ID: 1185395529

View in Genome Browser
Species Human (GRCh38)
Location 22:50585305-50585327
Sequence AAAGCAGTTCACATTTATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185395527_1185395529 -4 Left 1185395527 22:50585286-50585308 CCAGTGGTAAAGAGGATTAAAAG 0: 1
1: 0
2: 1
3: 9
4: 166
Right 1185395529 22:50585305-50585327 AAAGCAGTTCACATTTATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185395529 Original CRISPR AAAGCAGTTCACATTTATAT GGG Intronic
No off target data available for this crispr