ID: 1185380786

View in Genome Browser
Species Human (GRCh38)
Location 22:50506707-50506729
Sequence GACTCAGGTAAGGTAGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 193}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185380775_1185380786 22 Left 1185380775 22:50506662-50506684 CCCACCTGCGGAGAGAGGGGCTG 0: 1
1: 0
2: 1
3: 25
4: 203
Right 1185380786 22:50506707-50506729 GACTCAGGTAAGGTAGAGGCAGG 0: 1
1: 0
2: 1
3: 9
4: 193
1185380777_1185380786 18 Left 1185380777 22:50506666-50506688 CCTGCGGAGAGAGGGGCTGTCAG 0: 1
1: 0
2: 1
3: 21
4: 190
Right 1185380786 22:50506707-50506729 GACTCAGGTAAGGTAGAGGCAGG 0: 1
1: 0
2: 1
3: 9
4: 193
1185380776_1185380786 21 Left 1185380776 22:50506663-50506685 CCACCTGCGGAGAGAGGGGCTGT 0: 1
1: 0
2: 0
3: 20
4: 169
Right 1185380786 22:50506707-50506729 GACTCAGGTAAGGTAGAGGCAGG 0: 1
1: 0
2: 1
3: 9
4: 193
1185380771_1185380786 27 Left 1185380771 22:50506657-50506679 CCTGGCCCACCTGCGGAGAGAGG 0: 1
1: 0
2: 1
3: 15
4: 240
Right 1185380786 22:50506707-50506729 GACTCAGGTAAGGTAGAGGCAGG 0: 1
1: 0
2: 1
3: 9
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185380786 Original CRISPR GACTCAGGTAAGGTAGAGGC AGG Intronic
902873614 1:19328408-19328430 GGCACAGCTAAGGTAGCGGCTGG + Intronic
903439218 1:23374872-23374894 GAGTCAGGCAGGGTAGATGCAGG + Intergenic
904670771 1:32163307-32163329 GACCCAGGTAAGAAAGAGGAGGG + Exonic
905166471 1:36086035-36086057 AGCTCTGGTAAGGGAGAGGCAGG + Exonic
910942443 1:92551271-92551293 CACTTAGGGAAGGCAGAGGCGGG - Intronic
911144574 1:94540689-94540711 GACTCAGCTCAGGAAGAGTCAGG + Intronic
912944960 1:114077262-114077284 AACTCAGGAAAGATAGAGGAGGG + Intergenic
913528170 1:119713154-119713176 GGATCAGGTGAGGTAGAGACTGG - Intronic
914265656 1:146036220-146036242 CACTTTGGTAAGGCAGAGGCGGG - Intergenic
915487287 1:156230579-156230601 GACACAGGCAAGGGAGAGGGAGG + Intronic
916149375 1:161771564-161771586 GAATCAGGAGAGGTAGAGGATGG - Intronic
918692682 1:187501364-187501386 GACTCAGGCAAGGAAGAGAGAGG + Intergenic
918761767 1:188419518-188419540 GACTCAGGGAAGGTACCAGCAGG + Intergenic
920267514 1:204735037-204735059 GACTTAGGTTAGGTGGAGGAGGG + Intergenic
923566324 1:235079380-235079402 AAGGCAGGTAAAGTAGAGGCTGG - Intergenic
1063161350 10:3421029-3421051 GACTCAGGTAGGGTGCAGGTGGG + Intergenic
1063545845 10:6980756-6980778 GACACAGGGGAGGCAGAGGCAGG - Intergenic
1063829099 10:9931775-9931797 GAGCCATGTAAGGTAGAGGAAGG - Intergenic
1066571116 10:36773183-36773205 AACTCACGGAAGGCAGAGGCAGG - Intergenic
1067158901 10:43806149-43806171 GACAGAGGCAGGGTAGAGGCAGG - Intergenic
1068554118 10:58439125-58439147 GGTTCAGGTAAGATACAGGCAGG + Intergenic
1069784878 10:70981497-70981519 GACTCGGGTCAGGCTGAGGCTGG + Intergenic
1070425610 10:76284285-76284307 GACTCAGGGAAGTCAGAGTCAGG + Intronic
1070917421 10:80163838-80163860 GACTAATGTAAGGGAGAGGCAGG - Intronic
1071514237 10:86286635-86286657 GAATCAGGTCAGATAGAGGCAGG + Intronic
1076706430 10:132304465-132304487 GCCTCAGGTCTGGAAGAGGCTGG + Intronic
1076888834 10:133274379-133274401 GCCTCAGGCAGGGTAGAGGGTGG + Intronic
1077867486 11:6234907-6234929 GCCTCTGGGAAGGTGGAGGCCGG + Intronic
1078459325 11:11501629-11501651 AACTCAGGCAAGGTAGAAACAGG - Intronic
1080350162 11:31375279-31375301 GAATCAGGTGAGGTAGTGGATGG - Intronic
1081024064 11:37986679-37986701 GCCTGAAGCAAGGTAGAGGCAGG - Intergenic
1081736001 11:45404678-45404700 GACTCAGGGAAGTGAGAGTCAGG - Intergenic
1085785396 11:79443806-79443828 GACTTAGGAAGAGTAGAGGCAGG + Intergenic
1087901637 11:103648102-103648124 GACTAAGCTAGGCTAGAGGCTGG + Intergenic
1089272311 11:117310153-117310175 CACTCAGGTGAGGCCGAGGCGGG - Intronic
1089534745 11:119154137-119154159 GATACAGGTAAGGAAGAGACTGG + Exonic
1089917786 11:122175738-122175760 TACTCAGGAAAGGTAGAGGCAGG + Intergenic
1090037844 11:123264227-123264249 GAGACAGGAAAGCTAGAGGCAGG - Intergenic
1090102724 11:123817367-123817389 GACTCAGGAAAGCCAGAGGACGG + Intergenic
1094160340 12:27383479-27383501 CACTGAGGCATGGTAGAGGCTGG - Intronic
1096596411 12:52698707-52698729 GGCTGAGGAAAGGTGGAGGCTGG - Intronic
1096810602 12:54167221-54167243 GCCTCAGGCAAGGGAGAGGAAGG - Intronic
1100695258 12:97085674-97085696 GACTCAGGTAGTGGAGAGGCAGG - Intergenic
1101234941 12:102778952-102778974 TACTTAGGAAAGTTAGAGGCAGG + Intergenic
1102558705 12:113747086-113747108 GACAGAGGGAAAGTAGAGGCTGG - Intergenic
1102610693 12:114109467-114109489 GACTCAGGGAAAGTAGATGGGGG + Intergenic
1103218558 12:119223757-119223779 GACTCAGGGCAGGGAGAGGAGGG - Intergenic
1103242907 12:119429715-119429737 GACTCCTGGAAGGTAGAGGAAGG + Intronic
1104630621 12:130398596-130398618 CTCTCTCGTAAGGTAGAGGCAGG + Exonic
1106649640 13:31676415-31676437 GACTCAGGTCTGGTGGAAGCAGG - Intergenic
1107432197 13:40350202-40350224 GACTCAGGTGACCTGGAGGCTGG - Intergenic
1113673022 13:112187844-112187866 GACTCAGGCAATGTGGAGGGTGG - Intergenic
1115374344 14:32656896-32656918 CACTCAGGAAAGGTATAAGCAGG - Intronic
1118566429 14:67146090-67146112 CACTAAGATCAGGTAGAGGCTGG + Intronic
1119635904 14:76273270-76273292 GAGTCAGGCAGGCTAGAGGCTGG + Intergenic
1121001653 14:90455539-90455561 GACGCAGGCAAGGAAGAGGAGGG - Intergenic
1125597252 15:40894853-40894875 CACTCGGGTAAGGAAGAGGAGGG + Exonic
1126164468 15:45642843-45642865 GATTCAGATAAGATAGAGGCTGG - Intronic
1128259862 15:66225464-66225486 GAGCCTGGTAAGGTAGAGGGTGG - Intronic
1129138828 15:73578347-73578369 AACCCAGGCAAGGGAGAGGCTGG + Intronic
1129740438 15:77987151-77987173 GCCTCAGGGAAGGCAGGGGCAGG + Intronic
1129845318 15:78765444-78765466 GCCTCAGGGAAGGCAGGGGCAGG - Intronic
1129908280 15:79205278-79205300 GACTCAGGACAGGGAGAGGGAGG - Intergenic
1130256529 15:82328414-82328436 GCCTCAGGGAAGGCAGGGGCAGG + Intergenic
1130598423 15:85261574-85261596 GCCTCAGGGAAGGCAGGGGCAGG - Intergenic
1131374782 15:91914679-91914701 TACTCAGGGAAGGCTGAGGCAGG - Intronic
1132043597 15:98546240-98546262 GAAGCAGGTAAGGCACAGGCAGG + Intergenic
1133925715 16:10190396-10190418 GACTCAGGTAATGTGGAGAAGGG - Intergenic
1134765315 16:16752252-16752274 AACTCAAGAAAGGTAGGGGCTGG - Intergenic
1134980741 16:18606959-18606981 AACTCAAGAAAGGTAGGGGCTGG + Intergenic
1135899589 16:26444594-26444616 GATTCAGGGAAGGTGGAGGAGGG + Intergenic
1137716587 16:50601927-50601949 GACCCAGGGATGGGAGAGGCTGG - Intronic
1137766181 16:50979399-50979421 GTCACAGGTAAGTCAGAGGCTGG - Intergenic
1138105392 16:54284953-54284975 GACTCAGGACCGGTAGTGGCCGG + Exonic
1139153337 16:64411260-64411282 GAATCAGGGAGGGTAGAGGAGGG - Intergenic
1139607899 16:68032974-68032996 GACACAGGTGAGGGTGAGGCTGG + Intronic
1140113296 16:72021439-72021461 GACTCTGGGAAGGTATAGCCAGG - Intronic
1140221436 16:73047499-73047521 GACTCAGGAAAGGAGGAGGGAGG + Intronic
1140455116 16:75100479-75100501 GATTCAGGGAAGGGAGAGGCAGG - Intronic
1140708472 16:77653805-77653827 GACTCAGGGGAGGAAGAGGAGGG + Intergenic
1141217473 16:82038669-82038691 GCCTAAGGCAAGGTAGATGCAGG - Intronic
1141951039 16:87339561-87339583 GTCCCAGGTAGGGCAGAGGCTGG - Intronic
1142154016 16:88525041-88525063 TACTCAGGCAAGGTTCAGGCGGG - Intronic
1146060100 17:29600440-29600462 GACCCAGGTAGGGAAGGGGCTGG + Intronic
1146719483 17:35113704-35113726 GAATCAGGAGTGGTAGAGGCTGG - Intronic
1149446278 17:56715694-56715716 AGTCCAGGTAAGGTAGAGGCTGG + Intergenic
1151587704 17:75020710-75020732 TACACAGGTAAGGAAGGGGCAGG + Intronic
1152262917 17:79276901-79276923 GACTCAGGGCTGGTACAGGCTGG + Intronic
1152573168 17:81129257-81129279 GACCCAGAGAATGTAGAGGCGGG + Intronic
1161194328 19:2977705-2977727 GACTGAGGCAAGGAAGAAGCTGG + Intronic
1162192116 19:8955162-8955184 GAGTCAGCTAAGGCAGAGGAAGG + Exonic
1162417590 19:10547296-10547318 GAATCGGGTAAGGCAGAGTCTGG - Intronic
1162524087 19:11197495-11197517 GACCCAGGGAAGGCAGCGGCCGG - Exonic
1164523688 19:28998228-28998250 GACACAAGTAAGCCAGAGGCCGG + Intergenic
1164560691 19:29290069-29290091 AATTCAGGGAAGGTAGAGGAAGG + Intergenic
1164602893 19:29575503-29575525 GACTCAGGGGAAGGAGAGGCTGG + Intergenic
1166738684 19:45101313-45101335 GACTTAGTTGAGGTAGAGGCAGG + Intronic
1167375889 19:49111551-49111573 GAGTTAGGAGAGGTAGAGGCTGG + Intergenic
1168612867 19:57814930-57814952 TGCGCAAGTAAGGTAGAGGCGGG - Intronic
926218892 2:10922329-10922351 GACTCAGTTAAGGTGGCAGCAGG - Intergenic
929276563 2:40032253-40032275 TACTAAGAGAAGGTAGAGGCGGG + Intergenic
932110697 2:68996741-68996763 GAATAAGGAAATGTAGAGGCTGG - Intergenic
932621221 2:73265786-73265808 GACCCAGGGAGGGTAGGGGCAGG + Intronic
932679730 2:73814701-73814723 GACTAGGGTAAGGTAGAGAGTGG - Intronic
937690169 2:124746645-124746667 GACTCAGGTGAAGAAGAGGTTGG - Intronic
938289940 2:130143772-130143794 CACTCAGGTAAGGCAGCAGCAGG + Intronic
942004540 2:171684953-171684975 GAAAGAGGTAAGGTAGAGACTGG - Intergenic
944907412 2:204276334-204276356 GACTTAGGTAAGATTTAGGCTGG - Intergenic
947832654 2:233152750-233152772 GACTCAGACAAGGCTGAGGCTGG + Intronic
947963559 2:234260033-234260055 GACTGAGGTGAGGCTGAGGCTGG - Intergenic
948026540 2:234782511-234782533 CACTCAGGTGTGGCAGAGGCTGG - Intergenic
948446032 2:238033546-238033568 GACTCAGTTAAACTAGGGGCGGG + Intronic
948858148 2:240740208-240740230 GACACAGGCAGGGTAGGGGCAGG + Intronic
1168854413 20:998649-998671 GACTCAGGCATGGGGGAGGCTGG + Intronic
1169509210 20:6245512-6245534 GACTCAGATAAGCTATTGGCAGG - Intergenic
1170625456 20:18026785-18026807 AGGTCAGGTAAGGTAGTGGCAGG + Intronic
1171146263 20:22786321-22786343 TTCTCAGATAAGGTAGAGGGAGG - Intergenic
1172497095 20:35395288-35395310 GACTCTTGGAGGGTAGAGGCTGG - Intronic
1174744210 20:53045546-53045568 GAATCAGGATAGGTAGAGCCTGG - Intronic
1175965206 20:62656912-62656934 GACGAAGGTGAGGCAGAGGCAGG - Exonic
1177871272 21:26575542-26575564 GACACAGATCAGGAAGAGGCTGG + Intergenic
1178052983 21:28768248-28768270 GAGTTAGGTTAGGTAGAGGATGG - Intergenic
1178524165 21:33311590-33311612 GCCTCAGGAAGGGGAGAGGCAGG - Intergenic
1178600607 21:33991278-33991300 GACTGAGGTCTGGTAGAAGCAGG + Intergenic
1179965144 21:44799941-44799963 GTCTCAGGGAAGAGAGAGGCCGG + Intronic
1180151134 21:45948658-45948680 GACTCGGGGAAGGTGGAGGAAGG + Intergenic
1182212595 22:28689372-28689394 TCCTCTGGGAAGGTAGAGGCGGG - Intronic
1183037748 22:35152812-35152834 GACACAGGTGAGGGACAGGCAGG + Intergenic
1185380786 22:50506707-50506729 GACTCAGGTAAGGTAGAGGCAGG + Intronic
949592378 3:5507954-5507976 GACTCAGGAAGGGAAGAGGATGG + Intergenic
950025710 3:9818701-9818723 GAGTCAGAAAAGGTAGAGTCAGG + Intronic
951312949 3:21151838-21151860 GTCTCAGGTAATGGAGGGGCTGG - Intergenic
954630629 3:52045985-52046007 GAGTGAGGCAAGGTAGAAGCTGG - Intergenic
956139022 3:66127090-66127112 GACATAGAGAAGGTAGAGGCAGG - Intergenic
956779639 3:72593838-72593860 GACTGAGGCCAGGAAGAGGCTGG + Intergenic
959101936 3:102020525-102020547 GGCTCAGATGAGGAAGAGGCAGG + Intergenic
959663613 3:108897075-108897097 GATTCAGGTGAGGTTGAGGATGG + Intergenic
960707756 3:120496648-120496670 GGCTCAGGTATGGGAGAGGAGGG + Intergenic
960982352 3:123242109-123242131 GAGTCAGGGAAGGCAGATGCAGG - Intronic
961426362 3:126851639-126851661 GACCCATGGAGGGTAGAGGCGGG + Intronic
961636110 3:128334143-128334165 GACTCAGATGTGGCAGAGGCAGG - Intronic
962026650 3:131554775-131554797 GGCACTGGTAAGGTGGAGGCTGG + Intronic
963946605 3:151152492-151152514 AACTCAGCTGAGGCAGAGGCAGG + Intronic
964181753 3:153896048-153896070 TACAGAGGTAAGGTAGATGCTGG + Intergenic
964380925 3:156098514-156098536 GCCTGAGGGAAAGTAGAGGCTGG + Intronic
964629152 3:158790789-158790811 GAATCAGGAATGGTAGAGGTGGG + Intronic
967124964 3:186415099-186415121 CACTGAGGTGTGGTAGAGGCAGG - Intergenic
973588289 4:52413965-52413987 GTCACAGGAAAGGTAGAGTCTGG + Intergenic
975697618 4:77029236-77029258 GACTAAGGTAAGGCTGAAGCAGG - Intronic
983168923 4:164513586-164513608 GACTGATGGAAGGTAGAGGTAGG + Intergenic
984043543 4:174768623-174768645 GAATCAGCTAAGGTAGTGCCTGG - Intronic
986049759 5:4077849-4077871 GTGTCAGGTCAGATAGAGGCTGG + Intergenic
987754475 5:22083282-22083304 GACTCAGGAAAGGAAGAGAATGG - Intronic
991595084 5:68296015-68296037 AACTCAGGTCGGGCAGAGGCAGG + Intronic
992472704 5:77074319-77074341 GACTCAGGTAAGGGACAGTTGGG + Exonic
998394403 5:141809262-141809284 GAGTCAGGTGATGGAGAGGCAGG + Intergenic
999226297 5:150027660-150027682 TACTCAGGAAAGGCTGAGGCAGG - Intronic
1000234044 5:159341193-159341215 GGATCAGGTAGGGGAGAGGCTGG + Intergenic
1002361283 5:178673283-178673305 GACTCAGATATGGCAGAGGTTGG + Intergenic
1002862395 6:1091655-1091677 GTCTGGGGAAAGGTAGAGGCTGG + Intergenic
1003995910 6:11538557-11538579 GACTCAGGGAAGGGGGTGGCGGG - Intronic
1006404842 6:33838924-33838946 GACCCAGGGTAGGTAGAGACTGG + Intergenic
1007948747 6:45850637-45850659 GATTCAGGAAAGGGAGATGCTGG - Intergenic
1009901241 6:69810221-69810243 GTCTCAGGGTTGGTAGAGGCAGG - Intergenic
1013011676 6:106126093-106126115 GACTCAGGTGAGGAAGGTGCTGG - Intergenic
1016981916 6:149862196-149862218 GCCTCATCTAAGGTAGAGGTGGG + Intronic
1020364015 7:7360440-7360462 GCCTCAGATGAGGTAGTGGCAGG + Exonic
1020833223 7:13116586-13116608 CACTCAGGTAAGGAAGATGAGGG + Intergenic
1022771006 7:33472984-33473006 GCCTGAGGTAAGGTAGAGGTTGG - Intronic
1023496826 7:40806794-40806816 GGGTCAGCTGAGGTAGAGGCTGG + Intronic
1033459583 7:141533232-141533254 GACTGAGGGAAGGTGGAGGGAGG + Intergenic
1037964171 8:23120360-23120382 GACTCATCTCAGGAAGAGGCAGG + Intergenic
1037976586 8:23218253-23218275 GACTCATCTCAGGAAGAGGCAGG - Intronic
1040289815 8:46118528-46118550 GACTCAGGGAAAATTGAGGCAGG - Intergenic
1040292577 8:46132992-46133014 GACTCAGGGGATGTTGAGGCAGG - Intergenic
1040315247 8:46257537-46257559 GACTCAGGGGACGTTGAGGCAGG + Intergenic
1040330421 8:46382985-46383007 GACTCAGGGGATGTTGAGGCAGG + Intergenic
1041598735 8:59689702-59689724 TACTCAGGAAAGGCTGAGGCAGG + Intergenic
1041693141 8:60709312-60709334 AACTCAGCTAAGTTAGAGGAAGG + Intronic
1043696789 8:83229915-83229937 GACTGAGGGAAGGGAGAGTCGGG - Intergenic
1043708264 8:83380138-83380160 CACTCAGGTTTGGGAGAGGCAGG - Intergenic
1044635842 8:94323093-94323115 GACTCAGAGTAGGTAGAGGCTGG - Intergenic
1047477126 8:125243702-125243724 GAGTCAGGTAAGGTGGAGTGAGG + Intronic
1047560408 8:125981523-125981545 GTCTCAGGGAATATAGAGGCTGG - Intergenic
1048616521 8:136080961-136080983 AAGTCAAGTAAGGGAGAGGCAGG + Intergenic
1052535235 9:29737841-29737863 TACTCAGGAGAGGTTGAGGCAGG + Intergenic
1053314684 9:37041347-37041369 GACTCTGGAAAGGGGGAGGCTGG + Intergenic
1055891600 9:81129963-81129985 GTCTCAGGGATGGCAGAGGCAGG - Intergenic
1056454462 9:86746616-86746638 GAATGAGGGAAGGTAGAGACAGG + Intergenic
1057294285 9:93826509-93826531 GACGCAGGTAAGGTAAAGCCAGG + Intergenic
1058860071 9:109107508-109107530 AACTCAGGGAAGGCAGAGGAGGG - Intronic
1060832508 9:126725465-126725487 TACTCAGGAAAGGCTGAGGCAGG - Intergenic
1060848505 9:126856511-126856533 GGCTCAGGTCAGAGAGAGGCAGG + Intergenic
1186182853 X:6989952-6989974 GACTCAGGGAAGGCAGGGGAAGG + Intergenic
1186343542 X:8667714-8667736 GAGTAAGGTAAGGTAGAGTAAGG + Intronic
1187281170 X:17859830-17859852 GAGTCAGGTAGGGGAGAGGTGGG - Intronic
1187305546 X:18092051-18092073 GAGGGAGGTAAGGTAGAGCCTGG + Intergenic
1191182973 X:57581967-57581989 GGCTCAGGTAAGAGAGAGGATGG + Intergenic
1197090957 X:122536728-122536750 GACACAGCTAAGGTAGAGCTTGG + Intergenic
1198654261 X:138896792-138896814 GGCACAGGTAAGGTTGAGGGAGG - Intronic
1199769652 X:150966395-150966417 CACTGAGGTGAGGTAGTGGCAGG + Intergenic
1200097502 X:153671062-153671084 GAATCAGGTGAGCTTGAGGCTGG - Exonic
1200194751 X:154240182-154240204 GACTCAGGGAAAGAAGAGGAAGG + Intergenic
1200408631 Y:2840161-2840183 GTAACAGGAAAGGTAGAGGCCGG - Intergenic