ID: 1185383039

View in Genome Browser
Species Human (GRCh38)
Location 22:50518857-50518879
Sequence GGGGCGAGGCCTCACTCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 1, 2: 0, 3: 11, 4: 185}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185383039_1185383047 0 Left 1185383039 22:50518857-50518879 CCATGGGAGTGAGGCCTCGCCCC 0: 1
1: 1
2: 0
3: 11
4: 185
Right 1185383047 22:50518880-50518902 GGGGAAGCAGCCACAGCCCCCGG 0: 1
1: 0
2: 8
3: 82
4: 754
1185383039_1185383053 20 Left 1185383039 22:50518857-50518879 CCATGGGAGTGAGGCCTCGCCCC 0: 1
1: 1
2: 0
3: 11
4: 185
Right 1185383053 22:50518900-50518922 CGGTGAGCCTCAGCCCATCTTGG 0: 1
1: 0
2: 0
3: 10
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185383039 Original CRISPR GGGGCGAGGCCTCACTCCCA TGG (reversed) Intronic
900613312 1:3553483-3553505 GTGGGGAGGCCTCTCTCCCGTGG - Intronic
901438998 1:9266166-9266188 GGAGCTAGGCCTCACTGGCAGGG + Exonic
902771765 1:18649279-18649301 GGGGAAAGGCCTCATTCCCATGG - Intronic
902817243 1:18923276-18923298 GGTGCTGGGCCTCATTCCCAAGG - Intronic
903135654 1:21307833-21307855 GGGGCAGGGCCTCCCTCTCAAGG - Intronic
903228484 1:21907255-21907277 GGGGCAGGGGCTCACTCCCAGGG + Intronic
904239426 1:29134397-29134419 GGGGCGCGGCCTCACGGCCAGGG - Intergenic
904297703 1:29532375-29532397 CAGGCGAGGCCTCTCCCCCATGG - Intergenic
904436863 1:30504722-30504744 CGGGGGCAGCCTCACTCCCATGG - Intergenic
905201486 1:36319841-36319863 GGGACAAGGCCTCTATCCCAGGG + Exonic
905492260 1:38353779-38353801 CGGGCCATGCCTCCCTCCCAGGG - Intergenic
905803952 1:40862512-40862534 GGGGCGTGGCCGGAGTCCCAAGG - Intergenic
906855114 1:49295754-49295776 GTGGGTAGGCCTCACTCCCCAGG + Intronic
907788036 1:57633311-57633333 GAGGGCTGGCCTCACTCCCAGGG + Intronic
914999640 1:152577218-152577240 GTGGCAAGGCCTCACACACAGGG + Intronic
915556285 1:156662619-156662641 GGGGCTAGGCCACAGTCCCCTGG + Intergenic
920049892 1:203157539-203157561 GGGCAGTGGCCTCACTCCCATGG + Intronic
921051952 1:211517240-211517262 AGGGCGAGGCCTCACCCATATGG + Intergenic
1065972451 10:30816334-30816356 GGGCAGATGCCTCCCTCCCACGG - Intergenic
1067762979 10:49063722-49063744 GGAGAGAAGCCTCACACCCATGG + Intronic
1069544356 10:69318381-69318403 GGGGCGAGCCCTCATTTCCGAGG + Intronic
1070655698 10:78269702-78269724 GGGGCAGGGCCTCATTCTCAAGG + Intergenic
1073181292 10:101585069-101585091 GGAACGTGGCCTCACACCCAAGG - Intronic
1074270052 10:111944909-111944931 GGGGCAAGGCCTCCCAACCAGGG + Intergenic
1075717767 10:124566842-124566864 GGGCAGAAGCCTCCCTCCCAAGG + Intronic
1076738092 10:132467648-132467670 GGGCCGAGGCTGCCCTCCCAGGG + Intergenic
1077315858 11:1919140-1919162 GGGGCCTGGCCTCAGTTCCATGG + Intergenic
1081189129 11:40081487-40081509 TGGGGGTGGCCCCACTCCCATGG - Intergenic
1081700862 11:45151779-45151801 GGGGAGAGGCTTCAGGCCCAGGG + Intronic
1082044722 11:47715422-47715444 GGAGCTAGGCCTCGCCCCCAAGG + Intergenic
1082791337 11:57348392-57348414 GGGGGGTGGCCTCAGGCCCAGGG + Intronic
1083323893 11:61863640-61863662 AGGGCCCGGCCTCATTCCCAGGG - Intronic
1083717099 11:64583745-64583767 GGGTTGAGGCCTCACGACCATGG + Intergenic
1084266551 11:68008191-68008213 TGGGGGGAGCCTCACTCCCAGGG + Intergenic
1085048539 11:73367622-73367644 GGGGCGGGGCCTCGGTGCCAAGG - Exonic
1096146076 12:49279807-49279829 GGGGCTGGGCTTCACTACCAGGG + Intergenic
1098002844 12:65963095-65963117 CTGGCGAGCCCTCATTCCCAGGG - Intronic
1098142982 12:67469598-67469620 GGGGTGATGCCACACTCCCTTGG + Intergenic
1098342878 12:69470280-69470302 GGGGCGGGGCCTCTCTCGCCGGG - Intergenic
1103407509 12:120686556-120686578 GGGGCGGGGCCTTATTCTCATGG + Intergenic
1103743615 12:123107611-123107633 GGAGGGAGGCCACACTCCCTGGG - Intronic
1104262689 12:127198992-127199014 CAGGGGAGGCCTCACTCTCATGG + Intergenic
1104408751 12:128540851-128540873 GGGTCGAGGGCTCACTCCCCAGG + Intronic
1107344135 13:39440969-39440991 GGGGGGAGGCCTCACAATCATGG - Intronic
1112557103 13:100478689-100478711 GAGGTGAGGAGTCACTCCCAGGG - Intronic
1113768186 13:112893933-112893955 GGGCCCAGGCCTCACTTCCTTGG - Intergenic
1114666569 14:24380810-24380832 GGGTCCAGCCCTCCCTCCCAAGG - Intergenic
1114670497 14:24408377-24408399 GGGTCCAGGACTCTCTCCCACGG - Exonic
1114917915 14:27289982-27290004 GGGGCAAGCCCTCACAACCATGG + Intergenic
1119330180 14:73787420-73787442 GGAGCGAGGCTTCCCTCCCAGGG - Intronic
1119813519 14:77544475-77544497 AAGGCGAGGCCTCCCTGCCATGG - Intronic
1121774679 14:96582859-96582881 GGTGCGAGGCCAGAGTCCCAGGG - Intergenic
1122218715 14:100221676-100221698 TGGGCGTGGCCTCACTGCCTCGG + Intergenic
1128640017 15:69329074-69329096 AGGGCGAAGCCGCATTCCCAGGG - Intronic
1129333600 15:74839871-74839893 GGAGCGAGGCCTCCATCCCTGGG + Intronic
1129738651 15:77979278-77979300 GGGGCGAGGCCTGACTGGGAGGG - Intergenic
1129805759 15:78455895-78455917 GGCCCAAGGCCTCACTCACATGG + Intronic
1129847305 15:78773902-78773924 GGGGCGAGGCCTGACTGGAAGGG + Intronic
1130540448 15:84817651-84817673 GGGGCCAGGCCGCCCTCACAGGG - Intronic
1131383017 15:91980205-91980227 GGGGAGAGGCCTCGCTGCCCCGG + Intronic
1131512038 15:93054795-93054817 GAGGAGAGGTCTCCCTCCCAAGG + Intronic
1132864634 16:2087351-2087373 GGCTGGAGGCCTCACTCCAAGGG + Intronic
1133392199 16:5419656-5419678 GCGGTGAGACATCACTCCCATGG + Intergenic
1134052859 16:11149123-11149145 GGGGCCAGGCTTCACAGCCAGGG + Intronic
1134457497 16:14405733-14405755 GGGGCGGGGCCTCATGCCTAAGG - Intergenic
1135202462 16:20450369-20450391 TGGGGGTGGCCCCACTCCCATGG - Intergenic
1135216642 16:20577497-20577519 TGGGGGTGGCCCCACTCCCATGG + Intergenic
1138505464 16:57476121-57476143 GGGAGGAGGCTTCTCTCCCAGGG - Intronic
1138630561 16:58291147-58291169 GGTGCGGGGCCTCACTGCCGGGG + Intronic
1138861350 16:60762129-60762151 GTGGGGAGGCCTCACAACCATGG + Intergenic
1139476893 16:67207322-67207344 GGGGCCTGGCCTCCCACCCAGGG + Exonic
1139654825 16:68381160-68381182 GGGGCAAGGCCTCACTGCTGAGG + Intronic
1141896891 16:86964074-86964096 GGGAGGAGGCCTCAGCCCCAAGG - Intergenic
1142237873 16:88931178-88931200 GGGGCTCAGCCTCCCTCCCAGGG + Intronic
1143780443 17:9226163-9226185 GGGGGGGGGCCTCAGTGCCAAGG + Intronic
1145067038 17:19768651-19768673 GGTGAGACGCCTCACTCCCTGGG - Intergenic
1145231257 17:21174952-21174974 GGGACCAGGCCTCACTACCCAGG + Intronic
1145367728 17:22278630-22278652 GGGGCGTGGCCTGGCTCTCATGG + Intergenic
1146658472 17:34649173-34649195 GGGCAGAGGCTTCACTCACAGGG + Intergenic
1148450842 17:47777117-47777139 GTGGAGGGGCCTGACTCCCAGGG - Intergenic
1150086780 17:62277642-62277664 GGGAGGAGGCCTCAGCCCCAGGG - Intronic
1150267878 17:63842582-63842604 GGGGGGAGGCGGCGCTCCCAGGG + Exonic
1150814436 17:68381708-68381730 GGGGAGAGCACTCATTCCCAGGG - Intronic
1151712999 17:75817425-75817447 GGGGCCAGGCCAGACTCCCCAGG - Exonic
1151828897 17:76538276-76538298 GGGCCGCGGCGCCACTCCCACGG + Intronic
1152407200 17:80104585-80104607 GGGCGGGTGCCTCACTCCCATGG - Intergenic
1153943229 18:9994893-9994915 GGCACGAGGCCTGACTGCCAAGG + Intergenic
1154066282 18:11110386-11110408 CGGGGGAGGCCCAACTCCCAGGG - Intronic
1157545009 18:48540668-48540690 GAGGCGACGCCTCACTCCTCGGG - Intronic
1157698580 18:49744962-49744984 GGGTCAAGTGCTCACTCCCATGG + Intergenic
1160113236 18:76053710-76053732 GGGCAGAGGACTCGCTCCCAGGG - Intergenic
1160418299 18:78727019-78727041 GGGCCAAAGCCTCACGCCCATGG - Intergenic
1160497823 18:79385416-79385438 GGGGCCAGGCCACACCGCCACGG + Intergenic
1160721264 19:597914-597936 GGGGCGAGGAGAAACTCCCAGGG - Intronic
1161668239 19:5589923-5589945 GGGGCGAGGCTGCTCTACCACGG + Intronic
1162770491 19:12946228-12946250 CGGGCGAGGCCCCACCCCCGGGG + Intronic
1163483732 19:17574208-17574230 GGGGTGAGGCCTCTGTCCCGGGG + Intronic
1163701119 19:18787121-18787143 GGGACGGGCTCTCACTCCCAGGG + Intronic
1164674875 19:30094438-30094460 GTGGCTGGGGCTCACTCCCATGG + Intergenic
1164767352 19:30781974-30781996 GGGGCCTGGCCTCACTCCTTGGG + Intergenic
1165117647 19:33538615-33538637 GGCTTGAGGCCTCACTCCGATGG - Intergenic
1165421301 19:35723285-35723307 GGGGCGTGACCTCATTCCCGTGG + Intronic
1166881836 19:45934736-45934758 GGGGCGTGGCCTCCCTCAAATGG - Exonic
1167251393 19:48400122-48400144 GGAGAAAGGCCTGACTCCCAAGG + Intronic
1167285070 19:48594559-48594581 TGGGCGGCGCCTCACACCCAGGG - Intronic
1167609457 19:50500328-50500350 GGGGGGCGGTCTCACCCCCAGGG - Intergenic
1168146385 19:54421790-54421812 GGGGCCAGGCCTCAGCCCCAGGG - Intronic
925027578 2:621580-621602 GGGGCAAAGCCTGACTTCCAGGG + Intergenic
925234983 2:2270170-2270192 GTGGCGAGGGCTCCCTCCCTGGG - Intronic
925654211 2:6127697-6127719 GAGGGGAAGCCTGACTCCCAGGG - Intergenic
926056204 2:9775577-9775599 GGGATGAGTCCTCACTGCCATGG + Intergenic
933073153 2:77888046-77888068 GGGGTTAGGACTCACTCCCAGGG + Intergenic
938339690 2:130527158-130527180 GGGGCGCGGCGCCACTCACAGGG + Intronic
938350146 2:130593592-130593614 GGGGCGCGGCGCCACTCACAGGG - Intronic
939382958 2:141459747-141459769 CGGGGGAGGCCTCACAACCATGG - Intronic
942639710 2:178048592-178048614 TGGGGGTGGCCTGACTCCCAAGG - Intronic
942991651 2:182209187-182209209 GGGGAGAGGCCTCACAATCATGG + Intronic
943791907 2:191942677-191942699 GAGGCTAGCCCTCCCTCCCAGGG - Intergenic
946400163 2:219464402-219464424 GGGGCAAGAACTCAGTCCCAGGG - Intronic
948049236 2:234967219-234967241 GGGGCCAGGTCTCAATTCCAGGG + Intronic
948206895 2:236167347-236167369 GGGGCGCGGCCTCGCCCCCTTGG + Intronic
949073232 2:242039253-242039275 GGAGGGAGGCCTCAGTCCCCGGG - Intergenic
1172379952 20:34481610-34481632 GTGGGGAGGCCTCACCCTCATGG + Intronic
1175957102 20:62617013-62617035 GGGGCGAGGCTGCCCTCTCATGG + Intergenic
1176025836 20:62985175-62985197 GGGCCTGGGCCTCCCTCCCAGGG - Intergenic
1176092564 20:63325589-63325611 GGGGTGAGGCCTCACAGGCAGGG + Intronic
1176179089 20:63741234-63741256 GGAGCCAGGCCTCATGCCCAGGG + Intronic
1180057297 21:45365506-45365528 GGGCCCAGCCCTCACTCCCCAGG + Intergenic
1180099556 21:45578199-45578221 GGTGCGTGGTCTCACACCCAAGG + Intergenic
1181099609 22:20530609-20530631 GGGGAGAGGCCTCACTGAGAGGG + Intronic
1181307742 22:21926666-21926688 TGGGAGGTGCCTCACTCCCAGGG - Intronic
1181941888 22:26483992-26484014 GGGGCGCCGCCTCTCTCCCCCGG - Exonic
1181941897 22:26484013-26484035 GGGGCGCCGCCTCTCTCCCCCGG - Exonic
1182948843 22:34352268-34352290 GGGAGAAGCCCTCACTCCCAAGG + Intergenic
1185383039 22:50518857-50518879 GGGGCGAGGCCTCACTCCCATGG - Intronic
952097216 3:29968163-29968185 GAGGGCAGGACTCACTCCCACGG + Intronic
952181210 3:30918284-30918306 GAGAGGAGGCCTCAGTCCCAGGG + Intergenic
955291040 3:57692767-57692789 GGGGCCGGGCCTCACCTCCACGG + Exonic
960747671 3:120908154-120908176 GGGGCGGGGCCTGCCTCCCACGG + Exonic
961374639 3:126456224-126456246 GAGGCGAGGCCTCTCTGGCAGGG - Intronic
963267620 3:143254697-143254719 GGGTGGAGGACTCACTTCCAAGG + Intergenic
964021822 3:152022064-152022086 GGGGTGAGGCCTCTCTGCCAGGG + Intergenic
964087423 3:152835052-152835074 GGGGCGAGTCCGCACTCCGCGGG - Exonic
967464597 3:189789530-189789552 TGGGAGAGGCCTCACTCCATTGG + Intronic
975937195 4:79596324-79596346 GGGGAGAGGACTTGCTCCCATGG + Intergenic
977625000 4:99180406-99180428 GGGGCAAGGCCTCAAAGCCATGG - Intergenic
986241695 5:5965598-5965620 GGTGCCAGGCCTCATTCTCATGG + Intergenic
986449329 5:7850335-7850357 GGGGCAGGGCTTCACTACCAGGG - Intronic
996873485 5:128216914-128216936 GAGGTGACGCCTCACTCCAAGGG - Intergenic
998005581 5:138654807-138654829 TGGCCTAGGCCTCACCCCCATGG + Intronic
998390298 5:141783106-141783128 GTGGCCAGGCCACACTCCCTAGG + Intergenic
999248836 5:150169584-150169606 GGGGCTTGGCCTCTCTCTCAGGG - Intronic
1000514177 5:162219728-162219750 GAGGTGAGGCCTAACTCTCAAGG + Intergenic
1001639242 5:173233614-173233636 AGGCCGAGGCCTCACTGCTAGGG + Intronic
1002679172 5:180948058-180948080 CGGGGGTGGCCTCACCCCCAAGG - Intronic
1002685044 5:181003559-181003581 CGGGGGTGGCCTCACCCCCAAGG - Intronic
1003406818 6:5832961-5832983 CTGGAGAGGCCTCACTGCCAGGG + Intergenic
1003484876 6:6567023-6567045 CTGGCCAGCCCTCACTCCCATGG + Intergenic
1006136996 6:31901562-31901584 GGGGCGAGCCCGCGCGCCCACGG + Intronic
1006665340 6:35689081-35689103 GGGGCGGGGCCTCATTTGCATGG - Intronic
1010069522 6:71726836-71726858 GGGGCTCTGCCTCACTCACATGG + Intergenic
1015923995 6:138291850-138291872 GGGGCGAGCCCTCACACTCGGGG - Exonic
1019462434 7:1167777-1167799 GGGGAGAGGTATCACTCCAAAGG - Intergenic
1019528239 7:1490618-1490640 AGGGCGTGGCCTCACTGACATGG + Intronic
1019885795 7:3903840-3903862 AGGGCAAGAACTCACTCCCAAGG - Intronic
1019938577 7:4271910-4271932 GGGCTGAGGCCTCACTTACAGGG + Intergenic
1024154047 7:46602125-46602147 GTGGGGAGGCCTCCCTGCCAAGG - Intergenic
1024216593 7:47254172-47254194 GGCGCTAGGCCCCCCTCCCAAGG - Intergenic
1024604160 7:51011151-51011173 GGGGCCAGGTCTCACTCACGTGG - Intergenic
1026843358 7:73683302-73683324 GGAGCGAGGACTTATTCCCAGGG - Exonic
1027716153 7:81673138-81673160 GGGGTGAGTTCTCACTCTCATGG + Intergenic
1029457619 7:100679028-100679050 GGGGTGAGGCCCCAACCCCAGGG - Exonic
1035246464 7:157565583-157565605 GGGGTCAGGCTTCACTCCCCAGG - Intronic
1035783499 8:2246568-2246590 GGGCTGAGGCCACACTCCAAGGG - Intergenic
1035808624 8:2473018-2473040 GGGCTGAGGCCACACTCCAAGGG + Intergenic
1037540109 8:19862621-19862643 TGGGAGTGGTCTCACTCCCATGG - Intergenic
1037910794 8:22742471-22742493 GGGGCAAGCCCACACTTCCAGGG - Intronic
1038094522 8:24293063-24293085 CTGGGGAGGCCTCACTCTCATGG + Intergenic
1040595555 8:48834532-48834554 GGGACGAGGCCTCACTCCCAGGG + Intergenic
1041023971 8:53665683-53665705 GGGGCTGGGCCTTTCTCCCATGG - Intergenic
1044850135 8:96419682-96419704 GAGGCCAGGCCGCCCTCCCAGGG - Intergenic
1049411553 8:142475906-142475928 CCGGCTAGGCCCCACTCCCACGG - Intronic
1049469995 8:142770953-142770975 GGGGGGTGGCCTCTCTCCCACGG + Intronic
1049580789 8:143409609-143409631 GTGGGGAGGACTCCCTCCCAGGG - Intergenic
1055009770 9:71552690-71552712 GGGGAGGGGTCTCACTCCAAGGG + Intergenic
1055852198 9:80645030-80645052 CTGGCGAGGCCTCACAACCACGG - Intergenic
1061236749 9:129347656-129347678 GGGGCGAGTTCTCCATCCCAGGG + Intergenic
1061324161 9:129852656-129852678 GGGGCCAGGGCCCACACCCAGGG + Intronic
1061967946 9:134026430-134026452 GGGACGAGGCGTCACACCCTGGG - Intergenic
1062041981 9:134408432-134408454 TGGGCCATGCCCCACTCCCAGGG + Intronic
1185944883 X:4364374-4364396 GGGACAAGGACTCACTCCTATGG + Intergenic
1189328657 X:40129525-40129547 GGGGCCAGGCCTCAGTGGCAGGG + Intronic
1190375304 X:49783246-49783268 TGGGGAAGGCCTCACTGCCAGGG + Intergenic
1193076745 X:77363347-77363369 GGGGCTAGGTCTGAGTCCCATGG - Intergenic
1194881210 X:99253896-99253918 TGGGCCAGGCCTCAGGCCCAGGG - Intergenic
1195696763 X:107673229-107673251 TGGGTGTGGCCTGACTCCCAGGG + Intergenic
1197249296 X:124198227-124198249 GGGGGGAGGCCTCACAATCATGG + Intronic
1197274952 X:124467339-124467361 TGGGCCAGAACTCACTCCCAAGG + Intronic