ID: 1185389516

View in Genome Browser
Species Human (GRCh38)
Location 22:50551362-50551384
Sequence GCGCATCACCACCATGTCAT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 44}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185389515_1185389516 -7 Left 1185389515 22:50551346-50551368 CCAGCGTAGGGTTGGTGCGCATC 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1185389516 22:50551362-50551384 GCGCATCACCACCATGTCATAGG 0: 1
1: 0
2: 0
3: 3
4: 44
1185389508_1185389516 17 Left 1185389508 22:50551322-50551344 CCTCCAGCCGACGCATGGACTCG 0: 1
1: 0
2: 0
3: 2
4: 27
Right 1185389516 22:50551362-50551384 GCGCATCACCACCATGTCATAGG 0: 1
1: 0
2: 0
3: 3
4: 44
1185389510_1185389516 14 Left 1185389510 22:50551325-50551347 CCAGCCGACGCATGGACTCGGCC 0: 1
1: 0
2: 0
3: 4
4: 37
Right 1185389516 22:50551362-50551384 GCGCATCACCACCATGTCATAGG 0: 1
1: 0
2: 0
3: 3
4: 44
1185389511_1185389516 10 Left 1185389511 22:50551329-50551351 CCGACGCATGGACTCGGCCAGCG 0: 1
1: 0
2: 0
3: 3
4: 30
Right 1185389516 22:50551362-50551384 GCGCATCACCACCATGTCATAGG 0: 1
1: 0
2: 0
3: 3
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185389516 Original CRISPR GCGCATCACCACCATGTCAT AGG Exonic
922722055 1:227904292-227904314 GTGCATCCCCACCATGCCACTGG + Intergenic
923930615 1:238691699-238691721 GCCCATCACGACGATATCATGGG + Intergenic
1073206984 10:101774747-101774769 GCGCATCAACGCCATGGCAGAGG - Exonic
1073619027 10:105027781-105027803 GCCCTTCAGCACCATGTCCTGGG - Intronic
1096898921 12:54854213-54854235 GGGCATCTCCAACCTGTCATAGG + Intronic
1100618402 12:96249358-96249380 GCGCGTCACCACCAGCTCACAGG - Intronic
1101010296 12:100442666-100442688 GCTTATCACCACCATGTGTTAGG - Intergenic
1102831236 12:116002314-116002336 GGGAAAAACCACCATGTCATAGG - Intronic
1103558353 12:121779283-121779305 CCACATCACCACCATGTCCCAGG + Exonic
1108259595 13:48643668-48643690 GCACTCCACCACCATTTCATGGG + Intergenic
1113431008 13:110250578-110250600 GCACTTCACCTCCAGGTCATTGG + Intronic
1114969293 14:28005601-28005623 CCCCATCACCACCCTGTCACTGG - Intergenic
1116288772 14:43005815-43005837 GCCCATCATCATCATGTTATGGG - Intergenic
1121318432 14:92975836-92975858 TCTCATCATCCCCATGTCATGGG + Intronic
1122765244 14:104064643-104064665 GCACTTCACCACCTTGTCCTCGG + Intergenic
1124853372 15:33362461-33362483 TCTCATCACCACCATTTCATGGG + Intronic
1128335864 15:66785479-66785501 GCCCATCACAACCAGGGCATGGG - Intergenic
1133547919 16:6826014-6826036 GCACATCACCACGATGTGGTCGG - Intronic
1137612826 16:49830322-49830344 GAGCATCTCCCTCATGTCATGGG - Intronic
1138991237 16:62392940-62392962 CCGCCTCACCTCCATGCCATGGG - Intergenic
1156315986 18:35969143-35969165 TCACAACACCACCATGGCATAGG - Intergenic
1159604808 18:70464399-70464421 AAGCATCACCATAATGTCATGGG - Intergenic
1159755436 18:72358346-72358368 CCCCATCTCCACCATGACATGGG + Intergenic
1163351555 19:16779341-16779363 AGGCATCACCGCCATGGCATGGG + Exonic
1167557356 19:50204573-50204595 GCTGATCACCCCTATGTCATTGG + Intronic
926879995 2:17534617-17534639 GAGCATTACCCCCATTTCATAGG - Intergenic
942932743 2:181515152-181515174 GCTCTTCACCACCATAACATTGG - Intronic
1170449859 20:16471439-16471461 ACGTATTACCATCATGTCATTGG - Intronic
1175504736 20:59473540-59473562 GGGGATCACCACCATCACATTGG + Intergenic
1176096559 20:63347062-63347084 GGGCATCATCACCATGGTATGGG + Intronic
1184067044 22:42126962-42126984 ACTCATCACCAACCTGTCATCGG - Exonic
1184069769 22:42140666-42140688 ACTCATCACCAACCTGTCATCGG - Intergenic
1184071512 22:42150274-42150296 GCTCTTCACCAACCTGTCATCGG - Intergenic
1185389516 22:50551362-50551384 GCGCATCACCACCATGTCATAGG + Exonic
968939524 4:3630808-3630830 GGGCAGCAGGACCATGTCATAGG + Intergenic
969052292 4:4381763-4381785 GAGCATCACAACGATGTCATGGG + Intronic
969710944 4:8843083-8843105 GCTCTTCACCACCATGCCATCGG - Intergenic
970362455 4:15323462-15323484 GAGCATCTCCTCAATGTCATAGG + Intergenic
972274154 4:37541447-37541469 GCTCATCACCACCCTGTTAAAGG - Intronic
980170520 4:129284015-129284037 GCACATCTCTACCATCTCATGGG + Intergenic
980513039 4:133818767-133818789 GTTCAACACCACCATATCATAGG - Intergenic
1006925967 6:37655302-37655324 TGGCATCACCACCATCTCCTGGG + Intronic
1025077207 7:55953351-55953373 GTAAATCACCACCATGTCCTGGG + Intronic
1036201966 8:6777607-6777629 GCCCATCACACCCTTGTCATTGG - Intergenic
1036620413 8:10421505-10421527 GCGTGTCACCTCCATGTAATAGG + Intronic
1054451244 9:65404524-65404546 GGGCAGCAGGACCATGTCATAGG - Intergenic
1062046702 9:134427676-134427698 GCACATACCCACCCTGTCATGGG - Intronic
1186658873 X:11647418-11647440 GGGCATCAACAGCATGTCTTTGG - Intronic