ID: 1185394540

View in Genome Browser
Species Human (GRCh38)
Location 22:50579966-50579988
Sequence ACTCAAGAACAGCAGGTATG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 173}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185394540_1185394545 -9 Left 1185394540 22:50579966-50579988 CCACATACCTGCTGTTCTTGAGT 0: 1
1: 0
2: 0
3: 8
4: 173
Right 1185394545 22:50579980-50580002 TTCTTGAGTGGGGTAGTCTGTGG 0: 1
1: 0
2: 0
3: 14
4: 168
1185394540_1185394547 10 Left 1185394540 22:50579966-50579988 CCACATACCTGCTGTTCTTGAGT 0: 1
1: 0
2: 0
3: 8
4: 173
Right 1185394547 22:50579999-50580021 GTGGGCCTTGCTTTGTAGAAAGG 0: 1
1: 0
2: 3
3: 9
4: 147
1185394540_1185394546 -8 Left 1185394540 22:50579966-50579988 CCACATACCTGCTGTTCTTGAGT 0: 1
1: 0
2: 0
3: 8
4: 173
Right 1185394546 22:50579981-50580003 TCTTGAGTGGGGTAGTCTGTGGG 0: 1
1: 0
2: 1
3: 14
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185394540 Original CRISPR ACTCAAGAACAGCAGGTATG TGG (reversed) Exonic
903276969 1:22228575-22228597 GCTCAGGAACAGCAGGGGTGAGG - Intergenic
905494522 1:38374326-38374348 AGTAAAGAGCAGCAAGTATGGGG - Intergenic
906798016 1:48712877-48712899 ACACCAAAACAGCAGCTATGAGG + Intronic
908482049 1:64550642-64550664 AGTGAAGTACAGCAGGTAAGAGG + Exonic
910860833 1:91741297-91741319 ACTCAAGAACAGCAGCCAGATGG + Intronic
910885149 1:91956318-91956340 ACTCAGGAAAAGCAGGCAGGGGG - Intronic
911661282 1:100504361-100504383 ACTCAAACACAACAGGGATGAGG - Intronic
913147439 1:116006263-116006285 ACTCCAGGACAACAGGGATGAGG + Intronic
914258460 1:145979248-145979270 AGGCAAGAAAACCAGGTATGAGG + Intergenic
915125772 1:153663011-153663033 ACCCTAGAACAGCAGGTATTGGG - Exonic
916464956 1:165064569-165064591 AGTAAAGAACAACAGGTATCAGG - Intergenic
917112590 1:171565143-171565165 GCTGAAGCATAGCAGGTATGGGG - Intronic
918007693 1:180557364-180557386 ACTGAAGACCAGGAGGTCTGGGG + Intergenic
918374466 1:183895300-183895322 GCCCAAGAACAGCATGGATGAGG + Intronic
918570306 1:185982740-185982762 ACTCAAGAAAATTAGGAATGTGG - Intronic
919053173 1:192536475-192536497 ATTCAACAACAGCAAGTATCAGG + Intergenic
922098413 1:222462076-222462098 ACTCAAGGTCAGAGGGTATGAGG - Intergenic
922341760 1:224662978-224663000 ACAGAAGAACATCATGTATGAGG + Intronic
923781643 1:237030490-237030512 ACTGAAGAACAAGAGGTTTGGGG + Intergenic
923888771 1:238187838-238187860 ACTCAAGGACAGGAGATATAAGG + Intergenic
924176736 1:241398994-241399016 TCTAAAGAAAAGCAGGTAGGTGG - Intergenic
924882554 1:248178010-248178032 ATTCAAGAACAGCTGTTATGTGG - Intergenic
1064067732 10:12196877-12196899 ACTTAAAAACATCAGGTAGGCGG + Intronic
1064480506 10:15735952-15735974 ACTCAAATCCAGCAGGAATGGGG - Intergenic
1066749824 10:38643013-38643035 AAAAAAGAAAAGCAGGTATGAGG - Intergenic
1066966823 10:42274763-42274785 AAAAAAGAAAAGCAGGTATGAGG + Intergenic
1073929554 10:108559004-108559026 ATGTAGGAACAGCAGGTATGTGG + Intergenic
1074309087 10:112306641-112306663 TCTCAAGAAAAGGAGTTATGGGG + Intergenic
1075663635 10:124215490-124215512 AATCCAGAGCAGCAGGTCTGGGG - Intergenic
1078290570 11:10006510-10006532 ACTCAAAAAAAGCAAGTAAGTGG - Intronic
1082686699 11:56246656-56246678 GCTGAGGAACAGCAGGTCTGTGG + Intergenic
1083982221 11:66181793-66181815 ACTGAGGTAAAGCAGGTATGTGG - Intronic
1086259985 11:84927906-84927928 AATCAAAAACACTAGGTATGTGG + Intronic
1086917822 11:92551172-92551194 CCTCAATTACAGCAGGTATCTGG + Intronic
1087609748 11:100420210-100420232 AATGAAGAAAAGCTGGTATGCGG + Intergenic
1088154244 11:106784178-106784200 TCTCAATAACAGCAGGAAAGGGG - Intronic
1088438254 11:109839847-109839869 ACTCAACAACAGTATTTATGGGG + Intergenic
1094019084 12:25895236-25895258 AGTCAAGAAGACCAGTTATGAGG + Intergenic
1096123546 12:49103988-49104010 AATGAAGAACACCTGGTATGTGG - Intronic
1097125448 12:56770933-56770955 ACTCAAGAAAATCTGCTATGAGG + Intronic
1098235398 12:68413208-68413230 AATCAAGAAGAACAGTTATGGGG - Intergenic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1100997649 12:100320229-100320251 ACTTAATAACAGCCGGGATGAGG - Intronic
1101541164 12:105666788-105666810 ACTCGAGAACAGCATGTTTCTGG + Intergenic
1101603128 12:106227542-106227564 TGACAAGAACAGCAGGGATGGGG - Intergenic
1103441642 12:120967356-120967378 ACTCAGGAACAACAAGGATGGGG + Intergenic
1103726756 12:123001038-123001060 ACACAAGGTCAGCAGGTCTGGGG - Exonic
1104530771 12:129568968-129568990 ACTCAGAAACCTCAGGTATGGGG - Intronic
1107200976 13:37716849-37716871 ACACAAGAGAAGCAGCTATGAGG - Intronic
1108804839 13:54141673-54141695 ACTCAAGATCAGCGGGGAAGAGG - Intergenic
1110767614 13:79298929-79298951 ACACAAGAAGGGCAGGGATGAGG - Intergenic
1116901402 14:50365540-50365562 ACTCCAGAGCAGCAGATATGTGG + Intronic
1119999189 14:79283365-79283387 ACTGATGAACAGCAGCTTTGAGG - Intronic
1120377397 14:83727990-83728012 ATTCAAGAGCAGTAGGTAAGTGG - Intergenic
1121722165 14:96116968-96116990 ACTCAAAAAAAGCAAGTAAGTGG + Intergenic
1121849352 14:97205818-97205840 ACTCAGGAACAGCAGTCATTGGG - Intergenic
1122313230 14:100810563-100810585 ACTCTTGAACATCAGGGATGGGG + Intergenic
1122763461 14:104048106-104048128 ACCCAAAAACAGCAGCTCTGGGG - Intronic
1126927392 15:53605335-53605357 ACTGAAGAACAGAAGGTGGGAGG + Intronic
1128074162 15:64816106-64816128 ACTGAAGCACAGCTGGTATATGG + Intronic
1129967956 15:79753526-79753548 TCCCAAGAACACCAGGTGTGAGG - Intergenic
1131216286 15:90538421-90538443 AATCAAATACAGCAGGTATAAGG + Intronic
1134365057 16:13569465-13569487 ATTCAACAAGAGCAGGGATGTGG - Intergenic
1139667790 16:68470544-68470566 ACTCGAGAACAGCAGGGAATCGG + Intergenic
1139735940 16:68988363-68988385 ACTGAAGAAAAGCAGCTCTGAGG - Intronic
1140736800 16:77905548-77905570 ACTTAAAAACAGCAGCTAGGTGG - Intronic
1140893817 16:79307717-79307739 ATTCCAGAAAAACAGGTATGGGG - Intergenic
1142481356 17:220129-220151 ACCCAAGAACAACAGCTCTGAGG + Intronic
1142481371 17:220264-220286 ACCCAAGAACAACAGCTCTGAGG + Intronic
1142481502 17:221389-221411 ACCCAAGAACAACAGCTCTGAGG + Intronic
1142481543 17:221749-221771 ACCCAAGAACAACAGCTCTGAGG + Intronic
1142481553 17:221839-221861 ACCCAAGAACAACAGCTCTGAGG + Intronic
1147031880 17:37645002-37645024 AATCAAGGAAAGCAGGTGTGAGG + Intergenic
1149455655 17:56785991-56786013 AGTCAAGATGACCAGGTATGTGG - Intergenic
1149527730 17:57369834-57369856 AGTTAAGAACAGAAGGCATGAGG - Intronic
1150010377 17:61497299-61497321 ACTCATGAACTGCCGTTATGAGG + Intergenic
1154145373 18:11862292-11862314 ACCCAAGTACAGCAAGGATGGGG - Intronic
1154159781 18:11972544-11972566 ACCCAAGACCCGCAGGAATGCGG - Intergenic
1154947142 18:21173139-21173161 ACTCTAGATCAGCAGATACGGGG - Intergenic
1160393526 18:78555715-78555737 ACTCAAGATCTGCAGGTCTCTGG + Intergenic
1161188570 19:2939632-2939654 ACTGAGAAACGGCAGGTATGAGG + Intronic
1163055242 19:14713088-14713110 AGTCATCTACAGCAGGTATGAGG + Intronic
1164797190 19:31043446-31043468 ACTTAAAAATAGCAGGGATGTGG + Intergenic
1164894998 19:31867775-31867797 ACCCAAGCACAATAGGTATGAGG + Intergenic
1165740866 19:38204312-38204334 ACTCAAACACAGGAGGTGTGGGG - Intronic
1166257233 19:41615239-41615261 TCTGATGAACAGCAGGTATTAGG - Intronic
927766797 2:25817707-25817729 AAACTAGAACAGCAGGTAAGAGG + Intronic
935836863 2:107064402-107064424 AATGGAGAACAGCAGGTTTGGGG + Intergenic
937774340 2:125758043-125758065 AGGCAAGAACAGCAGGTAAATGG - Intergenic
942089758 2:172478513-172478535 GCACAAGAAATGCAGGTATGCGG - Intronic
942249409 2:174034648-174034670 ACCCAAGTAGAGCAGGGATGAGG + Intergenic
942781386 2:179647586-179647608 AAACAAAAAGAGCAGGTATGTGG + Intronic
942907279 2:181199225-181199247 ACTCAGGAAAAGCATGTATTAGG + Intergenic
943052831 2:182937416-182937438 ACTCTAGAACAGAGGCTATGTGG + Intronic
945195972 2:207238052-207238074 AGTAAATAACAGCAGGGATGGGG - Intergenic
946580570 2:221124237-221124259 ACTCAAGAACAGCCTGCAAGAGG + Intergenic
1168985399 20:2043978-2044000 ATGCAGGAATAGCAGGTATGAGG - Intergenic
1169485149 20:6024059-6024081 ACTCAAGAAGCGCAGGCAAGAGG - Intronic
1169820594 20:9705406-9705428 TATCAAGAACACCAGGCATGAGG + Intronic
1171364488 20:24614473-24614495 ACTGAAGAACGGGAGGTTTGGGG - Intronic
1171996537 20:31736000-31736022 ACTCAAGAAGCTGAGGTATGAGG - Intergenic
1174461223 20:50684400-50684422 CCTCAAGAACAGCAATTGTGGGG + Intronic
1174481574 20:50834885-50834907 ACTCAACCACAGAAGGAATGAGG - Intronic
1177627873 21:23687797-23687819 ACATAAGAACAACAGGCATGTGG - Intergenic
1180539555 22:16430990-16431012 AAAAAAGAAAAGCAGGTATGAGG - Intergenic
1181779523 22:25182682-25182704 ACACCAGAGCAGCAGGTTTGGGG - Intronic
1182956225 22:34429205-34429227 ACTGAAGAACAGCAGGCTTTGGG - Intergenic
1185394540 22:50579966-50579988 ACTCAAGAACAGCAGGTATGTGG - Exonic
949094703 3:72401-72423 ATTCAAGAAAAGCAGGGCTGCGG - Intergenic
951641025 3:24835652-24835674 AATAAAGAACAGCAGTTAAGAGG - Intergenic
951850917 3:27138862-27138884 AGTCAAGAACAGCAGCTATTTGG - Intronic
953208792 3:40855987-40856009 TCTCAAGAACATCAGGTGAGGGG + Intergenic
961415775 3:126755449-126755471 TCTGCAGCACAGCAGGTATGAGG + Intronic
962978818 3:140469607-140469629 ACTACAGAACAGTAGGAATGGGG - Intronic
968514079 4:1009243-1009265 TCTCAGGAACAGCAGGTGTAGGG - Intergenic
970470984 4:16379163-16379185 ACTCAAAAAAAGCAAGTAGGTGG + Intergenic
970880014 4:20917851-20917873 ACCCAATAACGACAGGTATGTGG + Intronic
972986599 4:44773109-44773131 ACTCAAAAAAAGAAGGTAGGTGG - Intergenic
975661897 4:76696739-76696761 ACTTAAGAACAGATGGTATTGGG - Intronic
977303235 4:95292692-95292714 ATTCAAGAACATCAGGTAGCTGG - Intronic
977945022 4:102903173-102903195 AAAAAAGAAAAGCAGGTATGAGG - Intronic
979233127 4:118369041-118369063 AATCAAAAACAGCAAGTCTGAGG - Intergenic
979401023 4:120249783-120249805 TCTCAAGAACAGCTGGTAGAAGG - Intergenic
984256256 4:177393181-177393203 CCTCTAGAAAAGCAGATATGGGG - Intergenic
984475414 4:180228744-180228766 AGTCAAGGACAGGATGTATGAGG - Intergenic
985495201 5:200246-200268 ACCCATGGACAGCAGGCATGCGG - Exonic
985631285 5:1015353-1015375 ACTCAAGAACAGCAGCCAGGAGG - Intronic
985707713 5:1411113-1411135 AGTCAAGGACAGGAGGTCTGGGG + Intronic
985948418 5:3204309-3204331 ACACAAGAACAGCCTGTTTGGGG + Intergenic
986219829 5:5758114-5758136 ACTTATGAAGAGCAGATATGAGG - Intergenic
986310904 5:6550556-6550578 AATCCAGAACAGCAGTCATGAGG - Intergenic
986932110 5:12838294-12838316 TCTTAAAAACAGTAGGTATGTGG + Intergenic
987702446 5:21418708-21418730 ACTGAAGAACAGGAAATATGAGG + Intergenic
991187727 5:63829899-63829921 AGTCAAGTACAGTATGTATGAGG + Intergenic
992653399 5:78884479-78884501 GCTCAAGAATAGCAGGTTTCAGG - Intronic
993591423 5:89800296-89800318 ACTCAAGACCTGAAAGTATGGGG + Intergenic
994705197 5:103195374-103195396 ACTCAGGAAGTGGAGGTATGAGG + Intronic
994865973 5:105270615-105270637 ACTAAAGATCAGAAGGTATTTGG - Intergenic
999010008 5:148026043-148026065 ACTCATGAACAGAAGTTATATGG - Intronic
1000645620 5:163757130-163757152 ACTCAAGAGGACCAGGTTTGGGG + Intergenic
1002005119 5:176226288-176226310 CCTCAGGAGCAGCAGATATGAGG + Intergenic
1002221257 5:177684337-177684359 CCTCAGGAGCAGCAGATATGAGG - Intergenic
1002360924 5:178670158-178670180 GGACAAGAACAGCAGGTCTGCGG + Intergenic
1003817521 6:9858804-9858826 ACTCAAGAAGAGAAAGTTTGAGG + Intronic
1004741221 6:18463346-18463368 ACTCAAGAGCATCAGTGATGTGG + Exonic
1006616414 6:35330722-35330744 TCTCAACAACAGGAGGTATCAGG - Intergenic
1007492811 6:42237186-42237208 ACTTCAGAACAGCAGCCATGTGG + Intronic
1012255290 6:97024289-97024311 ACTCTATTACAGCAGCTATGTGG - Intronic
1017770506 6:157640504-157640526 TCTCAGGATCAGCAGGTATCAGG - Intronic
1019538306 7:1540078-1540100 ACTCAAGAACCGCGGCTACGCGG + Exonic
1021083655 7:16393303-16393325 ACTTAAGAACAGCAGGGAAAGGG + Intronic
1022050791 7:26668557-26668579 ACTGCAGAACAGCAGATTTGAGG - Exonic
1022107120 7:27204635-27204657 TCTCAAGGACAGCAGGTTTTTGG + Intergenic
1022790251 7:33681469-33681491 TCACAAGAACAGCATGGATGAGG + Intergenic
1024052661 7:45638615-45638637 ACACAAGACCAGCACATATGAGG - Intronic
1031963142 7:128007547-128007569 ACTCAGGCATAGCAGGAATGAGG - Intronic
1033473633 7:141670108-141670130 ACTTAAAAATAGCATGTATGAGG - Intronic
1034335847 7:150323198-150323220 ACTCAGGCACCGCAGGTAGGAGG + Intronic
1035935215 8:3829469-3829491 ACTCAAGAACAGCAGGGTGGCGG - Intronic
1036010172 8:4713240-4713262 ACTCAAGTACAGAAGGAATGCGG + Intronic
1036144961 8:6246275-6246297 ACTCAAAAACAGCAATCATGTGG - Intergenic
1040994629 8:53389339-53389361 TCTCTAGAACAGCTGGTCTGGGG - Intergenic
1051059812 9:13032874-13032896 ACTCAAAAACAGCAGGTAGTAGG - Intergenic
1051489675 9:17647512-17647534 ACTTAAGAACAACAGCTTTGTGG - Intronic
1052337083 9:27331108-27331130 AGTCAAGAAAAGCAGGAAGGAGG + Intronic
1053430879 9:38041019-38041041 ACTCAAGCAGAGAAGGTCTGAGG + Intronic
1054794148 9:69283347-69283369 ACTAAAGCCCAGCAGGTTTGTGG - Intergenic
1055128873 9:72751871-72751893 TCTCAAGAAGAGGAAGTATGAGG - Exonic
1056923410 9:90812105-90812127 AATTAAGAACAGCAGCTTTGGGG + Intronic
1057664345 9:97032902-97032924 ACTTAAGGACAGCATGTCTGGGG - Exonic
1059081627 9:111256190-111256212 ACTCAAGAAATTGAGGTATGAGG - Intergenic
1059699481 9:116761083-116761105 ACGAATGAACAGCAGATATGAGG - Intronic
1186404143 X:9286916-9286938 GTGCAAGAACAGCAGGTAGGTGG - Intergenic
1186938028 X:14472614-14472636 ACGCGAGAACAGGAGGTATTTGG + Intergenic
1187552137 X:20316556-20316578 TCTCAGGAACAGCACCTATGGGG - Intergenic
1189741473 X:44121346-44121368 ACTCAAGAAGTTCAGGTAGGAGG + Intergenic
1190265518 X:48825546-48825568 AGTCAAGAAGAGGAGGGATGGGG + Intergenic
1195334789 X:103841786-103841808 ACTTAAAAACACCAGGCATGAGG + Intergenic
1195675556 X:107504813-107504835 ACTCAAGGACTGCAGGTGTCTGG - Intergenic
1195813872 X:108864062-108864084 CCTCAAGAACAGCAGCTAGATGG - Intergenic
1196153537 X:112402015-112402037 CTAGAAGAACAGCAGGTATGGGG - Intergenic
1201180762 Y:11342630-11342652 AAAAAAGAAAAGCAGGTATGAGG - Intergenic