ID: 1185383047

View in Genome Browser
Species Human (GRCh38)
Location 22:50518880-50518902
Sequence GGGGAAGCAGCCACAGCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 845
Summary {0: 1, 1: 0, 2: 8, 3: 82, 4: 754}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185383031_1185383047 20 Left 1185383031 22:50518837-50518859 CCTCATGCCCCTTCTGTGGCCCA 0: 1
1: 0
2: 0
3: 38
4: 333
Right 1185383047 22:50518880-50518902 GGGGAAGCAGCCACAGCCCCCGG 0: 1
1: 0
2: 8
3: 82
4: 754
1185383039_1185383047 0 Left 1185383039 22:50518857-50518879 CCATGGGAGTGAGGCCTCGCCCC 0: 1
1: 1
2: 0
3: 11
4: 185
Right 1185383047 22:50518880-50518902 GGGGAAGCAGCCACAGCCCCCGG 0: 1
1: 0
2: 8
3: 82
4: 754
1185383029_1185383047 24 Left 1185383029 22:50518833-50518855 CCAGCCTCATGCCCCTTCTGTGG 0: 1
1: 0
2: 2
3: 30
4: 318
Right 1185383047 22:50518880-50518902 GGGGAAGCAGCCACAGCCCCCGG 0: 1
1: 0
2: 8
3: 82
4: 754
1185383036_1185383047 11 Left 1185383036 22:50518846-50518868 CCTTCTGTGGCCCATGGGAGTGA 0: 1
1: 0
2: 3
3: 8
4: 234
Right 1185383047 22:50518880-50518902 GGGGAAGCAGCCACAGCCCCCGG 0: 1
1: 0
2: 8
3: 82
4: 754
1185383035_1185383047 12 Left 1185383035 22:50518845-50518867 CCCTTCTGTGGCCCATGGGAGTG 0: 1
1: 0
2: 3
3: 31
4: 210
Right 1185383047 22:50518880-50518902 GGGGAAGCAGCCACAGCCCCCGG 0: 1
1: 0
2: 8
3: 82
4: 754
1185383038_1185383047 1 Left 1185383038 22:50518856-50518878 CCCATGGGAGTGAGGCCTCGCCC 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1185383047 22:50518880-50518902 GGGGAAGCAGCCACAGCCCCCGG 0: 1
1: 0
2: 8
3: 82
4: 754
1185383034_1185383047 13 Left 1185383034 22:50518844-50518866 CCCCTTCTGTGGCCCATGGGAGT 0: 1
1: 0
2: 0
3: 18
4: 158
Right 1185383047 22:50518880-50518902 GGGGAAGCAGCCACAGCCCCCGG 0: 1
1: 0
2: 8
3: 82
4: 754

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185383047 Original CRISPR GGGGAAGCAGCCACAGCCCC CGG Intronic