ID: 1185383053

View in Genome Browser
Species Human (GRCh38)
Location 22:50518900-50518922
Sequence CGGTGAGCCTCAGCCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 93}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185383043_1185383053 6 Left 1185383043 22:50518871-50518893 CCTCGCCCCGGGGAAGCAGCCAC 0: 1
1: 0
2: 0
3: 24
4: 211
Right 1185383053 22:50518900-50518922 CGGTGAGCCTCAGCCCATCTTGG 0: 1
1: 0
2: 0
3: 10
4: 93
1185383044_1185383053 1 Left 1185383044 22:50518876-50518898 CCCCGGGGAAGCAGCCACAGCCC 0: 1
1: 0
2: 3
3: 44
4: 447
Right 1185383053 22:50518900-50518922 CGGTGAGCCTCAGCCCATCTTGG 0: 1
1: 0
2: 0
3: 10
4: 93
1185383046_1185383053 -1 Left 1185383046 22:50518878-50518900 CCGGGGAAGCAGCCACAGCCCCC 0: 1
1: 0
2: 4
3: 57
4: 520
Right 1185383053 22:50518900-50518922 CGGTGAGCCTCAGCCCATCTTGG 0: 1
1: 0
2: 0
3: 10
4: 93
1185383039_1185383053 20 Left 1185383039 22:50518857-50518879 CCATGGGAGTGAGGCCTCGCCCC 0: 1
1: 1
2: 0
3: 11
4: 185
Right 1185383053 22:50518900-50518922 CGGTGAGCCTCAGCCCATCTTGG 0: 1
1: 0
2: 0
3: 10
4: 93
1185383038_1185383053 21 Left 1185383038 22:50518856-50518878 CCCATGGGAGTGAGGCCTCGCCC 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1185383053 22:50518900-50518922 CGGTGAGCCTCAGCCCATCTTGG 0: 1
1: 0
2: 0
3: 10
4: 93
1185383045_1185383053 0 Left 1185383045 22:50518877-50518899 CCCGGGGAAGCAGCCACAGCCCC 0: 1
1: 1
2: 5
3: 81
4: 701
Right 1185383053 22:50518900-50518922 CGGTGAGCCTCAGCCCATCTTGG 0: 1
1: 0
2: 0
3: 10
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185383053 Original CRISPR CGGTGAGCCTCAGCCCATCT TGG Intronic