ID: 1185383039

View in Genome Browser
Species Human (GRCh38)
Location 22:50518857-50518879
Sequence GGGGCGAGGCCTCACTCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 1, 2: 0, 3: 11, 4: 185}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185383039_1185383053 20 Left 1185383039 22:50518857-50518879 CCATGGGAGTGAGGCCTCGCCCC 0: 1
1: 1
2: 0
3: 11
4: 185
Right 1185383053 22:50518900-50518922 CGGTGAGCCTCAGCCCATCTTGG 0: 1
1: 0
2: 0
3: 10
4: 93
1185383039_1185383047 0 Left 1185383039 22:50518857-50518879 CCATGGGAGTGAGGCCTCGCCCC 0: 1
1: 1
2: 0
3: 11
4: 185
Right 1185383047 22:50518880-50518902 GGGGAAGCAGCCACAGCCCCCGG 0: 1
1: 0
2: 8
3: 82
4: 754

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185383039 Original CRISPR GGGGCGAGGCCTCACTCCCA TGG (reversed) Intronic