ID: 1185388137

View in Genome Browser
Species Human (GRCh38)
Location 22:50545889-50545911
Sequence TCTACCAGGCAGAAGCAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185388125_1185388137 30 Left 1185388125 22:50545836-50545858 CCAGGCTGAGAGGAGGGACTGTG No data
Right 1185388137 22:50545889-50545911 TCTACCAGGCAGAAGCAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185388137 Original CRISPR TCTACCAGGCAGAAGCAGGT TGG Intergenic
No off target data available for this crispr