ID: 1185391486

View in Genome Browser
Species Human (GRCh38)
Location 22:50563687-50563709
Sequence CTTGACAGGGCTTGGTAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185391481_1185391486 -8 Left 1185391481 22:50563672-50563694 CCATTCCAAGGTCGACTTGACAG No data
Right 1185391486 22:50563687-50563709 CTTGACAGGGCTTGGTAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185391486 Original CRISPR CTTGACAGGGCTTGGTAATG TGG Intergenic
No off target data available for this crispr