ID: 1185384918

View in Genome Browser
Species Human (GRCh38)
Location 22:50527182-50527204
Sequence CCCGGGCCTGCTCCTGGTTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 274}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185384907_1185384918 18 Left 1185384907 22:50527141-50527163 CCAGGGAAAGGCCACACCGCTCA 0: 1
1: 0
2: 0
3: 11
4: 125
Right 1185384918 22:50527182-50527204 CCCGGGCCTGCTCCTGGTTGGGG 0: 1
1: 0
2: 0
3: 27
4: 274
1185384909_1185384918 2 Left 1185384909 22:50527157-50527179 CCGCTCACCAGCGTCTTTGCCAG 0: 1
1: 0
2: 1
3: 9
4: 156
Right 1185384918 22:50527182-50527204 CCCGGGCCTGCTCCTGGTTGGGG 0: 1
1: 0
2: 0
3: 27
4: 274
1185384906_1185384918 19 Left 1185384906 22:50527140-50527162 CCCAGGGAAAGGCCACACCGCTC 0: 1
1: 0
2: 0
3: 13
4: 116
Right 1185384918 22:50527182-50527204 CCCGGGCCTGCTCCTGGTTGGGG 0: 1
1: 0
2: 0
3: 27
4: 274
1185384910_1185384918 -5 Left 1185384910 22:50527164-50527186 CCAGCGTCTTTGCCAGCTCCCGG 0: 1
1: 0
2: 1
3: 15
4: 133
Right 1185384918 22:50527182-50527204 CCCGGGCCTGCTCCTGGTTGGGG 0: 1
1: 0
2: 0
3: 27
4: 274
1185384908_1185384918 7 Left 1185384908 22:50527152-50527174 CCACACCGCTCACCAGCGTCTTT 0: 1
1: 0
2: 0
3: 7
4: 105
Right 1185384918 22:50527182-50527204 CCCGGGCCTGCTCCTGGTTGGGG 0: 1
1: 0
2: 0
3: 27
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185384918 Original CRISPR CCCGGGCCTGCTCCTGGTTG GGG Exonic
900680274 1:3912600-3912622 CCAGGGCCAGCTCCTGGCTATGG + Intergenic
900743104 1:4342489-4342511 CCAGGGCCTGGTCCTGGTCCAGG + Intergenic
900751594 1:4401304-4401326 CCCAGGGCTGCTCCTGCTGGTGG + Intergenic
900975610 1:6014315-6014337 AACTGGCCTGCTCCTGGATGTGG - Intronic
901202569 1:7475002-7475024 CCGTGGCCTCCTCCTGGTGGTGG + Intronic
901303398 1:8215765-8215787 CCCCGGCCTGCTCCAGGGAGGGG + Intergenic
901930071 1:12591492-12591514 CTCTGCCCTGCTCCAGGTTGCGG - Intronic
902457884 1:16548852-16548874 CCCGGGCCTGATCCTGAATCAGG + Intergenic
902475330 1:16681193-16681215 CCCGGGCCTGATCCTGAATCAGG + Intergenic
902580585 1:17405071-17405093 CCCCAGCCTGCCCCTGGCTGAGG - Intergenic
902727558 1:18347221-18347243 GCTGGGCCTGTTCCTGGGTGAGG - Intronic
903859118 1:26354532-26354554 CCAGGGCCTGCTCCTGGACATGG - Intergenic
904620753 1:31773639-31773661 CCCTTGCCTGCTTCTGGCTGTGG - Intergenic
904704187 1:32378036-32378058 TCCGGGCCTGCTCCTGAATGTGG + Exonic
905298859 1:36972396-36972418 CCCCAGCCAGCTCCTGGATGAGG + Intronic
905303118 1:36999055-36999077 CCCAGGTCTGTTCATGGTTGGGG - Intronic
906035251 1:42746774-42746796 CCAGGGGCTGCTCCTGGGAGAGG + Exonic
911907938 1:103593726-103593748 CCCGGGTTCGCTCCTGGTTTGGG - Intergenic
912555421 1:110512655-110512677 CCGGAGCCTGCTCCTTGTTGGGG + Intergenic
912572902 1:110637584-110637606 CCTGGGTCTGCCCCTGGGTGGGG + Intergenic
913611681 1:120515026-120515048 CCCGGGCCTGATCCTGAATCAGG + Intergenic
914579510 1:149007213-149007235 CCCGGGCCTGATCCTGAATCAGG - Exonic
915516230 1:156414135-156414157 AGCGGGCCTGCTGCTGGTTGGGG - Intronic
915545009 1:156592095-156592117 CCTGGGCCTCCTCCTGGCTGAGG - Exonic
916675802 1:167063591-167063613 CCAGGGGCTGCTCCTGATTCAGG + Exonic
916936547 1:169633671-169633693 TGCAGGCCTGCTCCTGGTGGTGG - Intergenic
917193124 1:172439886-172439908 CCACTGCCTGCTCCTGGTTTGGG - Intronic
917975466 1:180235016-180235038 CCCGGGCGTGCTCTGGGTTTTGG + Intronic
918200591 1:182262642-182262664 GCCAGGCTTGCTCCTGGTTCAGG - Intergenic
924102815 1:240621923-240621945 CCCTTGCCTCCTCCTGGTTTTGG + Intergenic
1062790350 10:300544-300566 CGCAGGGCTGCTCCTGGTTCTGG - Intronic
1063439956 10:6064738-6064760 CCAGGGCCTGCTGCAGGGTGGGG - Intergenic
1063957423 10:11280284-11280306 CGCAGGCCTGCTCCTGGATGGGG - Intronic
1063959566 10:11295947-11295969 CTCCAGCCTGCTCCAGGTTGGGG - Intronic
1069683263 10:70300231-70300253 CCCAGGCCCTCTCCTGGTAGGGG + Exonic
1069859336 10:71460763-71460785 CCCTGTCCTGCTCCTGAATGTGG + Intronic
1070174195 10:73956507-73956529 CAGGGGCCAGCTCCTGGTGGAGG - Intergenic
1072637205 10:97185740-97185762 CCCGGGACTGCACCTGGAGGCGG - Exonic
1072683516 10:97523445-97523467 ACCGGGCCAGTTACTGGTTGGGG + Intronic
1074550335 10:114436762-114436784 CCAGGGCTTCCTCCTGGCTGAGG + Intronic
1076385547 10:130052438-130052460 CCCGGGGATGCTTCTGGGTGTGG - Intergenic
1076784574 10:132743385-132743407 CCCGGGCCTGGTCCCTGCTGGGG - Intronic
1076798939 10:132811833-132811855 CCAGGGCCTGCACTTGGGTGGGG - Intronic
1076988051 11:253546-253568 CCACGGCCTGCTCCTGTTGGAGG + Intergenic
1077014711 11:394424-394446 CGCGGACCTGCTCCTGGACGCGG - Exonic
1077231343 11:1459388-1459410 ACCTGGGCTGCTCCTGGTAGAGG - Intronic
1078917705 11:15795484-15795506 ACCAGTCTTGCTCCTGGTTGTGG - Intergenic
1080584375 11:33667974-33667996 CCGGGGCCTGCTCCAGGCTGGGG - Exonic
1082089778 11:48079828-48079850 CCCGTGCCTGCTTCTGGGTTGGG + Intronic
1083187666 11:61026952-61026974 CCCGGGCCCTATCCTGGCTGAGG + Intergenic
1083233786 11:61339306-61339328 CCCGGGCCTGCTCCCGGGCCAGG - Exonic
1083628072 11:64082159-64082181 CTCTGGCCTGCTCCTGGCTCTGG - Intronic
1084309411 11:68308064-68308086 CCCTGGCCTGCTCCTGGGGCAGG + Intergenic
1084435276 11:69135813-69135835 CCCAGGCCTGCTCCTCCTGGAGG - Intergenic
1084485763 11:69447300-69447322 CCCAGGCTTGGTTCTGGTTGGGG + Intergenic
1085014580 11:73164891-73164913 CCAGGGCTTTCTCCTGGTTTGGG + Intergenic
1085297598 11:75439763-75439785 GTCAGGCCTGCTCCTGGCTGAGG + Intronic
1088565685 11:111170337-111170359 TCGGGGGCTGCTCCTGCTTGAGG - Intergenic
1089567749 11:119380978-119381000 CGCGTGCCTGCTTCTGGTTTGGG + Intronic
1089605479 11:119638896-119638918 CCCGGGCCTGCTCTTGTGAGTGG - Intronic
1089705710 11:120276139-120276161 CCTGAGGCTGCTCCTGGTTGTGG - Intronic
1089821450 11:121230920-121230942 CCAGGGTCTGCTCCTGGTGAGGG + Intergenic
1090002708 11:122976653-122976675 TCCGGGCGTGCACCTGTTTGGGG - Intergenic
1091408636 12:224547-224569 CCCGGGCCAGCTCCAGGCTGTGG + Intronic
1091877756 12:3950545-3950567 CCTGGGTCTGCTCCTATTTGGGG - Intergenic
1094016618 12:25871508-25871530 CCCGGGCCTGTTGCGGGGTGGGG + Intergenic
1098138433 12:67427626-67427648 CCCGGGCCTGACCCTTGCTGGGG + Intergenic
1101809312 12:108093765-108093787 CCCCTGCCTGCACCTGTTTGGGG + Intergenic
1102241682 12:111328392-111328414 CCCGGGGCTGCGCCTGGCAGTGG - Intronic
1102261412 12:111445629-111445651 CCCGGGCCTGCTCTGGTTGGCGG - Intronic
1103445777 12:120994315-120994337 CCCGGGCCTGGCCCTGGGGGGGG - Exonic
1103945754 12:124525511-124525533 CCACGGCCTCCTCCTGGTTGAGG - Intronic
1104987621 12:132605885-132605907 CCCAGGGCTGCTCCTGGTGCTGG + Intronic
1106101436 13:26697370-26697392 CCCGTGCATGCTCCTGGAGGAGG - Intergenic
1106402120 13:29441197-29441219 CCCTGGGCTTCTCCTGGTGGGGG - Intronic
1106465154 13:30006880-30006902 GCCAGGCCCTCTCCTGGTTGTGG - Intergenic
1106679380 13:31994396-31994418 CCCGAGCCGGTTGCTGGTTGGGG + Intergenic
1106692941 13:32138563-32138585 CCCAGGCCTGCTCCTCTCTGGGG - Intronic
1112428063 13:99323043-99323065 CCCTGGCCTGCTTCTGGGCGAGG + Intronic
1113679709 13:112234709-112234731 CCTGGTCCTGCTCCTGGGGGTGG + Intergenic
1113894268 13:113753718-113753740 CCCGGGGATGCTCCTGCTTCAGG - Intergenic
1116029188 14:39550355-39550377 CCAGGGCCTGCTGCGGGGTGAGG - Intergenic
1119672749 14:76531889-76531911 CCCGGGCCTGCTGCTGGGCGAGG - Intergenic
1121311445 14:92937531-92937553 CCATGGCCTCCTGCTGGTTGGGG - Exonic
1122037653 14:98960468-98960490 CCTGGGCCTGCTCCAGGTGGTGG - Intergenic
1122205667 14:100146737-100146759 CCCGGGCTGCCTCCTGGTGGTGG - Exonic
1122982757 14:105199001-105199023 CACTGGCCTGGCCCTGGTTGTGG + Intergenic
1122999927 14:105287931-105287953 CCCGGGCCTCCTTCAGGCTGAGG + Intronic
1123940074 15:25212508-25212530 CCCGGGCATGTTCCTGGGGGGGG + Intergenic
1124141626 15:27082102-27082124 CCCTTGCCTGCTTCTGGTGGAGG + Intronic
1127983718 15:64052189-64052211 GCCGGGCCTAGTCCTGTTTGGGG - Intronic
1128709085 15:69858443-69858465 CCTGGGCCTGCCCCTAGCTGGGG + Intergenic
1129376844 15:75138899-75138921 CCCGAGGCTGCTCCTGGTGCAGG - Intergenic
1129691724 15:77717703-77717725 CCCGGGCCTGGGCTTGGTGGGGG - Intronic
1130828619 15:87576596-87576618 CCTGGCCCGGCACCTGGTTGTGG + Intergenic
1131091385 15:89627251-89627273 CCTGGCCCTGCCCCTTGTTGGGG + Exonic
1131222553 15:90597145-90597167 CCAGGGCTTGCTCCTGGCTGGGG + Intronic
1131436950 15:92430676-92430698 CCCAGGCTTGCCCCTGGCTGTGG + Intronic
1131471650 15:92702877-92702899 TCTGGGCCTGCGCCTGGTGGGGG - Intronic
1131481866 15:92789069-92789091 CCAGGGGCTGCTGCTGGTTGGGG + Intronic
1132678230 16:1129452-1129474 CCCGGGCCTGCCCCTGCTGCGGG + Intergenic
1132747550 16:1443268-1443290 CCAGGGCCTGCATCTGGTTCTGG + Exonic
1133119331 16:3596542-3596564 CCCAGGACTGCTCCAGGCTGTGG - Intronic
1133131908 16:3681361-3681383 CCCTGGCCTGCTGCTTGCTGTGG - Intronic
1133140635 16:3741162-3741184 CCCGGGGCTGGCCCTGGGTGAGG - Intronic
1133816962 16:9204862-9204884 ACCCGGCCTGATCCTGGTAGGGG - Intergenic
1135547147 16:23374012-23374034 CTCAAGCCTGCTCCTGGTTGGGG - Intronic
1135732862 16:24908901-24908923 CTCGGGCCTGCTCCTGGGCTTGG + Exonic
1136109593 16:28056456-28056478 CCGGGGCCTGCTGTTGGGTGGGG + Intronic
1139653879 16:68375964-68375986 CCCTGCCCTGCTCCTGTGTGCGG + Intronic
1141860836 16:86715067-86715089 CCCAGGGTTGCTCCAGGTTGTGG + Intergenic
1141878168 16:86840601-86840623 CCTGGGCCTCCTCCAGGGTGGGG + Intergenic
1141965375 16:87438736-87438758 CCCGGTCTTCCTCCTGCTTGGGG + Intronic
1143550968 17:7630274-7630296 CCCGCTCCTGCACCTGGGTGGGG - Exonic
1143697607 17:8631386-8631408 CCCGGGGCTGCGCGGGGTTGGGG + Intergenic
1144676301 17:17164369-17164391 CCCGGCCCTGCTCCCGCTTCAGG - Intronic
1145234289 17:21197831-21197853 CCCTGCCCTGCTCCTAGCTGCGG - Exonic
1147458720 17:40554819-40554841 GCCGGAGCTGCTCCTGGCTGAGG + Exonic
1148772718 17:50076439-50076461 CCAGAGCCTGTGCCTGGTTGAGG - Exonic
1149010471 17:51851310-51851332 AGCGGCCCTGCTCCTGGATGAGG + Intronic
1149517483 17:57291741-57291763 CCCTGGCCTTGTCCTGCTTGTGG + Intronic
1149772384 17:59331926-59331948 GCCGGGCCTGCGCGGGGTTGGGG + Intronic
1151222315 17:72622311-72622333 TCAGGGCCTCCTCCTGGTTACGG - Intergenic
1152108746 17:78345393-78345415 CCCCTGCCAGCTCCTGGTGGTGG - Intergenic
1152391632 17:80007215-80007237 CCCGGCCCTGCTCCTGATGAAGG - Intronic
1152621204 17:81365732-81365754 CCCGGGCATGGTTCTGTTTGGGG + Intergenic
1156457225 18:37301575-37301597 CTCAGCCCTGCTCCAGGTTGGGG + Intronic
1160510293 18:79449752-79449774 CCCGGGGCTCCACCTGGATGGGG - Intronic
1160586974 18:79918401-79918423 CCCGGGCCCGCTCCTCACTGGGG - Intronic
1161047605 19:2144483-2144505 CCGGGGTCTGGTCCTGGATGGGG - Intronic
1161123691 19:2544367-2544389 CCCGGGGGTGCTCATGGCTGAGG - Intronic
1161242027 19:3228013-3228035 CCCTGCCCCGCTCCTGGATGAGG - Intronic
1161979083 19:7621183-7621205 CCCGTGCCCGCTCCAGCTTGCGG + Exonic
1162833095 19:13299025-13299047 CCCGGGCCCGATCGTGGTAGCGG + Exonic
1162972473 19:14188921-14188943 CCCGTGTCTGCTCGTGGTGGTGG - Intronic
1163182739 19:15615667-15615689 CCCGTGGCTGCTCCTGCTGGTGG + Exonic
1163437911 19:17306214-17306236 CCCGGGCCTGCTGCGGGGTGGGG - Exonic
1163564232 19:18040420-18040442 CCCGGGCCCCCTCCTGGTGCAGG - Intergenic
1165157258 19:33796229-33796251 CCCGGGCCTCCTCCGGGCTCGGG - Intronic
1166139762 19:40799565-40799587 TCAGGGCCTGCCCCGGGTTGGGG + Exonic
1166302304 19:41918139-41918161 CTCTGGCCTGACCCTGGTTGGGG + Intronic
1166863706 19:45823830-45823852 CCCGGAGCTGCTCCTGCTGGTGG - Exonic
1168725878 19:58581738-58581760 CCTCGCCCTGCTCCTGCTTGCGG - Intergenic
1202709571 1_KI270714v1_random:10247-10269 CCCGGGCCTGATCCTGAATCAGG + Intergenic
924962147 2:45446-45468 TCCGGCTCTGCTCCTGGCTGGGG + Exonic
925016143 2:525719-525741 CCCGGGCCAGCTCCTCGTGGAGG - Intergenic
927287157 2:21368970-21368992 CCTGGGTCTGCTACTGGCTGGGG - Intergenic
929460375 2:42098846-42098868 CCTAGGCCTGCTCCTTGTGGAGG + Intergenic
929968343 2:46552258-46552280 CTCGGGCCTGCTCCTTTTTGAGG - Intronic
930352459 2:50274382-50274404 CCAGGGCCTGCTGGGGGTTGGGG + Intronic
930691723 2:54371777-54371799 TCCAGGCATGCTCCTGTTTGGGG + Intronic
932817887 2:74876281-74876303 CCTGGGCCTCCTCCTCGCTGGGG + Intronic
932887117 2:75558556-75558578 CCCTGCCCTGCCCCAGGTTGGGG - Intronic
933767467 2:85719837-85719859 GCTGGACCTGCTCCAGGTTGAGG + Intergenic
934555749 2:95286324-95286346 CCAGGGCCTGATCTTGGTTTGGG - Intronic
934992537 2:98931622-98931644 CTCAGGCCTTCTCCTGGCTGTGG - Intronic
935099263 2:99977348-99977370 CCAAGGCCTGCTCCTGTCTGAGG + Intronic
935112494 2:100105402-100105424 CCCGGACCTGCTCTCCGTTGCGG + Intronic
936071360 2:109373910-109373932 CTCGGGCCTGCACCTGCTTGCGG - Intronic
936505752 2:113104468-113104490 CCTGGGCCTTCTCATGGTGGGGG + Intergenic
937297438 2:120818090-120818112 CCTGTGCCTGCATCTGGTTGAGG + Intronic
939189325 2:138897514-138897536 CCAGGGCCTGCTCGAGGTGGTGG - Intergenic
942133958 2:172906996-172907018 CCTGGGGCTGCTCCTGCCTGGGG - Intronic
944501023 2:200360461-200360483 GCAGGCCCTGCCCCTGGTTGGGG - Intronic
946000142 2:216475480-216475502 CCCAGGCATGCTCATGGCTGTGG + Intronic
946156458 2:217809792-217809814 CCCCTGCCTGCTCCTCGGTGGGG - Intronic
948890958 2:240906904-240906926 CCCGGGGCCGCTGCTGGCTGTGG + Intergenic
948890978 2:240906982-240907004 CCCGGGGCCGCTGCTGGCTGTGG + Intergenic
1169920912 20:10733383-10733405 CCCGGGCATGTTCATGGTGGTGG + Intergenic
1170734398 20:19001630-19001652 CCTGGGCCTTCTGCTGGTTTTGG - Intergenic
1171334436 20:24370823-24370845 CCTGGGCCAGCTGCTGGGTGGGG - Intergenic
1172294423 20:33798591-33798613 CTTGGGCCTGCGCCTGGGTGAGG + Intergenic
1173224277 20:41152842-41152864 CCCTGGCCTGGGCCTGGTGGGGG + Intronic
1174060163 20:47826877-47826899 CCGGGGCCTGCTCCCAGGTGGGG - Intergenic
1174071730 20:47904492-47904514 CCGGGGCCTGCTCCCAGGTGGGG + Intergenic
1174152318 20:48494143-48494165 CCGGGGCCTGCTCCCAGGTGGGG - Intergenic
1174186478 20:48709671-48709693 CCTGGTGCTGCTCATGGTTGTGG + Intronic
1176029752 20:63006204-63006226 CCAGGCCCTGGCCCTGGTTGAGG + Exonic
1176029765 20:63006252-63006274 CCAGGGCCTGCGCCTGCATGAGG + Exonic
1176146665 20:63568518-63568540 CCACGGCCAGCTCCTGCTTGCGG + Exonic
1176178170 20:63738274-63738296 CCCGGGGCAGCTCCTGGTGTGGG - Exonic
1178431734 21:32523602-32523624 ACTCAGCCTGCTCCTGGTTGTGG + Intergenic
1178431748 21:32523683-32523705 GCCCAGCCTGCTCCTGGCTGTGG - Intergenic
1178533767 21:33396115-33396137 CATGGGCCTCCTCCTGGCTGTGG + Intergenic
1178699361 21:34820157-34820179 CCCAGCCCTGCTCCCTGTTGGGG - Intronic
1179545083 21:42108265-42108287 CCTGGGGGTGCTCCGGGTTGGGG - Intronic
1179547818 21:42124351-42124373 CCCGTGCCGGCTCTGGGTTGGGG + Intronic
1179549920 21:42137447-42137469 CCCAGGCCTGCTTCTGCATGAGG - Exonic
1179779995 21:43693343-43693365 CCTGGGCCTTCTCCTTGGTGTGG - Exonic
1179912454 21:44457325-44457347 TCCGGGCATCCTCCTGGTTGTGG - Exonic
1180048034 21:45318678-45318700 CCCGGCCCAGCTCCAGGGTGAGG + Intergenic
1181030225 22:20145945-20145967 CCCTGGCCTGCTCTGGGTGGTGG + Intronic
1181746274 22:24956935-24956957 GCCCTGCCTGCTCCTGGCTGTGG + Intronic
1183279185 22:36923063-36923085 CCGGGGTGGGCTCCTGGTTGCGG - Intronic
1183284126 22:36952020-36952042 CCTGGGCCTGGGCCTGGTTCTGG - Intergenic
1185000786 22:48244415-48244437 CGTGGGCTTGCTCCTGGGTGGGG + Intergenic
1185384918 22:50527182-50527204 CCCGGGCCTGCTCCTGGTTGGGG + Exonic
949687512 3:6592742-6592764 CCGGGGCCTGTCCTTGGTTGGGG + Intergenic
949988204 3:9555757-9555779 TCTGGGGCTGCTCCTGGTTTGGG + Intergenic
950104471 3:10379439-10379461 GCCAGGCCTGCTCCTGCTTCAGG - Intronic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
950426752 3:12928456-12928478 CCAGGGCCGGCTCCAGGGTGGGG + Intronic
950477232 3:13221898-13221920 GGCGGGCCTGGTCATGGTTGAGG - Intergenic
952950042 3:38515525-38515547 CCAGGGCCAGCTCCTCGGTGAGG + Intronic
953024708 3:39138169-39138191 CCCTTGCCTGCTTCTGGTTCTGG + Intronic
953031877 3:39185002-39185024 CCAGGGCTTGCACCTGGTTCAGG + Exonic
953535154 3:43771530-43771552 CCCCTGCCTGCTCCTGTGTGAGG - Intergenic
953636793 3:44671094-44671116 CCCGGGGCTGCTCCTCCTTCAGG - Intergenic
954214585 3:49117220-49117242 CCTGGGCCCGCTTCTGGTTCCGG + Exonic
954327944 3:49873742-49873764 CCTCGGCCTGCGCCTGGGTGTGG + Intergenic
954453101 3:50582272-50582294 CCGAGGCCGGCTCCTGCTTGTGG - Exonic
954640000 3:52092183-52092205 CCCTGGCCTGCCCCTGTGTGGGG - Intronic
955231446 3:57102431-57102453 CCCTGGCCTGCCCCTTGTTGTGG + Intronic
961346416 3:126266477-126266499 CCCAGTCCTGCTCCTGGCCGCGG - Intergenic
962736438 3:138329603-138329625 CCCTGGCCGGCTCCGGGGTGGGG - Intronic
967135802 3:186511707-186511729 CCTGGCCCTGCCCCTGTTTGGGG + Intergenic
968234273 3:197022583-197022605 CCCGTCTCTGCTGCTGGTTGCGG - Intronic
968441260 4:625632-625654 TCCGGGCCTGCTCCTCACTGAGG - Exonic
968462063 4:731156-731178 CCCTGCCCTGTTGCTGGTTGTGG + Intronic
968486798 4:866812-866834 CCCGAGGCTGCTCCTGGGGGAGG + Intronic
968631766 4:1655567-1655589 CCCAGGCCTGCGCCTGGGCGCGG + Exonic
968701771 4:2060886-2060908 CCCGGCCGCGCTCCTGGTGGAGG - Intronic
968941840 4:3643103-3643125 CCTGGGCCTCCTCCGGCTTGTGG - Intergenic
969436700 4:7192938-7192960 CCCGGTCCCGCTCCTGGTCCCGG + Exonic
971531849 4:27698483-27698505 ACCGGGCCTGCTGTTGGGTGGGG - Intergenic
973967735 4:56181266-56181288 CCTGGGCCTGTTCCAGGTAGAGG + Intronic
974531594 4:63115280-63115302 CCAGGGCCTGTTGGTGGTTGGGG - Intergenic
974768281 4:66377309-66377331 CCAGGGCCTGCTTAGGGTTGGGG + Intergenic
980514095 4:133831150-133831172 CCGGGGCCTACTCCAGGTGGAGG + Intergenic
981346133 4:143678378-143678400 CCGGGGCCTGTTGTTGGTTGGGG + Intronic
981834971 4:149043727-149043749 GCAGGGCCTTCTCCTGTTTGTGG - Intergenic
982823238 4:159970517-159970539 CCAGGGCTTGCTCTAGGTTGTGG + Intergenic
985524414 5:394804-394826 GCAGGGCCAGCTCCTGGGTGAGG + Intronic
985998405 5:3610809-3610831 CCCTGGCCAGCTCCTGGGGGAGG + Intergenic
986456688 5:7927242-7927264 CCCTGGGCTGCTCCTGTCTGTGG + Intergenic
987381341 5:17288813-17288835 CCCCAGCTGGCTCCTGGTTGGGG - Intergenic
989567438 5:42915460-42915482 CCCAGGCTTGCTCTTGGTTCAGG - Intergenic
990736965 5:58875134-58875156 CCTGGTCCTGCTGCTGGTTGGGG - Intergenic
992747689 5:79835443-79835465 CCGGGGCCTGAGCTTGGTTGCGG + Intergenic
993381347 5:87212225-87212247 CCAGGGCCTGTTGCTGGGTGGGG - Intergenic
998161101 5:139813483-139813505 CACGGGCCCGCTGCTGGATGAGG - Exonic
998449472 5:142223020-142223042 CCAGCGCCTGCTCCTGGTCTTGG + Intergenic
999386507 5:151157556-151157578 CCCGTCCCTGCTCCTGGCGGGGG + Intronic
1001600712 5:172926440-172926462 TCCAGGCCTGGCCCTGGTTGTGG - Intronic
1002268758 5:178055596-178055618 CCCGAGCATGCTCATGGCTGCGG - Intergenic
1002419339 5:179137600-179137622 CCCTGGCCCACTCCTGGGTGGGG - Intronic
1002784727 6:392415-392437 CCCGGGCCTGCTCCGGGGTCCGG + Intronic
1004743090 6:18482135-18482157 CCCTTCCCTGCTCCTGGTTCTGG + Intergenic
1004903916 6:20218883-20218905 GCCAGGCCTGCTCCTGTTTTAGG - Intergenic
1006092278 6:31635122-31635144 CCCGGGGCAGCTCCTGGATTGGG - Exonic
1009459319 6:63893563-63893585 CCAGGGCCTGTTGGTGGTTGGGG + Intronic
1010898912 6:81401506-81401528 CCCGGGCCTGTTGCGGGGTGGGG + Intergenic
1013804937 6:113986441-113986463 CCCTGGCCTTTTCCTAGTTGTGG + Intronic
1017071008 6:150575719-150575741 CCCTGGCCAGCTCCTTGCTGTGG - Intergenic
1017649115 6:156564921-156564943 CCGGGGCCTGGGCCTGGCTGTGG - Intergenic
1018900703 6:168050410-168050432 CCAGGGCCTGTTCCTGGCTACGG - Intergenic
1019176291 6:170160924-170160946 CCTGGGCCTGCTCCTGTGTGGGG + Intergenic
1019513251 7:1428961-1428983 CCGGGCCCTGCTCCTGTCTGCGG - Intronic
1022943242 7:35258545-35258567 CCCGGGCCTCCTCCCGGCAGTGG + Intergenic
1024094088 7:45970575-45970597 GCCAGGCCTGCTTCTGTTTGGGG + Intergenic
1024633172 7:51265606-51265628 CCAGGGCTTTCTCCTGGTTGGGG - Intronic
1025234761 7:57227144-57227166 CCGGGGCCTGCTCCCAGGTGGGG + Intergenic
1026953621 7:74363423-74363445 CCCAGGGCTGCCCCTGGATGTGG - Intronic
1029123629 7:98283583-98283605 CCCGGAGCTGCACCGGGTTGGGG + Intronic
1034449093 7:151127915-151127937 CCGGGGCAGGCTCCTTGTTGTGG + Intronic
1034470266 7:151251128-151251150 CCCGGGCTTGGTCTTGGTGGTGG + Intronic
1035343596 7:158182477-158182499 CCAGGGCCTGCTGAGGGTTGGGG - Intronic
1036777037 8:11620659-11620681 CCCGGGGCTGCTTCTGGAGGGGG + Intergenic
1036928701 8:12931699-12931721 CCGGAGCCGGCTCCTGCTTGCGG - Intergenic
1038012844 8:23488337-23488359 CCAGGGCTTGCTCTTGGGTGTGG - Intergenic
1038856491 8:31338630-31338652 CCTGGGCCAGGTCCTGGTTGGGG + Intergenic
1042040256 8:64581669-64581691 CCAGGGCCTGCGCCTGCATGAGG - Exonic
1043052789 8:75404290-75404312 CCCGGGGCTGCTTCTGGCCGCGG - Intergenic
1044628260 8:94255543-94255565 CCCAGGCTTGCACCTGGTTAGGG - Intronic
1045249140 8:100468573-100468595 CCCTGCCCTGCTGCTGTTTGTGG - Intergenic
1046676250 8:117111834-117111856 ACCAGCTCTGCTCCTGGTTGAGG + Intronic
1048309635 8:133310430-133310452 CTGGGGCCTGTTCCTGGATGAGG + Intergenic
1048886698 8:138914795-138914817 CCCGGGCCTGCACCTGTTCATGG - Intergenic
1048999289 8:139814435-139814457 CCTGGGCCTGCTCTTGCCTGAGG - Intronic
1049176289 8:141194540-141194562 CCAGTGCCAGCCCCTGGTTGTGG - Exonic
1054788119 9:69229186-69229208 CTCGGGGCTGCTTTTGGTTGAGG - Exonic
1056928589 9:90855428-90855450 CCAGGGCCTGCTCCTGGACGAGG + Intronic
1057186161 9:93058655-93058677 CCTGGGCCTGGGCCTGGGTGAGG - Intergenic
1057199909 9:93134347-93134369 CCCGGGCCCGCCCCGGGTGGAGG - Intergenic
1060176389 9:121500012-121500034 CTCGGGCCTGCACGTGGTGGTGG + Intergenic
1060815960 9:126635269-126635291 CCCGGGCCTGCTCCCTGTGTGGG - Intronic
1060897039 9:127224942-127224964 GCGGGGCCTGCTCCGGGCTGAGG + Intronic
1062069500 9:134547917-134547939 ACTGGGCCTGCTCCTCGTGGGGG - Intergenic
1062354922 9:136157412-136157434 CCTGGGCCTGCTCGTGGTGGGGG + Intergenic
1062516699 9:136940544-136940566 GCAGGGGCTGCTCCTGGCTGTGG - Exonic
1185695452 X:2190886-2190908 CCGGGGCCTGCTGGGGGTTGGGG + Intergenic
1189421368 X:40861079-40861101 CCTGTGGCTGCTCCAGGTTGAGG + Intergenic
1190416417 X:50184512-50184534 CTCAGGGCTGCTCCTTGTTGGGG - Intergenic
1191677176 X:63803737-63803759 CCGGGGCCTGCTGGGGGTTGGGG + Intergenic
1192178749 X:68902443-68902465 CCAGGGGCTTCTCCTGGCTGGGG - Intergenic
1192265635 X:69535763-69535785 CCTGGGCCTGGGCCTGGCTGAGG - Intergenic
1198060029 X:133036329-133036351 CCAGGGCCTGCTGGTGGGTGGGG - Intronic
1199167525 X:144694795-144694817 TCTGGTCATGCTCCTGGTTGTGG - Intergenic
1200115983 X:153769918-153769940 CCTGGCCCTGCTCCTGGCGGGGG - Exonic
1200216511 X:154370505-154370527 CCCGGGCCTCCTCCTCCTCGGGG + Intronic
1200253187 X:154564589-154564611 CCGCGGCCAGCTCCTGGGTGGGG - Exonic
1200264580 X:154639826-154639848 CCGCGGCCAGCTCCTGGGTGGGG + Intergenic