-29078121 TCGCTTGAACCCGGGAGGCTCGG - Exonic
1147872821 17:43599587-43599609 TGGCTTGAGCCCGGGAGGTTGGG + Intergenic
1149016421 17:51913720-51913742 AGGGATGACCCTGGGAGGCTGGG + Intronic
1151652200 17:75476983-75477005 AGGGTATCCCCTGGGAGGCTTGG - Intronic
1151749043 17:76026654-76026676 TGGGATGACCCCTGGAGCCTGGG - Intronic
1152625209 17:81385008-81385030 TGGGTCTTCCCGCGGAGGCTGGG + Intergenic
1153615426 18:6929467-6929489 GGTGTAGACCCCGGGAGGCTGGG - Intergenic
1155296681 18:24391013-24391035 TGGCTTGAGCCCGGGAGGCAGGG + Intronic
1159874361 18:73793732-73793754 TGGATTTACCCCTGGACCCTGGG - Intergenic
1160813150 19:1021979-1022001 TGGCTTGAACCCGGGAGGCGGGG - Intergenic
1161265682 19:3362889-3362911 TGGGGTTACCATGGGGGGCTGGG + Intronic
1161453076 19:4357473-4357495 GGGGTTGGCCCTGGGAGGCTCGG - Intronic
1162467055 19:10848674-10848696 TGGGTTTTCCCCCTGAGCCTTGG + Intronic
1163159976 19:15458539-15458561 TGGGGCTCCCCCAGGAGGCTGGG + Exonic
1163588960 19:18179969-18179991 TGGCTTGAACCCGGGAGGCAGGG + Intergenic
1166730066 19:45054142-45054164 TGGGCTTGCCCAGGGAGGTTTGG + Intronic
1167381972 19:49143455-49143477 TGGCTTGAACCCGGGAGGCAGGG - Intronic
926349623 2:11983224-11983246 TGGGCTTATCCAGGCAGGCTAGG + Intergenic
927458133 2:23275144-23275166 TTAGTTTACCCAGGGAGGCATGG - Intergenic
930901519 2:56512489-56512511 TTTGTTTACTCAGGGAGGCTGGG - Intergenic
934853979 2:97717830-97717852 TGCCTTTACCCAGGGAGGCTGGG + Intronic
936011693 2:108929189-108929211 TGTGCTTACCCAGGGAGGCAAGG + Exonic
937366052 2:121262378-121262400 TGGCTTGAACCCGGGAGGCGAGG + Intronic
946053122 2:216880497-216880519 TGTCTTTGCCCCGGGAGGCAGGG - Intergenic
947661458 2:231872155-231872177 TTGCTTTAACCCGGGAGGCAGGG - Intergenic
1174567960 20:51480551-51480573 TGGTGTTACCCGGGGAGGCGGGG - Intronic
1174629631 20:51945051-51945073 TTGGTTGAACCCGGGAGACTTGG + Intergenic
1174629636 20:51945070-51945092 TTGGTTGAACCCGGGAGACTTGG + Intergenic
1175983431 20:62752744-62752766 TGGGTTTATCTCCTGAGGCTGGG + Intronic
1178755375 21:35344644-35344666 TGGGTTTTCCTCTGGAGACTGGG + Intronic
1179149745 21:38799753-38799775 TCGCTTTAGCCCGGGAGGCAGGG - Intergenic
1183905632 22:41038152-41038174 TCACTTGACCCCGGGAGGCTCGG - Intergenic
1184248269 22:43246432-43246454 TGTGTGTGCCCAGGGAGGCTTGG + Intronic
1184640716 22:45868559-45868581 TTGGCTTAGCCCGGGAGGCCGGG - Intergenic
1185221099 22:49629645-49629667 TGGGTTCAAACAGGGAGGCTGGG + Intronic
1185221120 22:49629709-49629731 TGGGTTCAAACAGGGAGGCTGGG + Intronic
1185379957 22:50503742-50503764 TGGGTTTACCCCGGGAGGCTGGG + Intronic
953016126 3:39078501-39078523 TGGCTTGAACCCGGGAGGCAGGG - Intronic
961906139 3:130264602-130264624 TGGCTTTTCCCAGGGATGCTGGG - Intergenic
962594447 3:136926357-136926379 TGGCTTGAACCCGGGAGGCGGGG - Intronic
965943436 3:174212024-174212046 TGGTGTTCGCCCGGGAGGCTCGG + Intronic
967564175 3:190954249-190954271 TGGTGTGAACCCGGGAGGCTGGG + Intergenic
968081470 3:195849518-195849540 TGGGGCTGCCCCGGGAGGCCCGG - Intergenic
975096990 4:70468069-70468091 TGGCTTTACCCCGGGATGCAAGG + Intronic
978336911 4:107679052-107679074 TGCTTTCACCCTGGGAGGCTTGG - Intronic
981998865 4:151003705-151003727 TTGCTTGAGCCCGGGAGGCTGGG + Intronic
985559262 5:574249-574271 TGGGTAGACCCCGGGAGGTGGGG - Intergenic
986946843 5:13031496-13031518 TGGGTTTACTCAGGTAGGCTAGG - Intergenic
990626501 5:57618590-57618612 TGGGTTTTCCCCAGGTGGCTGGG - Intergenic
991037738 5:62144808-62144830 TGGGTATACTTGGGGAGGCTTGG + Intergenic
991702033 5:69325239-69325261 TGGCTTGAACCCGGGAGGCAGGG + Intronic
993705022 5:91160049-91160071 TGGGATAACACCAGGAGGCTAGG - Intronic
998085274 5:139316630-139316652 TAGCTTTAACCCGGGAGGCAGGG - Intronic
1002539342 5:179895610-179895632 CTGTTTTACCCCAGGAGGCTTGG - Intronic
1007641252 6:43341563-43341585 TGGGGTGAACCCGGGAGGCGGGG + Intronic
1012987709 6:105892771-105892793 GGGGTTGACACTGGGAGGCTGGG - Intergenic
1013907454 6:115235875-115235897 TGGGGGTACCCCCGGAGGTTAGG + Intergenic
1016363845 6:143294922-143294944 TGGGTTTACCTAGGGAGAGTGGG - Intronic
1019095084 6:169573094-169573116 CAGGTGCACCCCGGGAGGCTCGG - Intronic
1019299894 7:297628-297650 TGGGCTGACCCCGGGACACTGGG - Intergenic
1022129788 7:27394497-27394519 TGGGTGAACCCAGGGAGCCTTGG - Intergenic
1024047158 7:45592638-45592660 TGGGTTTGGCCCGGGCGGCGTGG + Intronic
1028540817 7:91940762-91940784 AGGGTTGACCCCGGAGGGCTGGG + Intergenic
1030020060 7:105264886-105264908 TGGGTTTACCTAGGCAGACTGGG + Intronic
1033676615 7:143546429-143546451 TGGCGTTAACCCGGGAGGCGGGG - Intergenic
1033695218 7:143783004-143783026 TGGCGTTAACCCGGGAGGCGGGG + Intergenic
1036170088 8:6475474-6475496 TGGGTTTTCCCCGGGATGCTGGG - Intronic
1037319384 8:17629419-17629441 TGGGTTTAGACCAAGAGGCTGGG - Intronic
1037920724 8:22803577-22803599 TGGCTTGAACCCGGGAGGCAGGG + Intronic
1045095652 8:98794981-98795003 TGGCTTGAACCCGGGAGGCAGGG + Intronic
1049578300 8:143399654-143399676 GGGGTGTGTCCCGGGAGGCTGGG + Intergenic
1050554912 9:6781138-6781160 TGAATTTACCCCTGTAGGCTGGG + Intronic
1050906109 9:11008689-11008711 TGGATTTACCCAGGGATGCAAGG - Intergenic
1051324768 9:15953507-15953529 TGGGTTTACCCCAGGATGCAAGG - Intronic
1054678566 9:67884803-67884825 TGGCTTGAACCCGGGAGGCGGGG + Intronic
1057969686 9:99542452-99542474 TGGCTTTCCCTGGGGAGGCTTGG + Intergenic
1061701652 9:132420779-132420801 TGGGTTTACCCCTGTATCCTTGG - Intronic
1062120428 9:134831150-134831172 TGTGTCCACCCAGGGAGGCTGGG - Intronic
1062261046 9:135663567-135663589 AGGGGTTACTCCGGGAGGGTCGG + Intronic
1185530777 X:816649-816671 TGGCTTGAACCCGGGAGGCGGGG + Intergenic
1185871963 X:3672108-3672130 TGGCTTAAGCCCGGGAGGTTGGG + Intronic
1192266667 X:69543443-69543465 TGGGTTGACTCCCAGAGGCTGGG + Intergenic
1192947533 X:75982306-75982328 TTGGTTTACTCAGGGAGGGTAGG + Intergenic
1196109451 X:111930514-111930536 TAGCTTGAACCCGGGAGGCTGGG + Intronic
1198671710 X:139088206-139088228 TGGGTAAACCCCCAGAGGCTGGG - Intronic
1199342214 X:146694311-146694333 TCGGTTGAACCCGGGAGGCCGGG - Intergenic
1200690758 Y:6305219-6305241 GAGGGTTACCCCAGGAGGCTGGG - Intergenic
1200714285 Y:6520295-6520317 TAGGCTTACCCCGGGAGGCTGGG + Intergenic
1200831160 Y:7689696-7689718 GAGGCTTACCCCGGGAGACTGGG - Intergenic
1201019537 Y:9640862-9640884 TAGGCTTACCCCGGGAGGCTGGG - Intergenic
1201044514 Y:9869497-9869519 GAGGGTTACCCCAGGAGGCTGGG + Intergenic