ID: 1185385416

View in Genome Browser
Species Human (GRCh38)
Location 22:50529580-50529602
Sequence GCTTCATGCGGATCAGCTCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 78}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185385411_1185385416 4 Left 1185385411 22:50529553-50529575 CCGCTTCGCTCAGGCGGCCTCCG 0: 1
1: 0
2: 0
3: 2
4: 88
Right 1185385416 22:50529580-50529602 GCTTCATGCGGATCAGCTCCGGG 0: 1
1: 0
2: 0
3: 7
4: 78
1185385405_1185385416 22 Left 1185385405 22:50529535-50529557 CCACGAAGCCCCTGATGTCCGCT 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1185385416 22:50529580-50529602 GCTTCATGCGGATCAGCTCCGGG 0: 1
1: 0
2: 0
3: 7
4: 78
1185385406_1185385416 14 Left 1185385406 22:50529543-50529565 CCCCTGATGTCCGCTTCGCTCAG 0: 1
1: 0
2: 0
3: 0
4: 74
Right 1185385416 22:50529580-50529602 GCTTCATGCGGATCAGCTCCGGG 0: 1
1: 0
2: 0
3: 7
4: 78
1185385407_1185385416 13 Left 1185385407 22:50529544-50529566 CCCTGATGTCCGCTTCGCTCAGG 0: 1
1: 0
2: 2
3: 5
4: 39
Right 1185385416 22:50529580-50529602 GCTTCATGCGGATCAGCTCCGGG 0: 1
1: 0
2: 0
3: 7
4: 78
1185385409_1185385416 12 Left 1185385409 22:50529545-50529567 CCTGATGTCCGCTTCGCTCAGGC 0: 1
1: 0
2: 0
3: 7
4: 59
Right 1185385416 22:50529580-50529602 GCTTCATGCGGATCAGCTCCGGG 0: 1
1: 0
2: 0
3: 7
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185385416 Original CRISPR GCTTCATGCGGATCAGCTCC GGG Exonic
900216051 1:1482244-1482266 CCTTCAGGCGGATCTGCTCGCGG - Exonic
900223171 1:1520247-1520269 CCTTCAGGCGGATCTGCTCGCGG - Exonic
902629642 1:17697026-17697048 CCTTCTTGCGGGTCAGCTCTCGG - Exonic
916883777 1:169047495-169047517 GCATCATGCGGCTCAGACCCTGG + Intergenic
918047911 1:180952512-180952534 GCCTCAGGCGTATCACCTCCCGG + Intergenic
919302850 1:195791784-195791806 GCTCCATGCGAATCTGCTACTGG - Intergenic
922796131 1:228340720-228340742 CCTTGTTGCGGATCAGCTCCTGG - Exonic
924386132 1:243499142-243499164 GCTTCATGCAGATCAGGTTGGGG - Intronic
1072617643 10:97060133-97060155 ACTTGATGCCGTTCAGCTCCAGG + Exonic
1076875951 10:133215609-133215631 GCTTCATGAGGATGAGCACAAGG + Intronic
1084701847 11:70791545-70791567 TCTTCATACGCATCATCTCCAGG + Intronic
1087929824 11:103964275-103964297 GCTACATGCGGCTCAGCTACAGG + Intronic
1089250036 11:117152469-117152491 GCTGCATGCGGAATAGCTGCTGG - Exonic
1089599209 11:119603162-119603184 GCTTCACGTTCATCAGCTCCTGG + Intergenic
1090485309 11:127107427-127107449 GCTCTATGAAGATCAGCTCCAGG + Intergenic
1096559850 12:52428314-52428336 GCTTGATGTTCATCAGCTCCTGG + Exonic
1096574852 12:52546344-52546366 GCTTCAGGCTCATGAGCTCCTGG + Exonic
1096587185 12:52630349-52630371 CCTTGATGCTCATCAGCTCCTGG + Intergenic
1096589298 12:52646798-52646820 GCTTCACGTTCATCAGCTCCTGG + Exonic
1096617150 12:52839822-52839844 GCTTCGTGCTCGTCAGCTCCTGG + Exonic
1097176728 12:57147587-57147609 GCTGCATGAGGCTCAGCCCCAGG - Intronic
1114043180 14:18698707-18698729 GCTTCATGCTGCCCAGCTGCGGG - Intergenic
1114047470 14:18889153-18889175 GCTTCATGCTGCCCAGCTGCGGG - Intergenic
1114116743 14:19630255-19630277 GCTTCATGCTGCCCAGCTGCGGG + Intergenic
1115951637 14:38728153-38728175 GCTTGATGTGCATCAGCTCCTGG - Intergenic
1116326887 14:43541181-43541203 GCTTGATGTTCATCAGCTCCTGG + Intergenic
1118071347 14:62249687-62249709 GCTTCATCCCGCTGAGCTCCAGG - Intergenic
1124149556 15:27165322-27165344 GCTTGGTGGGGATCAGCGCCTGG - Intronic
1126144105 15:45461327-45461349 GCTTGATGTGGATCAGCCTCTGG - Intergenic
1130996490 15:88907254-88907276 GGTTCAGGCGGGCCAGCTCCGGG + Exonic
1132633038 16:928972-928994 GCTTCCTCTGGCTCAGCTCCTGG - Intronic
1135436312 16:22428917-22428939 TCTGCATGGGGGTCAGCTCCTGG + Intronic
1136026771 16:27473714-27473736 GCTTCATTCAGATACGCTCCAGG - Intronic
1139593423 16:67945370-67945392 GCTTAATGTGCACCAGCTCCCGG + Exonic
1143975386 17:10825538-10825560 GCTCCCTGTGCATCAGCTCCAGG - Exonic
1147350049 17:39835270-39835292 GCTTGATGGTCATCAGCTCCTGG + Intronic
1153135819 18:1916409-1916431 GCCTCGTGGGGATCATCTCCTGG + Intergenic
1155682916 18:28511954-28511976 GCTTCAGGCGTATCTTCTCCTGG + Intergenic
1156652359 18:39239268-39239290 GCATCATTGGGATGAGCTCCAGG + Intergenic
1157593813 18:48851742-48851764 CCTTCCTTCGCATCAGCTCCCGG + Intronic
1159963892 18:74577671-74577693 TCTTCTTGCAGACCAGCTCCAGG + Intronic
1161313447 19:3607200-3607222 GGTCCAGGCGGATCGGCTCCCGG + Intergenic
1161550801 19:4910981-4911003 GCTCCACGTGGAACAGCTCCTGG - Exonic
1162001099 19:7745596-7745618 CCTTCAGCCGGGTCAGCTCCTGG + Exonic
1162001109 19:7745665-7745687 CCTTCAGCCGGGTCAGCTCCTGG + Exonic
1162001136 19:7745872-7745894 CCTTCAGCCGGGTCAGCTCCTGG + Exonic
1162004044 19:7765831-7765853 CCTTCAGCCGGGTCAGCTCCTGG - Exonic
1162004055 19:7765900-7765922 CCTTCAGCCGGGTCAGCTCCTGG - Exonic
1162004066 19:7765969-7765991 CCTTCAGCCGGGTCAGCTCCTGG - Exonic
1167749772 19:51372529-51372551 GCTCCATGGGGATAAGCTCAGGG + Exonic
928829684 2:35465512-35465534 GCTTCATGTGCTTCAGCGCCAGG + Intergenic
934126155 2:88892748-88892770 GCTTCATGCTGATGAGCTGTAGG + Intergenic
938424848 2:131177681-131177703 GCTTCATGCTGCCCAGCTGCGGG - Intronic
942558660 2:177198223-177198245 GCTTGATGTTCATCAGCTCCTGG - Intergenic
945027603 2:205633864-205633886 TCTTCATGCTTATCATCTCCTGG - Intergenic
1174688962 20:52483781-52483803 GCTTCATCCAAAACAGCTCCAGG + Intergenic
1180466004 22:15611824-15611846 GCTTCATGCTGCCCAGCTGCGGG - Intergenic
1181175277 22:21031746-21031768 GCTTCAGGCGGTTCAGCTTCTGG + Exonic
1182526488 22:30923525-30923547 GCTTCAACCAGAGCAGCTCCAGG + Intergenic
1185385416 22:50529580-50529602 GCTTCATGCGGATCAGCTCCGGG + Exonic
961397423 3:126605419-126605441 GCTTCCTGTGAAGCAGCTCCTGG + Intronic
961412128 3:126730182-126730204 GCTTCATGAGGACAACCTCCCGG - Intronic
969131076 4:4991431-4991453 GCTTCATTAGGATCAGCCCGCGG - Intergenic
969606021 4:8202684-8202706 GCCTCAGCCGGATCAGCCCCGGG - Intronic
976527177 4:86107240-86107262 ACTTCATGAGGACCAGCTCCCGG + Exonic
982753787 4:159194338-159194360 CCTTCAGGCAGATCAGGTCCTGG + Intronic
992696992 5:79299199-79299221 GGTTCATGCTTAGCAGCTCCAGG - Intronic
997921951 5:137989483-137989505 CCTTCATGCTGATCGTCTCCAGG + Intronic
1002702412 5:181134003-181134025 GCTTCACGCGGATCAGCCACAGG + Intergenic
1004135236 6:12959690-12959712 GATTCATGAGGATGACCTCCAGG + Intronic
1005315521 6:24599474-24599496 GCTTGATGATCATCAGCTCCTGG - Intronic
1006339270 6:33437718-33437740 GCTTCTTGGGGGGCAGCTCCCGG - Exonic
1007175839 6:39896828-39896850 GCTTGCTGCGGACCAGCTCCCGG - Exonic
1011263180 6:85489430-85489452 TCTTCCTTAGGATCAGCTCCAGG - Intronic
1019523605 7:1471132-1471154 GCTCCATGCAGAACAGCCCCAGG - Exonic
1020256026 7:6503622-6503644 GCTCCATGCTCATCAGCACCTGG + Exonic
1023016270 7:35971287-35971309 GATTGATGTGGATGAGCTCCTGG - Intergenic
1023264899 7:38394186-38394208 GCTGCATCAGCATCAGCTCCAGG + Exonic
1024970823 7:55068573-55068595 GCTCCGTGAGGATCTGCTCCTGG + Intronic
1031310060 7:120185071-120185093 GCTTGATGCTGGTCATCTCCTGG - Intergenic
1034446132 7:151115157-151115179 GCTCCAGGCGGTTCACCTCCAGG - Intronic
1048658902 8:136574004-136574026 TCTTCATCTGAATCAGCTCCAGG - Intergenic
1055216949 9:73875767-73875789 GCTTCAAGAGGAACAGCTACAGG + Intergenic
1056697670 9:88873782-88873804 GCTTCATGAAGATCCGCCCCGGG - Intergenic
1188243320 X:27813935-27813957 GTTTTATGCACATCAGCTCCAGG + Intronic
1193431739 X:81414947-81414969 GCTTCAGGCGGATGAGTGCCTGG + Intergenic