ID: 1185395527

View in Genome Browser
Species Human (GRCh38)
Location 22:50585286-50585308
Sequence CTTTTAATCCTCTTTACCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 166}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185395527_1185395530 0 Left 1185395527 22:50585286-50585308 CCAGTGGTAAAGAGGATTAAAAG 0: 1
1: 0
2: 1
3: 9
4: 166
Right 1185395530 22:50585309-50585331 CAGTTCACATTTATATGGGAAGG 0: 1
1: 1
2: 1
3: 37
4: 190
1185395527_1185395531 16 Left 1185395527 22:50585286-50585308 CCAGTGGTAAAGAGGATTAAAAG 0: 1
1: 0
2: 1
3: 9
4: 166
Right 1185395531 22:50585325-50585347 GGGAAGGACAGCTCTGTAAATGG 0: 1
1: 0
2: 0
3: 17
4: 193
1185395527_1185395529 -4 Left 1185395527 22:50585286-50585308 CCAGTGGTAAAGAGGATTAAAAG 0: 1
1: 0
2: 1
3: 9
4: 166
Right 1185395529 22:50585305-50585327 AAAGCAGTTCACATTTATATGGG No data
1185395527_1185395528 -5 Left 1185395527 22:50585286-50585308 CCAGTGGTAAAGAGGATTAAAAG 0: 1
1: 0
2: 1
3: 9
4: 166
Right 1185395528 22:50585304-50585326 AAAAGCAGTTCACATTTATATGG 0: 1
1: 0
2: 8
3: 47
4: 388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185395527 Original CRISPR CTTTTAATCCTCTTTACCAC TGG (reversed) Intronic
901991872 1:13121844-13121866 CTTATAATCACCTTTACCATAGG + Intergenic
902401709 1:16161445-16161467 CATTTAATCCTCTCTAGCCCTGG + Intergenic
902687467 1:18087984-18088006 CTTTGATTCCTCATTAGCACGGG - Intergenic
904417753 1:30373482-30373504 CTTTTATTCCCATTTAACACGGG - Intergenic
904552434 1:31330751-31330773 CATTTAATCCTCTTTGACAAAGG - Intronic
907363223 1:53938105-53938127 CTTTTCTTCATCTTTACAACGGG + Intronic
907442451 1:54487719-54487741 CTCTCAATCCTCTTTCCCAGCGG - Intergenic
908029200 1:59982012-59982034 CTTTTGTTCCTCTTCACCCCTGG + Intergenic
909508093 1:76417891-76417913 CTTTTCATCCTCTTCACCTGAGG - Intronic
910812496 1:91252724-91252746 ATTTTAGTCCTTTTTACAACTGG - Intergenic
912530354 1:110316371-110316393 TTTTTGACCCTCTTTACCCCAGG - Intergenic
918064810 1:181092922-181092944 CTTTTATTCCTCTTTTTCTCTGG + Intergenic
920956927 1:210628157-210628179 CTTTTTCTCCTCATTACCCCAGG - Intronic
921752320 1:218810171-218810193 CTTCTAATTCTCCCTACCACTGG - Intergenic
1062804742 10:409448-409470 CTTTTACTCCTCTTGACTCCAGG - Intronic
1063712888 10:8497262-8497284 CTTTTTGTCCATTTTACCACTGG + Intergenic
1063719468 10:8565184-8565206 CTTTCAATCCTCTTGATCAAGGG + Intergenic
1067727852 10:48785306-48785328 CTTTTAATCCTCTTTCACATGGG + Intronic
1067971091 10:50971680-50971702 CTTATAATTCTCTTCATCACTGG - Intergenic
1072039636 10:91594606-91594628 ATTTTAAGCCTATTGACCACAGG - Intergenic
1074649368 10:115501968-115501990 CTTTTAGTCCTCTTTAGAAGGGG - Intronic
1076831741 10:132998702-132998724 GTTTTCATCCTCTTAACAACAGG + Intergenic
1078227748 11:9408186-9408208 CTTTTAACCCTGTTTTCTACAGG - Intronic
1078924745 11:15864596-15864618 CTTTGAGTTCTCTCTACCACTGG - Intergenic
1080424925 11:32146563-32146585 CTTTTGATCCCTATTACCACTGG - Intergenic
1085432847 11:76470022-76470044 CTTGTAATTCTCTGTAACACTGG + Intronic
1086819107 11:91413104-91413126 CTTATAATGCCATTTACCACCGG + Intergenic
1086891577 11:92264910-92264932 CTTGGAATCCTCTTTACCCAAGG - Intergenic
1088135972 11:106555573-106555595 CTTTTAAAATTCTTTATCACTGG + Intergenic
1088417757 11:109608346-109608368 ATTTTAATCCTTATTACCAGTGG + Intergenic
1089426608 11:118381943-118381965 CTTCTAGTCCTCTTTTCCAAAGG + Intronic
1089812742 11:121144924-121144946 CTTGTATTCCTCTCTACCGCTGG - Intronic
1091637952 12:2212265-2212287 CTTTGAGTTCTCTCTACCACAGG - Intronic
1093608553 12:21125260-21125282 CTATTAATCCTCTATCCCAGTGG - Intronic
1095323562 12:40859710-40859732 CTTACAATTCTGTTTACCACAGG + Intronic
1096335924 12:50756249-50756271 CTTTTATTCCTCTTTTCCTCTGG - Intergenic
1099180211 12:79467788-79467810 CATATAATCCTCTTTCCCCCTGG - Intergenic
1100862598 12:98822271-98822293 CTTTTTATTTTTTTTACCACTGG + Intronic
1101553771 12:105787481-105787503 CCTTTAATTTTCTTTAACACTGG + Intergenic
1102819226 12:115893875-115893897 CTTTTCATCCTTTTTAAAACGGG + Intergenic
1107470385 13:40686023-40686045 CTTACACTCCTCCTTACCACTGG - Intergenic
1108405019 13:50092198-50092220 TTTTGAAACCTCTCTACCACTGG - Intronic
1109637280 13:65138314-65138336 CTTTTAATCTTCTTTTCCTAGGG - Intergenic
1112814003 13:103251234-103251256 CTTTTTATCCGCTGTACCAATGG - Intergenic
1113205334 13:107909789-107909811 CTTCTAATCCTTTTTAGCAGAGG + Intergenic
1114389223 14:22288371-22288393 CTTGTAATGCTCTCTACAACTGG - Intergenic
1115766232 14:36625992-36626014 CTCAAAATCCTCTTTACTACTGG - Intergenic
1116935578 14:50736440-50736462 CTTTTATAACTCTTTACTACAGG + Intronic
1117328253 14:54688419-54688441 TTTTAAAGCATCTTTACCACAGG - Intronic
1120303348 14:82735991-82736013 CTTTTACTCTTCTTTACCCTTGG - Intergenic
1124989465 15:34657025-34657047 CTTTTAAAACTCTTTACCCAAGG - Intergenic
1125604556 15:40932586-40932608 CTTTTAAGGATCTTTACAACTGG + Intronic
1127488737 15:59442124-59442146 CTTTTAACCCTGTTTACCCAGGG + Intronic
1129218019 15:74112415-74112437 CTTTTAACCATCTTCACCAAGGG + Intronic
1130261462 15:82357258-82357280 CTTTGTATCCTCTTTGCCAGTGG + Intergenic
1138050778 16:53775093-53775115 CTTTTCATCCTCTGCACCATAGG + Intronic
1139260295 16:65586087-65586109 CTTTTATTCCTCTTTTTCAATGG + Intergenic
1143509085 17:7385529-7385551 CATTTAATGCTCTCAACCACTGG + Intronic
1147004725 17:37393366-37393388 CTTTTAATCATCCTCACCAGTGG - Intronic
1148515028 17:48208824-48208846 CCTTTAATCCTATTTAGCAGAGG + Intronic
1150205169 17:63399076-63399098 CTTTCAATCCTCTTTGCCTGTGG + Intronic
1150467740 17:65408547-65408569 CTTTAAATCCTCTTGATCTCAGG - Intergenic
1153036355 18:766276-766298 CTTGTATTCCTCTTTACAAGTGG - Intronic
1155038891 18:22048306-22048328 ATTATGATCCTCTTTTCCACAGG - Intergenic
1156016848 18:32556160-32556182 CTTTTAATAGTCTTTCCCGCCGG - Intergenic
1158091432 18:53718293-53718315 CTTTTAACCCTCTTGGCAACTGG + Intergenic
1159924384 18:74254321-74254343 CTTTAAATCCACTTCAGCACAGG - Intronic
1161227246 19:3152444-3152466 CTTTTCATCCTCTAGCCCACCGG - Intronic
1163558946 19:18007913-18007935 CTTTTTTTCCTCTTTACCCCCGG + Intronic
1164991177 19:32685323-32685345 CTTTAAATCCTTTTGACAACAGG - Intergenic
1166177241 19:41082893-41082915 CTTTTGGTCTTCCTTACCACAGG - Intergenic
1168491913 19:56818123-56818145 TTTTAAGTCCTCTTTTCCACTGG + Intronic
926068322 2:9862167-9862189 TTTTTAATCTTCTTTGCCATTGG - Intronic
927228532 2:20796205-20796227 CTTTCAATCCTCTTCAGCAGAGG + Intronic
927587282 2:24319135-24319157 CTTTGAATCCTCTAGATCACTGG - Intronic
928070570 2:28210976-28210998 ATTTGAATTGTCTTTACCACTGG - Intronic
928969118 2:37008665-37008687 CTTTTAATGCTGCTAACCACAGG + Exonic
929436942 2:41936115-41936137 CTTATTATACTCCTTACCACGGG + Exonic
929896397 2:45964244-45964266 CTTTTAATCCTGCTGTCCACAGG + Intronic
932219364 2:69987983-69988005 GTTTTAAACCTCTTCATCACGGG - Intergenic
932290062 2:70569518-70569540 CTTTAATTCCTCTTTGCCAGGGG - Intergenic
933143650 2:78824500-78824522 TTTTTAATCCTCTGTAGCAATGG + Intergenic
936378120 2:111960014-111960036 CTTTTAATTCTCATTATCTCAGG - Intronic
936526277 2:113243706-113243728 CTTTTGATCCTATTAGCCACAGG + Intronic
936784633 2:116079177-116079199 TTTTTCATTCTCTTTACCATAGG + Intergenic
942972536 2:181974207-181974229 CTGTTTGTCCTCTTTCCCACAGG + Intronic
944102461 2:196043051-196043073 CAATTAATCCTCTTGCCCACTGG - Intronic
945712180 2:213311793-213311815 TTTTTTATCATTTTTACCACAGG + Intronic
946537711 2:220649164-220649186 CTTTTGATGCTCTTAACCAAAGG + Intergenic
948614287 2:239188376-239188398 CTGATAATTCTCTTGACCACAGG - Intronic
1171894568 20:30747904-30747926 AATATAATCCTCTTTCCCACTGG + Intergenic
1172329168 20:34062708-34062730 CTTATGAGCCTCTTTCCCACAGG - Intronic
1173429179 20:42970580-42970602 CATTTAATCCTCATGACGACTGG - Intronic
1173670616 20:44796226-44796248 CTTATATGCCTCTTTATCACAGG + Intronic
1175024640 20:55888978-55889000 CTTTGGCTCCTCTTTACCCCGGG - Intergenic
1176885618 21:14251731-14251753 CTTCTAATCCTGTTTTCTACAGG - Intergenic
1177451647 21:21275734-21275756 CTTTTCATATTCTTTGCCACAGG + Intronic
1177519010 21:22193385-22193407 CTTTTTATGCCCTTTACCAAGGG + Intergenic
1178605265 21:34030730-34030752 TTTTGAATCCCCTTTCCCACTGG - Intergenic
1184459070 22:44627001-44627023 CTTCCAATCCCCTTTCCCACGGG + Intergenic
1185395527 22:50585286-50585308 CTTTTAATCCTCTTTACCACTGG - Intronic
954283151 3:49599089-49599111 CTTTTAAGCCTGTTTGCCCCTGG + Intronic
958753157 3:98216981-98217003 TTTTTAATCCAATTAACCACTGG + Intergenic
958821814 3:98983475-98983497 ATTTTAAAGCTCTTTACCAGTGG + Intergenic
958951261 3:100418830-100418852 CTTTCAATCCTTCTTACCACAGG + Intronic
960236177 3:115285367-115285389 AATTTAACCCCCTTTACCACAGG + Intergenic
960810121 3:121620136-121620158 CTTCTAATCTTCTCTTCCACTGG - Intronic
962099028 3:132322410-132322432 TTTTTAATTTTCTTTACCAATGG + Intronic
966048280 3:175580682-175580704 CTTTTCATCTTGTTTACAACTGG - Intronic
968035456 3:195544137-195544159 CTTTTTATCGTCCTCACCACAGG + Intergenic
973722143 4:53735318-53735340 CATTAAATATTCTTTACCACAGG - Intronic
974386338 4:61204965-61204987 ATTTAAATACTCTTTTCCACAGG + Intronic
975046580 4:69811783-69811805 ATTTTCTTCCTCTTTACCAAAGG + Intronic
976367771 4:84248991-84249013 ATTTTAATGTTCTTTGCCACTGG - Intergenic
976502213 4:85804315-85804337 CTCTTCATCATCTTTACAACAGG + Intronic
979203038 4:118002243-118002265 ATTTTTCTCCTCTTTTCCACGGG - Intergenic
980379068 4:131986937-131986959 TTTTTAATTATCTTTATCACAGG + Intergenic
980980049 4:139647077-139647099 CTTTTCATGCTCGTTGCCACTGG + Intergenic
983742195 4:171149695-171149717 CTTTGAATTCTGTGTACCACCGG - Intergenic
983828954 4:172301285-172301307 CTTTTAAACTTCTTTGCCATGGG + Intronic
984568021 4:181354705-181354727 CATTTACTCCTCTTTACCTTTGG + Intergenic
984916846 4:184733166-184733188 CTTCTAATCCTTTTTTGCACTGG + Intronic
986970468 5:13329557-13329579 CATTTAATCTTCATTTCCACTGG - Intergenic
987594284 5:19975909-19975931 CATTAAATCCTCTTTAGCACTGG + Intronic
988770032 5:34423334-34423356 ATTTTAATCATCTTGACCACAGG - Intergenic
990547474 5:56837253-56837275 ATTTTATTCCTACTTACCACAGG + Intronic
992755485 5:79901711-79901733 CTTTTAATTCTCTTTCCTAATGG - Intergenic
993348296 5:86813456-86813478 TTTTTCATCCCCTTTATCACTGG + Intergenic
993956714 5:94243286-94243308 GTTTTAAGCCCCTTTACCAAAGG - Intronic
996134563 5:119823750-119823772 CTTTGACTCCTGTTTACCATTGG + Intergenic
999506315 5:152201095-152201117 TTTTTATTTCTCTTTACCACAGG + Intergenic
999730832 5:154475855-154475877 CCTTTAATCCTCTTCTCGACTGG + Exonic
1000073460 5:157762878-157762900 CTGTTATTCCTCTACACCACAGG - Intergenic
1000477739 5:161732215-161732237 CTTTTGAACTTCTTTACCAAAGG - Intergenic
1000938886 5:167336355-167336377 CTTTTTATCCTCTTAATCAAAGG - Intronic
1003235720 6:4293883-4293905 CTTTTAATCCTCTGCAACAGTGG - Intergenic
1004573993 6:16874776-16874798 CTTTTATTCCTCTCTTTCACTGG + Intergenic
1005084864 6:21995081-21995103 TTTTTTAACTTCTTTACCACAGG - Intergenic
1005402637 6:25450690-25450712 ATTTTAGTCATCTTGACCACAGG + Exonic
1006817023 6:36858565-36858587 CTTTTAGTCGGCTTCACCACAGG + Intronic
1007005945 6:38362578-38362600 CGTTTCATACTCTATACCACTGG - Intronic
1010441239 6:75897097-75897119 CTTTCAAATCTCATTACCACTGG - Intronic
1013020011 6:106205064-106205086 CTTTTAATGCTTTTTAGCAAAGG + Intronic
1013697998 6:112727161-112727183 CTTTTAAGTTTCTTTGCCACTGG - Intergenic
1015425288 6:133058429-133058451 ATTTTAAAACTCTTTACCAAAGG - Intergenic
1016191272 6:141267903-141267925 CTTTTTTTCTTGTTTACCACTGG - Intergenic
1016739005 6:147508833-147508855 CTTTTAATCCTCTCCTCCAAGGG - Intergenic
1018087736 6:160319487-160319509 CTTTTAATCCTTTTTCCCACTGG - Intergenic
1022028934 7:26474227-26474249 CTTTTGATTCTCTTTACTCCAGG - Intergenic
1022118315 7:27282228-27282250 ATTTTAACCCTGTTTACCTCTGG - Intergenic
1026563523 7:71470365-71470387 CTGTTTCTCCTCTGTACCACAGG - Intronic
1028804138 7:95004926-95004948 ATTAAAATCCTCTTTTCCACAGG - Intronic
1029901462 7:104044966-104044988 CCTTTATTCCTATTTACCATTGG - Intergenic
1032867594 7:135942569-135942591 TTTTTAATCCATTTTACCACTGG - Intronic
1035786757 8:2267291-2267313 CTTTGAATCCTCTTTTCCTAAGG - Intergenic
1035806050 8:2454425-2454447 CTTTGAATCCTCTTTTCCTAAGG + Intergenic
1039310992 8:36317520-36317542 CTATCCATCCTCTTTACCATGGG - Intergenic
1043408131 8:79960763-79960785 TTGTGAATCCTTTTTACCACAGG + Intronic
1045923923 8:107565708-107565730 ATTATCATCCTCTTTCCCACTGG - Intergenic
1045925275 8:107574590-107574612 ATTTTCATCCTCTCTTCCACTGG - Intergenic
1048818687 8:138358963-138358985 CCTTTTATCCTCTTAACCCCTGG - Intronic
1050308014 9:4325607-4325629 CTTTTAACCTTCATTAGCACTGG + Intronic
1055753637 9:79533918-79533940 CTTTTAAGTTTCTTTACAACTGG - Intergenic
1055890501 9:81118725-81118747 CTTTTAAGTCTCTTTACTCCAGG - Intergenic
1057798184 9:98172841-98172863 CTTTTAATCCTCATAAACCCAGG - Exonic
1061176607 9:129001502-129001524 CTTTTACTCATCTTTGCCTCTGG + Intronic
1061512619 9:131070155-131070177 CTGTTAACCCTCTTTACCAAGGG - Intronic
1187608021 X:20907435-20907457 CTTATAATCCTGTTTCCCAGAGG + Intergenic
1187608089 X:20908229-20908251 CTTATAATCCTGTTTCCCAGAGG + Intergenic
1189097405 X:38155011-38155033 CCTTTTATCCTCTTTTCCCCTGG - Intronic
1193409834 X:81149238-81149260 TTTTTAATCCACTCTACCATTGG - Intronic
1196780175 X:119376553-119376575 CTATTAATCCTCTTAACTCCTGG - Intergenic
1197580173 X:128272653-128272675 CATTTAATACTCTTTAACAGTGG - Intergenic
1198781689 X:140244609-140244631 CTGTTAATACTGTATACCACAGG + Intergenic
1201856031 Y:18544064-18544086 CCTATATTCCTCATTACCACTGG + Intergenic
1201877290 Y:18776321-18776343 CCTATATTCCTCATTACCACTGG - Intronic
1202029438 Y:20556383-20556405 CTTCTAGTAGTCTTTACCACTGG + Intergenic