ID: 1185393374

View in Genome Browser
Species Human (GRCh38)
Location 22:50574419-50574441
Sequence GCCATGCTGGGCCTTCCCTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 251}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185393374 Original CRISPR GCCATGCTGGGCCTTCCCTC AGG (reversed) Exonic
900125124 1:1065423-1065445 GCCCTGCCTGGCCTTCCCGCTGG - Intergenic
900287276 1:1907685-1907707 GACAGGCTGGGCCTACCCCCAGG - Intergenic
900396721 1:2456136-2456158 GACAAGCTGGGCCTCCCCTCTGG - Intronic
900935103 1:5759929-5759951 GCCCTGCTGACTCTTCCCTCTGG + Intergenic
900981813 1:6050045-6050067 CCCAGGCTGGGCCTTTCCTGGGG - Intronic
901758730 1:11457016-11457038 GCCATGCTCTCCCTCCCCTCTGG - Intergenic
902128314 1:14236463-14236485 GCCTGGCCGGGGCTTCCCTCAGG + Intergenic
902953777 1:19910130-19910152 GACATACTGGGCCTCCACTCGGG - Exonic
903569196 1:24291824-24291846 GCCATGCTGTTCCTTCCACCTGG + Intergenic
903998284 1:27322096-27322118 GCCCCGCTTGGCCTTCCCCCGGG - Intergenic
904017251 1:27431643-27431665 GGCATTCTGGACTTTCCCTCTGG + Intronic
904200969 1:28818812-28818834 GTCATGCTGGGCCTGCCTCCAGG - Intronic
905035806 1:34917852-34917874 GCCATGATGCTCCTTCTCTCTGG + Intronic
905207978 1:36353751-36353773 GCCCTGCTGGGACTTCACTGCGG + Intronic
905942500 1:41875149-41875171 GCAATGCAGCGCCTTCCTTCAGG + Intronic
906048955 1:42854931-42854953 GCCAGGCTGGTCCTGACCTCAGG + Intergenic
906137873 1:43512945-43512967 GCCTTGCTGGGCCTTCCATGGGG - Intergenic
906495769 1:46303016-46303038 CCCAGGCTGGGCCTTGCCCCGGG + Intronic
907501367 1:54883904-54883926 GGCCTGCTGGCCCTACCCTCTGG + Intronic
911177517 1:94831955-94831977 GCCAAGCTGGTCCTGACCTCAGG - Intronic
911365908 1:96936992-96937014 GGCATCCTATGCCTTCCCTCTGG - Intergenic
912391621 1:109306987-109307009 TCCATGCTGGGCCTTCCCAGAGG + Exonic
917300752 1:173571386-173571408 ACCAGGCTGGCCCTTCCCTTAGG + Intronic
918233521 1:182557180-182557202 GTCTTGCTGGGCCTTCTCCCAGG - Intronic
920456472 1:206105268-206105290 GCCACTCTGGGCCGCCCCTCAGG - Intergenic
922391334 1:225146534-225146556 GCCAGCCTGGGCCTGCACTCTGG + Intronic
923669030 1:236024362-236024384 GCCATGCTGGTCCTGCCCCAGGG - Intronic
1062855093 10:776026-776048 GCCATGCAGGGCCTCCCGCCGGG - Intergenic
1063522119 10:6750620-6750642 CCCATGCTGGCCCTTACCTCAGG - Intergenic
1065774568 10:29107441-29107463 GACATGCTGGGCCCTCTCTAAGG + Intergenic
1067066149 10:43105376-43105398 ACCCAGCTGGGCCTTGCCTCGGG + Intronic
1067073311 10:43154515-43154537 GCCAGGCTGGTCCTGACCTCAGG - Intronic
1067708037 10:48625742-48625764 GCTTTGCTGGGCTTTCCTTCTGG + Intronic
1067748113 10:48951847-48951869 GCCTTGCTGGGCCCCACCTCGGG - Intronic
1067751851 10:48976910-48976932 CCCATGCTGGGCCCTCCATCAGG - Exonic
1070163729 10:73882028-73882050 GCCAGGCAGGGACTTGCCTCAGG + Intergenic
1070305780 10:75238366-75238388 GCCCTCCTGGGACTTGCCTCCGG + Intergenic
1070804615 10:79263841-79263863 GTGAGGCTGGGCCTTCCCTAGGG - Intronic
1072625519 10:97108559-97108581 GCCATGTTGGGCCTTTCGTGAGG - Intronic
1073297666 10:102450856-102450878 GCCCTGGTGGGCCTGCCCTCCGG - Exonic
1075087654 10:119424196-119424218 GCCAAGATGGCCATTCCCTCAGG - Intronic
1076114672 10:127886960-127886982 GGCCTGCTGGGCCTGCCTTCTGG + Intronic
1076316305 10:129544405-129544427 GCCATGCTGGGGCTTCCTGAGGG - Intronic
1076316549 10:129546158-129546180 CCCATGCAGGGCCTGCCATCTGG - Intronic
1076634092 10:131871704-131871726 TCCATGCAGGGCCTGCCCTTGGG + Intergenic
1076684636 10:132192532-132192554 GCCGTGCTGGCCTTTTCCTCGGG + Intronic
1076880684 10:133237878-133237900 GCCCCGCCTGGCCTTCCCTCCGG + Exonic
1077049299 11:559565-559587 GGGATGCTGGGGCCTCCCTCAGG - Intronic
1077103467 11:832276-832298 CCCATGCTGGTCCTCCCCTGTGG + Intergenic
1078446577 11:11409343-11409365 GACCTGCTGGGCCTGCCCTGTGG - Intronic
1078460702 11:11513192-11513214 GACATGCAGTGCCTTCCCTAAGG - Intronic
1081602247 11:44503572-44503594 GGCTTGCTGGGCTTTCCCTGGGG - Intergenic
1081603832 11:44514426-44514448 GCCACACTGGGCCTGGCCTCTGG - Intergenic
1081795039 11:45813031-45813053 GCCCTGCTGCCTCTTCCCTCAGG - Intergenic
1082940815 11:58703449-58703471 GCCATGCTCCGCCCTCCCTTAGG - Intronic
1084084240 11:66847591-66847613 GCGATGCTGCCCCTTCCATCCGG - Intergenic
1085456060 11:76666032-76666054 CCCATTCTGTGCCTGCCCTCAGG + Intronic
1086435245 11:86773640-86773662 GTCATGCTGGGCCAGCCCACAGG - Intergenic
1089326541 11:117661321-117661343 GCAATGCAAGGCCTTCCCTGGGG + Intronic
1089746959 11:120624292-120624314 GCCTTGCTGGACCTTCCCCATGG + Intronic
1090360347 11:126167995-126168017 TCCATCCTGGGCATTCCCTTGGG - Intergenic
1090796201 11:130137515-130137537 GTCATGCTAAGCTTTCCCTCTGG + Intronic
1091841908 12:3627575-3627597 GGCATGCACGGCCTTCCCTCTGG + Intronic
1091855456 12:3735831-3735853 GGCATGCTGGGCCTCACCTGCGG - Intronic
1092275906 12:7060804-7060826 GGCATGCTGGGCAACCCCTCTGG - Intronic
1092578474 12:9814569-9814591 GCCAGGCTGGGTCTTCAGTCAGG - Intergenic
1095508073 12:42919816-42919838 GCCATGATGAGCCAGCCCTCAGG - Intergenic
1095815515 12:46417821-46417843 GCCAGGCTGGTCCTGACCTCAGG + Intergenic
1096277824 12:50225758-50225780 GCCAGGCTGGTCCTGACCTCAGG + Intronic
1096839847 12:54373581-54373603 GCCCTACTGGGGCTCCCCTCGGG - Intronic
1096875336 12:54625766-54625788 GCTATGCTCAGCCTTCCATCTGG + Intergenic
1097966786 12:65590148-65590170 CCCAGGCTGGGCCTTCCCAGAGG - Intergenic
1098367259 12:69717419-69717441 GCCAGGCTGGTCCTGACCTCAGG + Intergenic
1101200602 12:102431819-102431841 GCCATGCATGGCATTCCTTCTGG - Intronic
1102302938 12:111783926-111783948 TCCATGGTGGGCCTTCTCCCTGG + Intronic
1103069208 12:117926794-117926816 GCCATGCTGTGCCATCTCCCAGG - Intronic
1103535770 12:121633022-121633044 CCCATGCTGGGCCTGACCTCAGG - Intronic
1103937060 12:124482429-124482451 GCCAGACTCGGCCTTCTCTCGGG - Intronic
1104918648 12:132279198-132279220 GCCTTGTTAGGCCTTCCCTGTGG - Intronic
1106219485 13:27733835-27733857 GCCAGGGTGGCCCTACCCTCAGG - Intergenic
1107824030 13:44311488-44311510 GCAATGCTGAGCCTGCCTTCTGG - Intergenic
1110401052 13:75092597-75092619 GCCATGCCTGCCCTTCCCACTGG - Intergenic
1110654137 13:77976608-77976630 GCCATGCTGAACCTTTTCTCAGG + Intergenic
1111717248 13:91895097-91895119 GCCCTGCTGAGTCTTCACTCAGG - Intronic
1121419025 14:93799316-93799338 GCCATGATGGGCAGTTCCTCTGG + Intergenic
1121538507 14:94707763-94707785 GCAGTGTTGGGCCTTCTCTCTGG - Intergenic
1121776313 14:96593244-96593266 GCCATTCTCGCCCTTACCTCTGG - Intergenic
1121874534 14:97439506-97439528 GCTATGCTGGGCCTTCTCTTTGG - Intergenic
1122425364 14:101602412-101602434 GCCATGCTGAGCCTTCTGCCTGG - Intergenic
1122599132 14:102912584-102912606 GCCTTGCTGGTCCTTCCGTCTGG + Intergenic
1122802537 14:104238900-104238922 GCCAGGCTACGCCTGCCCTCAGG + Intergenic
1122881609 14:104692893-104692915 CCCAGGCTGGCCCTTCTCTCAGG - Intronic
1122986225 14:105212846-105212868 GCCAGGCAGGGCCCTGCCTCAGG - Intronic
1125313834 15:38409743-38409765 GCCAATCTGAGCCTTTCCTCGGG + Intergenic
1126192644 15:45894734-45894756 GACATCCTGGTGCTTCCCTCAGG + Intergenic
1127703104 15:61520965-61520987 GCCATGGAGGGTCTTCTCTCAGG + Intergenic
1128516031 15:68342449-68342471 GCCACGCTGTGCCTTCCCAAAGG + Intronic
1131099113 15:89674073-89674095 GCCATGTTTGGCCTACACTCTGG - Intronic
1131507352 15:93030128-93030150 TCCCTGCTGGGCCTTCCTGCTGG - Intergenic
1131533076 15:93211248-93211270 GCCAGGCTGGTTCTTGCCTCCGG + Intergenic
1132559715 16:588015-588037 GCCAAGCTGGTCCTGACCTCAGG + Intergenic
1132590744 16:725353-725375 CCCCTGCTGAGGCTTCCCTCTGG + Intronic
1132625786 16:890890-890912 GACATCCAGGGCCATCCCTCTGG + Intronic
1132843796 16:1990775-1990797 GCCCTGCTGCTCCTTCCCTCCGG + Intronic
1133048583 16:3103321-3103343 GCCATGCTGGGACCACCCCCAGG - Intergenic
1134810962 16:17166728-17166750 GCCAGGCTGGTCCTGACCTCAGG + Intronic
1134832726 16:17336702-17336724 GCCATGGTGGCCCTTCCCTGTGG - Intronic
1136357880 16:29758247-29758269 GCCCTGCTGAGTCTTCTCTCAGG - Intergenic
1138231481 16:55340185-55340207 GCAAAGGTGGGGCTTCCCTCTGG + Intergenic
1138273070 16:55710011-55710033 CCCTTGCTGGGCCTTCTCTGGGG - Intergenic
1138458989 16:57136979-57137001 ACCATGCTGGCCCTTCCCTCTGG + Intronic
1139516185 16:67453746-67453768 GCCTTGCTGGGCCTCCCCAAGGG + Intronic
1139957771 16:70701289-70701311 GCCAGGCAGGGCCTTCCACCAGG - Intronic
1141036702 16:80632982-80633004 GCCCAGCTTGCCCTTCCCTCTGG + Intronic
1141856346 16:86683681-86683703 GCCAGGCTGGGGCATCTCTCGGG + Intergenic
1142235587 16:88921061-88921083 CCCACCCTGGGCCTTCCCCCAGG + Intronic
1142247648 16:88977173-88977195 GCCCTGCGCGGCCTTCCCTCGGG + Exonic
1142333526 16:89471574-89471596 GCCAAGCTGGTCCTGACCTCAGG - Intronic
1142810731 17:2394488-2394510 GCCATGCTGCGCCCACCCCCTGG + Intronic
1143038097 17:4012002-4012024 GGCATGCTGGGAGTTCCCTCCGG + Intronic
1144452626 17:15393786-15393808 GCCTTCATTGGCCTTCCCTCCGG + Intergenic
1144732727 17:17537806-17537828 GCCATGCTGGGCCCTGCAGCAGG - Intronic
1145268578 17:21392366-21392388 GCCAGACTCGTCCTTCCCTCGGG - Intronic
1145758140 17:27407922-27407944 GGCATGGTGTCCCTTCCCTCTGG - Intergenic
1148766699 17:50043792-50043814 CCCATGCAGGGCCATCCCTGGGG + Intergenic
1149227735 17:54494881-54494903 ACCATGCTGGGCCTGCCTTCAGG + Intergenic
1149434085 17:56618689-56618711 CCCATGCTGGTCCTTGCCCCTGG - Intergenic
1152328684 17:79657892-79657914 GCCATACTGGGCCTTCTCCTTGG - Intergenic
1152686170 17:81694848-81694870 CCCATGCTGGGCCTTACCTCAGG - Exonic
1155336422 18:24769780-24769802 GCCAGGCTGGTCCTGACCTCAGG - Intergenic
1159722695 18:71912869-71912891 TCCATTCTGGGCCTTCCTTTTGG + Intergenic
1160789458 19:916957-916979 GCCAGGCTGGGCCCACCCCCTGG + Intergenic
1160792264 19:928218-928240 CCCATGATGTGCCTTCCCTCTGG + Intronic
1162019783 19:7863130-7863152 GCCATGCTGGGCCTGGGGTCCGG - Intronic
1162489551 19:10984227-10984249 GCCATGCTGGGCCCTAGCCCGGG + Exonic
1162638321 19:11987623-11987645 GCAATGCTGCGCCCTCCTTCCGG - Intergenic
1162761254 19:12889789-12889811 GCCAGGCTGGTCCTGACCTCAGG + Intergenic
1163156503 19:15442647-15442669 GCCATGCTGGCCCTGACCTCAGG - Intronic
1163300806 19:16444933-16444955 GCCAGGCTGGTCCTGACCTCAGG + Intronic
1163819460 19:19487710-19487732 GCCATGCTGGGCCATGTCTGTGG + Intronic
1167591929 19:50408935-50408957 GCCCATCTGGGCCTTCCCTTGGG + Intronic
1167610629 19:50506305-50506327 GCCAGCCTGGGCATTCCGTCTGG + Intronic
925014206 2:509532-509554 GCCACCCTGGGCATCCCCTCTGG - Intergenic
925188241 2:1864114-1864136 GCCGGGCTGTGCCTTCCCTCTGG + Intronic
925217786 2:2111874-2111896 GCCATGGTGGGCGTTGCCCCCGG + Intronic
925865604 2:8223572-8223594 TCCCTGCTGGTCCCTCCCTCTGG - Intergenic
929782422 2:44965631-44965653 GCCATCCTGGGTCTTCCTGCAGG - Intergenic
930001599 2:46865481-46865503 GGCATCCTGGGCCTTCTCTAAGG + Intergenic
930160983 2:48155959-48155981 GACAGGGTGGGCCTTTCCTCAGG - Intergenic
930806953 2:55500334-55500356 GCCATCCTGACCCTTCCCTTAGG - Intergenic
931455313 2:62405449-62405471 GCCATTATGTGCCTTCCCTGAGG + Intergenic
932145369 2:69310875-69310897 GCCAAGCTGGGCCTGAGCTCTGG + Intergenic
932433925 2:71692031-71692053 GCCATGCTGGGCCAAGCCACAGG - Intergenic
932659700 2:73641542-73641564 GGCATGCTCGGCCATCCCCCGGG + Exonic
934580484 2:95434093-95434115 ACCATGCTTAGCATTCCCTCGGG + Intergenic
934598963 2:95642624-95642646 ACCATGCTTAGCATTCCCTCGGG - Intergenic
934762899 2:96866148-96866170 GGCATCCGGGGCCTGCCCTCTGG - Intronic
937337903 2:121072948-121072970 GCCAGGCTGGGCTTTCCTGCAGG - Intergenic
937662287 2:124444827-124444849 ACCATGCTCCTCCTTCCCTCAGG + Intronic
938992234 2:136641339-136641361 GCTCAGCTGGGCATTCCCTCAGG + Intergenic
939823982 2:146992139-146992161 GCCACGCAGGGCCTTTCCTTTGG + Intergenic
947987555 2:234462193-234462215 GCCAGGCTGGGCCCTACCTGGGG - Intergenic
1168751583 20:285788-285810 GCCAGGCTGGTCCTGACCTCAGG + Intronic
1170103574 20:12728844-12728866 GCCATGCTGGAGCTGTCCTCTGG - Intergenic
1171397838 20:24850128-24850150 GCCATGCTGGTCCATTGCTCTGG + Intergenic
1172148956 20:32777331-32777353 ACCACCCTGGGCCTTCCCCCAGG - Intronic
1172685255 20:36749018-36749040 GCCAGGCTGGTCCTGACCTCAGG + Intergenic
1172872312 20:38143441-38143463 GGTATGCAGGGCCCTCCCTCCGG - Intronic
1172997902 20:39084165-39084187 GCCCTGCTGGGCTTTGGCTCCGG - Intergenic
1176822028 21:13666261-13666283 AGCATCCTGGGCCTTCCCTGGGG + Intergenic
1178740376 21:35194538-35194560 GCCATACCGGGACTTCCATCTGG - Intronic
1178814941 21:35920664-35920686 GCCATGCTGGTTCTGTCCTCTGG - Intronic
1179509772 21:41864921-41864943 GCCAAGCTGGGTCCTGCCTCTGG + Intronic
1179618780 21:42598919-42598941 GCCATGCCTGACCTTCCCTAGGG + Intergenic
1180004688 21:45014930-45014952 GCCAGGCTGGGACTCCCCACTGG + Intergenic
1180109304 21:45640643-45640665 TCCAGGCTGAGCCTTTCCTCAGG - Intergenic
1181536647 22:23549631-23549653 GAGATGCTGGGGCTGCCCTCGGG - Intergenic
1182009262 22:26986685-26986707 TCCATGCTGGGCCTTCCTCTTGG - Intergenic
1182428698 22:30288145-30288167 GCCAGCCTGGGCCCTCCCTGGGG - Intronic
1183331724 22:37225940-37225962 GCCATGCTGTCCCCTCCCTGTGG - Exonic
1183363962 22:37397492-37397514 CCCATGCTGGCCCTGCCCACAGG + Intronic
1183631158 22:39033561-39033583 CCCATGGTGGGCTTTCCCACAGG + Intergenic
1183831445 22:40420352-40420374 GCCAGCCTGGCCCTTCCCACAGG - Intronic
1184684853 22:46091618-46091640 ACGCTGCTGGGCCTTCTCTCCGG + Intronic
1185211000 22:49570455-49570477 ACCATGCTGGGGCTTCCCAAAGG - Intronic
1185314323 22:50172133-50172155 GACATGCTGGGCCTGCCCCAAGG - Intronic
1185339834 22:50286338-50286360 GCCAGGCTGGGCCTCCCCTGGGG + Intronic
1185393374 22:50574419-50574441 GCCATGCTGGGCCTTCCCTCAGG - Exonic
952121159 3:30246018-30246040 GCCATGCTGTGCCTTCTGGCTGG + Intergenic
952556093 3:34532808-34532830 GACATGCAGGGGCTTTCCTCAGG + Intergenic
952750553 3:36821610-36821632 GCCATGCTTGGCCTCTGCTCGGG - Intergenic
952983646 3:38758621-38758643 GCCAATGTGGGCCTTTCCTCAGG + Intronic
953420130 3:42747839-42747861 GCCACGCTGGGCTTGCCTTCGGG - Intronic
954387654 3:50252653-50252675 GCCAGGCTGGTCCTGACCTCAGG - Intronic
954408619 3:50359280-50359302 GCCGTCCAGGGCCTTCCCTCAGG - Exonic
954419653 3:50411994-50412016 GCCACGCTGGGCTTCTCCTCTGG + Intronic
956311613 3:67887072-67887094 GCAATGCTTTTCCTTCCCTCAGG + Intergenic
957215648 3:77317190-77317212 ACACTGCTGGGCCTTCCATCCGG - Intronic
958942934 3:100334906-100334928 GCCGTGCGCGGCCTTCCCTGAGG + Intronic
960907278 3:122614052-122614074 GCCAGGCTGGTCCTGACCTCAGG + Intronic
961742158 3:129039708-129039730 GCAGGGCTGGGCCTTCCCTCTGG - Exonic
962373332 3:134839558-134839580 GCCCTGCTGTGCCATGCCTCAGG + Intronic
962892140 3:139681241-139681263 GCCAGGCTGGTCCTGACCTCAGG + Intergenic
966298323 3:178449913-178449935 AGCATGCTGGGCTTTCCATCAGG - Intronic
966881474 3:184353524-184353546 GCCAGGTGGGGGCTTCCCTCTGG - Intronic
968597979 4:1495134-1495156 GCCGTGCTGGGCCTCCCATTGGG - Intergenic
969113867 4:4859719-4859741 GGCGTGCTGGGCCTGGCCTCCGG - Exonic
969121369 4:4913826-4913848 GCCATGCTGGGATTTGACTCTGG + Intergenic
969401615 4:6959441-6959463 TCTCTGCTGGGCCTTCCCCCGGG + Intronic
970503734 4:16705540-16705562 GGCAGGCTGGGCTTGCCCTCAGG - Intronic
975296665 4:72742947-72742969 GGCAGGCTGGGCCTTATCTCTGG - Intergenic
975952075 4:79786162-79786184 GCCATTTTGGAACTTCCCTCAGG + Intergenic
978310552 4:107381331-107381353 CCCAGCCTGTGCCTTCCCTCCGG + Intergenic
981306235 4:143249526-143249548 GCCTTGCTGGGTCTCCCCTTCGG - Intergenic
983212967 4:164977494-164977516 GCCCTTCTGGGCCTTTCCTGCGG + Intronic
983902269 4:173147992-173148014 GCCAGGCTGGTCCTGACCTCAGG - Intergenic
984990170 4:185372718-185372740 GACATGATGGTCCTCCCCTCTGG + Intronic
985659942 5:1152053-1152075 GCCGAGCTGGACCTTCCCACAGG + Intergenic
992498486 5:77317770-77317792 GTCATGCTGGGCTTTCCAACTGG + Intronic
997450726 5:133980863-133980885 ACATTGCTGGGCCTTCCATCCGG - Exonic
997539443 5:134649185-134649207 GCCAGGCTGCGCCCTCCCCCCGG - Intronic
997652223 5:135530872-135530894 CCCTTGCTGGGCCTTCTCCCTGG + Intergenic
1002451679 5:179322493-179322515 GCCACGCTGGGTCCTCCCGCAGG + Intronic
1002480971 5:179500544-179500566 CCCAGGCTGGGCCTTCACTGGGG - Intergenic
1003871185 6:10404491-10404513 GCCGTGCCGGGCCTCACCTCCGG + Exonic
1004228897 6:13813914-13813936 GGCCTGCCGGGCCTTTCCTCGGG + Intronic
1004350444 6:14885997-14886019 GTCCTGCCGGGCTTTCCCTCTGG - Intergenic
1004516902 6:16328175-16328197 GCCATGCTGTGCCCTCCACCCGG + Exonic
1005318686 6:24629968-24629990 GCCAGGCTGGTCCTGACCTCAGG - Intronic
1006838902 6:37015681-37015703 CCCATGCTCGGCCCACCCTCGGG + Intronic
1009452481 6:63817863-63817885 GCCATGGTGGGCCTGCGGTCAGG + Intronic
1015504395 6:133967092-133967114 GCCATGCTGATTCTTCCTTCAGG + Intronic
1017125986 6:151065274-151065296 TCCCTGCTAGGCCTTCCCTCTGG - Intronic
1017137666 6:151162343-151162365 GCCAGGCTGGTCCTGACCTCAGG - Intergenic
1017322464 6:153109871-153109893 ACCATGTTGGGCTTTGCCTCAGG - Intronic
1017819255 6:158037939-158037961 ACCAGGCTGGGCCTTGGCTCTGG + Intronic
1018825275 6:167404141-167404163 GTCATGCTGGTCCGTCTCTCAGG + Intergenic
1019042167 6:169116321-169116343 ACCAGGCTGGGCATTCCCTCAGG - Intergenic
1019523329 7:1470133-1470155 GCCAGGCTGGGCTCTCCCTTGGG - Intergenic
1021222050 7:17985857-17985879 GCCTTGCTGGGTTTTCTCTCGGG + Intergenic
1022991739 7:35715100-35715122 GCCATGTTGGGCTTTGACTCAGG + Intergenic
1023035439 7:36127424-36127446 GCCATGCTGGTGCCTCCATCAGG - Intergenic
1024026515 7:45414131-45414153 GCCATAATCGGCCTTCCCTGTGG - Intergenic
1025014532 7:55428200-55428222 GCCTTGCTGGGCCTCACCCCTGG + Intronic
1025018664 7:55463799-55463821 GCCAGGGCGGGCCTGCCCTCAGG + Intronic
1025990183 7:66491699-66491721 GCCAGGCAGTGCCTTCCCTTGGG + Intergenic
1025995435 7:66524593-66524615 CCCAAGCAGGGCCTTCCTTCAGG - Intergenic
1026517638 7:71086701-71086723 ACCAGGCTGGTCTTTCCCTCTGG - Intergenic
1028204583 7:88001936-88001958 GCCATGCTGTGTCATCTCTCTGG + Intronic
1030113991 7:106049507-106049529 GCTATGCTGTGGCTTCCCTTTGG + Intergenic
1034932018 7:155170020-155170042 GCCCTGGTGGGACTTCCATCGGG + Intergenic
1034974177 7:155438386-155438408 GGCATTCTGGACCCTCCCTCAGG + Intergenic
1035373199 7:158392119-158392141 GCCAGGCTGGGGCTTCCGTGGGG + Intronic
1038245223 8:25848827-25848849 GACTTGCTGGGCCTCCACTCGGG + Intronic
1038380061 8:27084466-27084488 TGCAGGCTGGGCCATCCCTCAGG + Intergenic
1039079825 8:33723093-33723115 GCCCTGCCCGGCCTTCCCTCTGG - Intergenic
1039531162 8:38264347-38264369 GCCAGGCTGGTCCTGACCTCAGG + Exonic
1042118718 8:65460805-65460827 GCCAGGCTGGTCCTTACCTCTGG - Intergenic
1042683662 8:71414085-71414107 ACTATGTAGGGCCTTCCCTCTGG - Intronic
1048586320 8:135777418-135777440 GCAATACTGGCCCTCCCCTCGGG + Intergenic
1049395435 8:142398068-142398090 GCACTGCTGTGCCTTCCCTTGGG + Intronic
1049473159 8:142785192-142785214 GGCATGAGGGGCCTTCCCTGGGG + Exonic
1049494780 8:142924552-142924574 ACCAGGCTGGGCCAGCCCTCAGG + Intergenic
1049524083 8:143112000-143112022 ACCAGGCTGGCCGTTCCCTCAGG + Intergenic
1052033404 9:23653977-23653999 GCCTTGCTGTGTCTTCACTCTGG - Intergenic
1052833521 9:33234015-33234037 GCCATGCTGGCCATGCCATCTGG + Intronic
1053144631 9:35704174-35704196 ACTAAGCTGGGCCCTCCCTCAGG - Exonic
1056254011 9:84779827-84779849 TCCATGCTGGACTTTCTCTCTGG + Intronic
1056791401 9:89627619-89627641 GCCCTGCTCTGCCTTCCCTGGGG + Intergenic
1059310198 9:113383326-113383348 GCCATGTTTGGCCTGCACTCCGG - Intergenic
1061609022 9:131733770-131733792 GCCAGGCTGGGTCTTACCTCAGG - Intronic
1061811876 9:133167052-133167074 CCCCGGCTGGGCCTTACCTCTGG + Intergenic
1062559437 9:137134132-137134154 GCCAGGCTGGTCCTGACCTCAGG + Intergenic
1189120070 X:38385059-38385081 GCCAGGCTGGTCCTGACCTCAGG - Intronic
1189182078 X:39014061-39014083 GCCAGGCTGGCCCTTCCTGCTGG + Intergenic
1190359126 X:49632935-49632957 ACATTGCTGGGCCTTCCATCCGG - Intergenic
1194283599 X:91983087-91983109 ACATTGCTGGGCCTTCCATCCGG - Intronic
1196768828 X:119273238-119273260 GCCACGCTGGGCCTTCGGTAGGG - Intergenic
1196807449 X:119601169-119601191 GCCATGCTGGTCCTGACCTCAGG - Intronic
1198024560 X:132692593-132692615 TCCATGCTGGTCCTTGCCTCTGG + Intronic
1199635000 X:149806000-149806022 GCTCTGCTGAGTCTTCCCTCAGG - Intergenic
1199878364 X:151953360-151953382 GCCATTCTGGGCCTTGCCACTGG + Exonic
1200601173 Y:5207651-5207673 ACATTGCTGGGCCTTCCATCCGG - Intronic