ID: 1185387819

View in Genome Browser
Species Human (GRCh38)
Location 22:50544380-50544402
Sequence GCGCTCGCGCGCGCTGCCAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185387807_1185387819 15 Left 1185387807 22:50544342-50544364 CCGCGAGTCGCTGTCAACCCTCC No data
Right 1185387819 22:50544380-50544402 GCGCTCGCGCGCGCTGCCAACGG No data
1185387815_1185387819 -3 Left 1185387815 22:50544360-50544382 CCTCCAGGCGCGGCCCGGGGGCG No data
Right 1185387819 22:50544380-50544402 GCGCTCGCGCGCGCTGCCAACGG No data
1185387814_1185387819 -2 Left 1185387814 22:50544359-50544381 CCCTCCAGGCGCGGCCCGGGGGC No data
Right 1185387819 22:50544380-50544402 GCGCTCGCGCGCGCTGCCAACGG No data
1185387806_1185387819 16 Left 1185387806 22:50544341-50544363 CCCGCGAGTCGCTGTCAACCCTC No data
Right 1185387819 22:50544380-50544402 GCGCTCGCGCGCGCTGCCAACGG No data
1185387816_1185387819 -6 Left 1185387816 22:50544363-50544385 CCAGGCGCGGCCCGGGGGCGCTC No data
Right 1185387819 22:50544380-50544402 GCGCTCGCGCGCGCTGCCAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185387819 Original CRISPR GCGCTCGCGCGCGCTGCCAA CGG Intergenic
No off target data available for this crispr