ID: 1185393374

View in Genome Browser
Species Human (GRCh38)
Location 22:50574419-50574441
Sequence GCCATGCTGGGCCTTCCCTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 251}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185393374 Original CRISPR GCCATGCTGGGCCTTCCCTC AGG (reversed) Exonic