ID: 1185385634

View in Genome Browser
Species Human (GRCh38)
Location 22:50530274-50530296
Sequence GTTCGGACGCGGCGCAGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 30}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185385624_1185385634 6 Left 1185385624 22:50530245-50530267 CCCCCTCCCGCCCTCGGTGGGGT 0: 1
1: 0
2: 0
3: 13
4: 187
Right 1185385634 22:50530274-50530296 GTTCGGACGCGGCGCAGCGCTGG 0: 1
1: 0
2: 0
3: 5
4: 30
1185385631_1185385634 -5 Left 1185385631 22:50530256-50530278 CCTCGGTGGGGTCTCGACGTTCG 0: 1
1: 0
2: 0
3: 3
4: 8
Right 1185385634 22:50530274-50530296 GTTCGGACGCGGCGCAGCGCTGG 0: 1
1: 0
2: 0
3: 5
4: 30
1185385627_1185385634 3 Left 1185385627 22:50530248-50530270 CCTCCCGCCCTCGGTGGGGTCTC 0: 1
1: 0
2: 0
3: 6
4: 135
Right 1185385634 22:50530274-50530296 GTTCGGACGCGGCGCAGCGCTGG 0: 1
1: 0
2: 0
3: 5
4: 30
1185385626_1185385634 4 Left 1185385626 22:50530247-50530269 CCCTCCCGCCCTCGGTGGGGTCT 0: 1
1: 0
2: 0
3: 7
4: 119
Right 1185385634 22:50530274-50530296 GTTCGGACGCGGCGCAGCGCTGG 0: 1
1: 0
2: 0
3: 5
4: 30
1185385630_1185385634 -4 Left 1185385630 22:50530255-50530277 CCCTCGGTGGGGTCTCGACGTTC 0: 1
1: 0
2: 0
3: 0
4: 14
Right 1185385634 22:50530274-50530296 GTTCGGACGCGGCGCAGCGCTGG 0: 1
1: 0
2: 0
3: 5
4: 30
1185385618_1185385634 15 Left 1185385618 22:50530236-50530258 CCCGAGAGTCCCCCTCCCGCCCT 0: 1
1: 0
2: 1
3: 28
4: 286
Right 1185385634 22:50530274-50530296 GTTCGGACGCGGCGCAGCGCTGG 0: 1
1: 0
2: 0
3: 5
4: 30
1185385625_1185385634 5 Left 1185385625 22:50530246-50530268 CCCCTCCCGCCCTCGGTGGGGTC 0: 1
1: 0
2: 0
3: 11
4: 171
Right 1185385634 22:50530274-50530296 GTTCGGACGCGGCGCAGCGCTGG 0: 1
1: 0
2: 0
3: 5
4: 30
1185385619_1185385634 14 Left 1185385619 22:50530237-50530259 CCGAGAGTCCCCCTCCCGCCCTC 0: 1
1: 0
2: 2
3: 43
4: 423
Right 1185385634 22:50530274-50530296 GTTCGGACGCGGCGCAGCGCTGG 0: 1
1: 0
2: 0
3: 5
4: 30
1185385629_1185385634 -1 Left 1185385629 22:50530252-50530274 CCGCCCTCGGTGGGGTCTCGACG 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1185385634 22:50530274-50530296 GTTCGGACGCGGCGCAGCGCTGG 0: 1
1: 0
2: 0
3: 5
4: 30
1185385628_1185385634 0 Left 1185385628 22:50530251-50530273 CCCGCCCTCGGTGGGGTCTCGAC 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1185385634 22:50530274-50530296 GTTCGGACGCGGCGCAGCGCTGG 0: 1
1: 0
2: 0
3: 5
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185385634 Original CRISPR GTTCGGACGCGGCGCAGCGC TGG Intronic
900113742 1:1020079-1020101 CTCCGGAGGCGGCGGAGCGCGGG - Intergenic
900237610 1:1600155-1600177 GCTCGGACCCGGCGCGGCGGCGG + Intergenic
903420735 1:23216881-23216903 GTTCGGGCGCGGCGCCGCGGAGG - Intergenic
912514606 1:110210233-110210255 GGCGGGGCGCGGCGCAGCGCGGG - Intergenic
916414039 1:164576397-164576419 GGTGCGACGCGGCGCCGCGCCGG - Intronic
1081845600 11:46238353-46238375 GGGCGGAGGCGGCGCGGCGCGGG + Intergenic
1086993476 11:93330751-93330773 GGGCGAGCGCGGCGCAGCGCAGG + Exonic
1103320005 12:120086970-120086992 CTACAGCCGCGGCGCAGCGCCGG - Intronic
1122691302 14:103533231-103533253 GTGCGGAGGCGGGGCAGCCCTGG + Intronic
1130076506 15:80695013-80695035 GCTGGGACGCGGCGCAGAGCCGG - Intronic
1141202790 16:81910649-81910671 GCTCGAACTCGGCGCAGCGCAGG - Exonic
1148744476 17:49910640-49910662 GTTCCCACGCTGCGCAGCGCTGG + Intergenic
1150562141 17:66303082-66303104 GGGCGGACGCGCCGGAGCGCCGG - Intronic
1160662199 19:306368-306390 GTTGGGACGCAGGGCAGAGCCGG - Exonic
1161069100 19:2251613-2251635 GGTCGGGCACAGCGCAGCGCGGG + Exonic
1162027675 19:7903786-7903808 GTTCGCACGCGGAGAAGGGCGGG + Intergenic
1162069887 19:8147326-8147348 GTGCGGAGGCGGGGCAGCCCAGG - Exonic
1163167599 19:15508617-15508639 GCGCGGCCGCGGCGCTGCGCTGG + Intronic
1166098196 19:40554704-40554726 GTTGGGAGTTGGCGCAGCGCTGG + Intronic
1166753697 19:45178029-45178051 GTTCGAACCCGGCCCAGCCCCGG - Intronic
929501395 2:42493989-42494011 GTTCGGAGGCGGCGAAGAGCCGG + Exonic
1185385634 22:50530274-50530296 GTTCGGACGCGGCGCAGCGCTGG + Intronic
963472797 3:145763864-145763886 GTGGGGACCCGGCGCAGAGCAGG + Intergenic
969240279 4:5892767-5892789 GCGCGCACGCCGCGCAGCGCTGG - Exonic
973635907 4:52862095-52862117 GGTCCGAGGCGGCGCAGCCCAGG - Intergenic
976608702 4:87007127-87007149 ATTCGGACGCGGCGCTCCCCGGG + Intronic
980130028 4:128809842-128809864 GTTCGGCCGAGGCGCTGGGCTGG - Exonic
990955061 5:61332440-61332462 GTGCGGGGGCGGCGCGGCGCTGG + Exonic
1006547493 6:34792049-34792071 GGGCGGCCGCGGCGCCGCGCTGG + Intronic
1016272249 6:142302207-142302229 GTCCCGCCGCGGCGCAGGGCTGG + Exonic
1019531092 7:1503909-1503931 GTTTGGCCGCGGCGCTGGGCCGG + Exonic
1045277739 8:100722349-100722371 CCACGGACGCGACGCAGCGCGGG - Exonic
1048862916 8:138737077-138737099 GGTGGGCCGCAGCGCAGCGCTGG - Intronic
1049784608 8:144444442-144444464 GCGGGGCCGCGGCGCAGCGCGGG - Exonic
1061502023 9:131009436-131009458 GGTCGGCGGCGTCGCAGCGCTGG - Exonic
1062622861 9:137430414-137430436 AGTCGGCCGTGGCGCAGCGCAGG - Intronic