ID: 1185388303

View in Genome Browser
Species Human (GRCh38)
Location 22:50546596-50546618
Sequence CTTGAGTGGAAGCCGGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185388303_1185388315 23 Left 1185388303 22:50546596-50546618 CCATGGCCCGGCTTCCACTCAAG No data
Right 1185388315 22:50546642-50546664 AGAGGCATTAGGACAGCAACGGG No data
1185388303_1185388314 22 Left 1185388303 22:50546596-50546618 CCATGGCCCGGCTTCCACTCAAG No data
Right 1185388314 22:50546641-50546663 GAGAGGCATTAGGACAGCAACGG No data
1185388303_1185388316 24 Left 1185388303 22:50546596-50546618 CCATGGCCCGGCTTCCACTCAAG No data
Right 1185388316 22:50546643-50546665 GAGGCATTAGGACAGCAACGGGG No data
1185388303_1185388310 5 Left 1185388303 22:50546596-50546618 CCATGGCCCGGCTTCCACTCAAG No data
Right 1185388310 22:50546624-50546646 TGTCGAGGAGGCCCGCAGAGAGG No data
1185388303_1185388309 -7 Left 1185388303 22:50546596-50546618 CCATGGCCCGGCTTCCACTCAAG No data
Right 1185388309 22:50546612-50546634 ACTCAAGACGGCTGTCGAGGAGG No data
1185388303_1185388311 12 Left 1185388303 22:50546596-50546618 CCATGGCCCGGCTTCCACTCAAG No data
Right 1185388311 22:50546631-50546653 GAGGCCCGCAGAGAGGCATTAGG No data
1185388303_1185388307 -10 Left 1185388303 22:50546596-50546618 CCATGGCCCGGCTTCCACTCAAG No data
Right 1185388307 22:50546609-50546631 TCCACTCAAGACGGCTGTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185388303 Original CRISPR CTTGAGTGGAAGCCGGGCCA TGG (reversed) Intergenic
No off target data available for this crispr