ID: 1185397594

View in Genome Browser
Species Human (GRCh38)
Location 22:50600785-50600807
Sequence GAGGCCCGCGACTGCGGCGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 232}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185397594_1185397600 -8 Left 1185397594 22:50600785-50600807 CCCCCGCCGCAGTCGCGGGCCTC 0: 1
1: 0
2: 1
3: 21
4: 232
Right 1185397600 22:50600800-50600822 CGGGCCTCTCCCGGAGAAGATGG 0: 1
1: 0
2: 0
3: 6
4: 103
1185397594_1185397605 4 Left 1185397594 22:50600785-50600807 CCCCCGCCGCAGTCGCGGGCCTC 0: 1
1: 0
2: 1
3: 21
4: 232
Right 1185397605 22:50600812-50600834 GGAGAAGATGGCGGATCGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 164
1185397594_1185397601 -5 Left 1185397594 22:50600785-50600807 CCCCCGCCGCAGTCGCGGGCCTC 0: 1
1: 0
2: 1
3: 21
4: 232
Right 1185397601 22:50600803-50600825 GCCTCTCCCGGAGAAGATGGCGG 0: 1
1: 0
2: 0
3: 9
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185397594 Original CRISPR GAGGCCCGCGACTGCGGCGG GGG (reversed) Exonic
900100661 1:960781-960803 CACGCCGGCGGCTGCGGCGGTGG - Exonic
900393521 1:2443898-2443920 GAGGGCAGCGAGGGCGGCGGGGG - Intronic
903072200 1:20732054-20732076 CAGGCGCGGGGCTGCGGCGGCGG - Intronic
903420911 1:23217389-23217411 GCGGCCCCCGAGTTCGGCGGGGG - Intergenic
906204392 1:43979330-43979352 ATGGCCCGCGGCGGCGGCGGCGG + Intronic
911072916 1:93846722-93846744 GGGGCCCGCGACTGCGTGGGCGG - Intronic
915246350 1:154558633-154558655 GCGGACCGCGGCGGCGGCGGCGG - Exonic
918044916 1:180935837-180935859 GCAGCCCGCGACTGCGACTGCGG + Exonic
919916967 1:202144767-202144789 GAGGGCGGCGGCGGCGGCGGAGG - Intergenic
920222095 1:204411561-204411583 GAGGGCAGCGAATGCGGCAGCGG + Exonic
922832252 1:228609815-228609837 GAGGACCCCGGCTGCGGCTGCGG + Intergenic
922832812 1:228612056-228612078 GAGGACCCCGGCTGCGGCTGCGG + Intergenic
922833373 1:228614297-228614319 GAGGACCCCGGCTGCGGCTGCGG + Intergenic
922833933 1:228616538-228616560 GAGGACCCCGGCTGCGGCTGCGG + Intergenic
922834490 1:228618779-228618801 GAGGACCCCGGCTGCGGCTGCGG + Intergenic
922835044 1:228620994-228621016 GAGGACCCCGGCTGCGGCTGCGG + Intergenic
922835601 1:228623214-228623236 GAGGACCCCGGCTGCGGCTGCGG + Intergenic
922836159 1:228625456-228625478 GAGGACCCCGGCTGCGGCTGCGG + Intergenic
922836717 1:228627695-228627717 GAGGACCCCGGCTGCGGCTGCGG + Intergenic
922837276 1:228629937-228629959 GAGGACCCCGGCTGCGGCTGCGG + Intergenic
922837837 1:228632178-228632200 GAGGACCCCGGCTGCGGCTGCGG + Intergenic
922838395 1:228634418-228634440 GAGGACCCCGGCTGCGGCTGCGG + Intergenic
922838953 1:228636643-228636665 GAGGACCCCGGCTGCGGCTGCGG + Intergenic
922839513 1:228638884-228638906 GAGGACCCCGGCTGCGGCTGCGG + Intergenic
922840074 1:228641115-228641137 GAGGACCCCGGCTGCGGCTGCGG + Intergenic
922840634 1:228643356-228643378 GAGGACCCCGGCTGCGGCTGCGG + Intergenic
922841197 1:228645587-228645609 GAGGACCCCGGCTGCGGCTGCGG + Intergenic
922958693 1:229626279-229626301 GAGGACGGCGGCAGCGGCGGCGG - Exonic
1062774788 10:135758-135780 GGGGCCTGCGAGGGCGGCGGCGG + Intronic
1064183382 10:13139298-13139320 GAGGCACGGGACTGGGGCGGGGG - Intergenic
1071527467 10:86366659-86366681 GCGGCCCGCGGCTGTGGCAGCGG + Intergenic
1073032227 10:100535958-100535980 GATGGCGGCGACAGCGGCGGAGG + Exonic
1073108757 10:101048306-101048328 GAGCCCAGATACTGCGGCGGCGG + Intergenic
1074182581 10:111077299-111077321 GAGCTCCGGGACGGCGGCGGCGG - Exonic
1075802010 10:125159911-125159933 GAGGGCAGCGGCGGCGGCGGCGG - Intronic
1077047154 11:551701-551723 GAGGCCCGGGACTGCGTCTCAGG - Exonic
1082002365 11:47400250-47400272 GGGGGCCGGGCCTGCGGCGGGGG - Intergenic
1083176114 11:60951456-60951478 GGGGCCCTCGACGGTGGCGGCGG - Exonic
1084266975 11:68010195-68010217 GAGGCCCCCGAGGGAGGCGGTGG + Intronic
1084295911 11:68213387-68213409 GGGGGGCGCGACGGCGGCGGCGG - Exonic
1084364081 11:68686247-68686269 GAGGCCTGGGACAGGGGCGGGGG - Intronic
1085395721 11:76206274-76206296 CAGGCCAGGGACTGGGGCGGCGG - Intronic
1086696788 11:89856653-89856675 GAGGCCAGGGACTGGGGCTGAGG + Intergenic
1086709370 11:89987837-89987859 GAGGCCAGGGACTGGGGCTGAGG - Intergenic
1094484644 12:30914869-30914891 GAGGCCAGCAACTGAGGCAGTGG - Intergenic
1096983736 12:55743394-55743416 GGGCCCCGCGGCGGCGGCGGCGG + Exonic
1097250065 12:57627624-57627646 GAGCCACGCGGCTGAGGCGGGGG + Exonic
1098426063 12:70366542-70366564 GACGCCCCCGGCGGCGGCGGCGG - Exonic
1098550370 12:71755136-71755158 GCGGCCGGCGGCGGCGGCGGCGG + Exonic
1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG + Intronic
1100847775 12:98678542-98678564 GAGGCCCGAGCCTGCAGCTGTGG - Intronic
1100963077 12:99984756-99984778 GAGGAGCGCGGCGGCGGCGGCGG + Intergenic
1102371024 12:112382341-112382363 GAGGGCGGCGGCGGCGGCGGCGG - Intronic
1104915240 12:132260980-132261002 GAAGCCGACGACTGGGGCGGTGG + Intronic
1107058546 13:36131371-36131393 GAGGGCGGCGGCGGCGGCGGCGG + Intergenic
1108727790 13:53201117-53201139 GAGGGCAGCGGCGGCGGCGGCGG - Intergenic
1111951315 13:94711546-94711568 GCTGCCCGCGGCGGCGGCGGCGG + Exonic
1113378532 13:109784447-109784469 CCGGCCCGAGACGGCGGCGGCGG - Exonic
1113493930 13:110713589-110713611 GAGGGGCGTGAATGCGGCGGGGG + Intronic
1116186614 14:41606988-41607010 GAGGTCCGGGGCTGCGGCCGCGG - Intergenic
1118206416 14:63727771-63727793 GAGACCCTCGACTGCGAGGGCGG - Exonic
1118586788 14:67360597-67360619 GAGGCCCACGACAGCGCGGGTGG - Intronic
1120200578 14:81533899-81533921 GAAGCCCGCGACGGCGGGCGGGG - Intergenic
1120745357 14:88146901-88146923 GAGGCCTGGGACTGCTGCAGTGG - Intergenic
1121368111 14:93332936-93332958 GAGGGCGGCGGCGGCGGCGGTGG - Exonic
1121874034 14:97434651-97434673 GAGGCCCTCGCCTGGGGTGGGGG + Intergenic
1122486763 14:102087146-102087168 TAGGCGCGCGGCCGCGGCGGCGG - Intronic
1122602905 14:102930153-102930175 GAGGGCCTCGCCTGCGACGGAGG - Exonic
1123053932 14:105560455-105560477 GAGGCCAGGGACTGCGGATGGGG - Intergenic
1125238987 15:37550823-37550845 GAGGCCTGCGTCTGCAGCCGCGG + Intergenic
1128501296 15:68229337-68229359 GAGGCGCGCTACCGTGGCGGCGG - Intronic
1129893777 15:79089471-79089493 TATAGCCGCGACTGCGGCGGCGG + Intronic
1132426766 15:101724420-101724442 GGTGCCCGCGACTGCGGCGAGGG + Exonic
1132721054 16:1315795-1315817 GAGGCCCGTGGCTGTGGCCGTGG + Intronic
1132806418 16:1777132-1777154 GAGGCTCGCGACTGCTGGGGTGG + Exonic
1133040373 16:3057360-3057382 GAGGCCGGGGGCTGGGGCGGAGG - Exonic
1133156454 16:3880141-3880163 GCGGCCGGCGGCGGCGGCGGCGG - Exonic
1133156583 16:3880505-3880527 GAGCCCGGCGGCGGCGGCGGCGG - Exonic
1133784414 16:8963571-8963593 GGGCCCCGCGGCGGCGGCGGCGG - Intronic
1136267816 16:29131350-29131372 GAGGTCCTCGCCTGCAGCGGCGG - Intergenic
1136861552 16:33707240-33707262 GAGGCCCACGGCGGCGGCGCAGG - Intergenic
1138471957 16:57245133-57245155 GAGGCCCGGACCTGCGGCGTCGG + Exonic
1139890685 16:70251662-70251684 GAGGGCGGCGAGCGCGGCGGCGG - Exonic
1141076108 16:81007516-81007538 TAGGCTCGCGACTGCGTCAGGGG + Intronic
1141660084 16:85436878-85436900 GCGGCCCGGGACTGTGGGGGCGG + Intergenic
1141878855 16:86845007-86845029 GGGGCCAGGGACTTCGGCGGAGG - Intergenic
1143492917 17:7294428-7294450 GGTGCCCGCGACGGCGGCAGGGG - Exonic
1144909908 17:18672505-18672527 GCCGCCCCCGGCTGCGGCGGTGG + Intronic
1146398587 17:32487087-32487109 GAGCGCCGGGACCGCGGCGGCGG + Exonic
1146398679 17:32487363-32487385 AGGGCCCGGGACTGGGGCGGCGG + Intronic
1149915006 17:60600562-60600584 GCGGCCGGCGACGGCCGCGGAGG - Exonic
1149996377 17:61408160-61408182 GGAGCCGGCGGCTGCGGCGGCGG - Exonic
1150747297 17:67825953-67825975 GGGGCCGGCGGCGGCGGCGGCGG - Exonic
1152433116 17:80260537-80260559 GGGGCCGGCGGCGGCGGCGGCGG + Intergenic
1152433129 17:80260567-80260589 GGGGCCGGCGGCGGCGGCGGCGG + Intergenic
1152433142 17:80260597-80260619 GGGGCCGGCGGCGGCGGCGGCGG + Intergenic
1152433155 17:80260627-80260649 GGGGCCGGCGGCGGCGGCGGCGG + Intergenic
1152433168 17:80260657-80260679 GGGGCCGGCGGCGGCGGCGGCGG + Intergenic
1152433181 17:80260687-80260709 GGGGCCGGCGGCGGCGGCGGCGG + Intergenic
1152433194 17:80260717-80260739 GGGGCCGGCGGCGGCGGCGGCGG + Intergenic
1152433207 17:80260747-80260769 GGGGCCGGCGGCGGCGGCGGCGG + Intergenic
1152433220 17:80260777-80260799 GGGGCCGGCGGCGGCGGCGGCGG + Intergenic
1152433233 17:80260807-80260829 GGGGCCGGCGGCGGCGGCGGCGG + Intergenic
1152454904 17:80409073-80409095 GGGGCCCACGACTCCGGAGGGGG - Intergenic
1152617969 17:81346414-81346436 GAGACCCGAGACTGCGTCGCCGG + Intergenic
1152677258 17:81648062-81648084 GCGGCCCGCCGCTCCGGCGGTGG + Exonic
1154266591 18:12884038-12884060 GAGGTCGGCGACTGCCGCGTGGG + Intronic
1156099640 18:33578397-33578419 GGGGCGCGCGACGGCGGCGGCGG - Intergenic
1156275827 18:35581835-35581857 TAGGCGCGCGGCGGCGGCGGCGG - Intronic
1158137592 18:54224219-54224241 GACGGCGGCGGCTGCGGCGGCGG - Exonic
1161014860 19:1978519-1978541 GCGGCCCGCGGGTGGGGCGGGGG + Intronic
1161494750 19:4580951-4580973 GAGGCTCGCGGCTGCGCCGCTGG - Intergenic
1161527968 19:4769188-4769210 GAGGCCCGCAGCTGCGTGGGAGG + Intergenic
1162535829 19:11262453-11262475 GGGGCCCGGGGCGGCGGCGGCGG - Intronic
1162751761 19:12833857-12833879 GGGGACCGCGGCGGCGGCGGCGG - Intronic
1163442076 19:17327413-17327435 GGGGCCGGCGACAGGGGCGGGGG - Intronic
1163807248 19:19406445-19406467 GAACCCCGCGGCGGCGGCGGCGG + Intronic
1165080047 19:33301846-33301868 GAGGGCGGCGGCGGCGGCGGCGG + Exonic
1165351692 19:35279277-35279299 GAGGCCGGCGTGGGCGGCGGCGG - Exonic
1165493534 19:36139502-36139524 GTGGCCCCTGACTGGGGCGGGGG + Intergenic
1165782228 19:38441391-38441413 GAGGCCCTCGGCGGGGGCGGGGG + Intronic
1166039337 19:40192270-40192292 GAGGCCCGCGGGTGCAGCGGGGG - Exonic
1166347725 19:42176793-42176815 GAGGGCCGGGGCCGCGGCGGCGG + Intronic
1167074987 19:47243224-47243246 GAGCCCCGCGGCTGCGGCGCGGG - Intergenic
1167578936 19:50330892-50330914 GGGGCCAGCGGCTGCGGCTGGGG + Intronic
1167852262 19:52211260-52211282 GTGGCCAGCGACTCCAGCGGTGG - Exonic
1168076324 19:53982541-53982563 GGGGCCGGCGGCGGCGGCGGCGG + Exonic
928928028 2:36598037-36598059 GAGCCCCGAGCCTGGGGCGGAGG - Exonic
929174232 2:38960554-38960576 GCGGGCGGCGACGGCGGCGGCGG - Exonic
935112320 2:100104809-100104831 GAGCACCGCGGCGGCGGCGGCGG - Intronic
935196640 2:100820234-100820256 GAGACCCGCAGCCGCGGCGGCGG + Exonic
935592439 2:104855287-104855309 GGGGGCCGCGGCGGCGGCGGCGG + Intergenic
935592699 2:104856106-104856128 GAGGTGCGCGGCGGCGGCGGCGG - Exonic
935692619 2:105744886-105744908 GATCCCCGCGGCAGCGGCGGCGG - Exonic
937325665 2:120988516-120988538 GAGGCCAGCCAGTGCAGCGGCGG + Exonic
937868539 2:126771496-126771518 GAAGCCCGAGACTGCAGCTGAGG + Intergenic
938273021 2:129992524-129992546 GAGGCCAGCGCCGGCGGCGGCGG + Intergenic
938443203 2:131353582-131353604 GAGGCCAGCGCCGGCGGCGGCGG - Intronic
940639086 2:156329420-156329442 GAGCCCCGCGACGGCGGTGAGGG + Exonic
941119114 2:161507860-161507882 TGGGCCCGCGGCGGCGGCGGCGG - Intronic
944831215 2:203535337-203535359 GCGCCCCGCGGCGGCGGCGGCGG + Exonic
946322232 2:218960808-218960830 GAGGCCGCCGCCAGCGGCGGGGG + Exonic
946410987 2:219515038-219515060 GAAGCCCGCCACTGGGGCTGGGG - Exonic
948140479 2:235669511-235669533 GAGTCCCGGGAGCGCGGCGGCGG - Intronic
948365574 2:237452440-237452462 AATGCCCGTGACAGCGGCGGAGG + Intergenic
1168853082 20:989833-989855 GAGGCCCGCGTCTCCAGCTGGGG - Intronic
1169093167 20:2873623-2873645 GAGCCCCGCGGCGGCGGCGGCGG - Intronic
1171977592 20:31605410-31605432 GGGGCCCGCGGCGGCGGTGGCGG - Exonic
1172951199 20:38724430-38724452 GAGGGCGGCGGCGGCGGCGGCGG - Intergenic
1174287288 20:49482538-49482560 AAGGCCCGCTGCTGCGGGGGAGG + Exonic
1176547617 21:8208467-8208489 ACCGGCCGCGACTGCGGCGGCGG + Intergenic
1176549735 21:8216031-8216053 GAGGGCGGCGGCGGCGGCGGGGG + Intergenic
1176555515 21:8252678-8252700 GACCGCCGCGACTGCGGCGGTGG + Intergenic
1176557626 21:8260260-8260282 GAGGGCGGCGGCGGCGGCGGGGG + Intergenic
1176566568 21:8391514-8391536 ACCGGCCGCGACTGCGGCGGCGG + Intergenic
1176568660 21:8399065-8399087 GAGGGCGGCGGCGGCGGCGGGGG + Intergenic
1176574444 21:8435701-8435723 ACCGGCCGCGACTGCGGCGGCGG + Intergenic
1176576569 21:8443294-8443316 GAGGGCGGCGGCGGCGGCGGCGG + Intergenic
1176611056 21:8986993-8987015 ACCGGCCGCGACTGCGGCGGCGG + Intergenic
1177011096 21:15730524-15730546 GAAGCCCGGGAAGGCGGCGGCGG - Intronic
1181051020 22:20238309-20238331 GGGGCGGGCCACTGCGGCGGCGG - Intergenic
1183439498 22:37815383-37815405 GAGGCCAGTGACAGCAGCGGTGG + Intronic
1185388405 22:50546920-50546942 GAGGCCGGGGCCGGCGGCGGCGG + Intergenic
1185397594 22:50600785-50600807 GAGGCCCGCGACTGCGGCGGGGG - Exonic
1203254619 22_KI270733v1_random:132352-132374 GAGGGCGGCGGCGGCGGCGGCGG + Intergenic
1203260547 22_KI270733v1_random:169838-169860 ACCGGCCGCGACTGCGGCGGCGG + Intergenic
1203262675 22_KI270733v1_random:177431-177453 GAGGGCGGCGGCGGCGGCGGCGG + Intergenic
950418406 3:12882452-12882474 GAGGCCCCCGGCTGCCGCCGCGG + Intergenic
950759363 3:15206643-15206665 GCGGCCCGGGCCTGCGGCCGAGG + Intronic
951411573 3:22372732-22372754 GAGCGCCGCGAGCGCGGCGGAGG - Intronic
952799508 3:37275568-37275590 TAGGCCCGGGCCTGCGGTGGTGG + Intronic
952867189 3:37862000-37862022 GAGCCCAGCGGCGGCGGCGGCGG + Intronic
954361554 3:50125246-50125268 GAGGCCGGCACCTGGGGCGGGGG + Intergenic
955387613 3:58492067-58492089 GCGCCCGGCGACGGCGGCGGCGG - Intergenic
955911576 3:63863963-63863985 GGGTCCCGCGGCGGCGGCGGCGG - Intergenic
955916388 3:63912317-63912339 GCGGCCCGCCACCGCGGCGCTGG - Intronic
965166224 3:165196485-165196507 GACGCTCGCGGCGGCGGCGGCGG + Intronic
966182197 3:177197557-177197579 GAGGCCCGCGGCGGCGGCGGCGG + Intergenic
967184228 3:186931208-186931230 GAGGCCCGCGGCAGCGGAGGGGG + Intronic
968286207 3:197510288-197510310 GAGGCCGGCGCCGGCTGCGGAGG + Exonic
968523215 4:1043881-1043903 GAGGCCCTGGGCTGGGGCGGGGG - Intergenic
968849548 4:3069700-3069722 GAGGCGCAGGACAGCGGCGGGGG - Intergenic
969330823 4:6472634-6472656 GGGGCCTGCGACAGCGGCGGCGG - Intronic
971264891 4:25088691-25088713 GTGGCCCACGAGAGCGGCGGGGG - Intergenic
972062542 4:34895231-34895253 GTGGCCTGCGCCTGTGGCGGAGG + Intergenic
975973752 4:80072679-80072701 GACGCCGGCGCCTGCGGCAGCGG + Intronic
976146125 4:82044189-82044211 CTGCCCCGCGGCTGCGGCGGAGG + Intronic
981270745 4:142845724-142845746 CAGGCCGGCGGCGGCGGCGGCGG + Intronic
985896183 5:2751177-2751199 GAAGCCGGCGGCGGCGGCGGCGG + Exonic
986297080 5:6448719-6448741 GGCGCCGGCGGCTGCGGCGGCGG + Exonic
988825302 5:34929663-34929685 GAGCCCGGCGGCGGCGGCGGCGG - Exonic
989565135 5:42894279-42894301 GATGCCAGCGCCTGCGGAGGTGG + Intergenic
989565732 5:42899143-42899165 GATGCCAGCGCCTGCGGAGGTGG - Intergenic
989573874 5:42971301-42971323 GATGCCAGCGCCTGCGGAGGTGG + Intergenic
990825488 5:59893555-59893577 GAGGGCAGCGACAGCGCCGGCGG - Exonic
993901217 5:93585108-93585130 GCGGCCCGCGGCGGCGGCGGCGG + Exonic
995650364 5:114362185-114362207 GAGGAGCGCGGCGGCGGCGGCGG - Exonic
996405043 5:123095613-123095635 GAGGGCCGCGACCTTGGCGGCGG + Intronic
996862812 5:128084227-128084249 GCGGGCCGCTGCTGCGGCGGCGG + Exonic
1002349942 5:178576809-178576831 GAGGCCCGCGCTGGAGGCGGAGG - Intronic
1002490713 5:179575035-179575057 GAGGACTGCGGCTGGGGCGGGGG - Intronic
1002525332 5:179812467-179812489 GATGCCAGCGCCTGCGGAGGTGG - Intronic
1002671681 5:180872683-180872705 GAGGCTTTCGACTGTGGCGGGGG + Intergenic
1003107677 6:3228210-3228232 GAGGCCAGCGACTGCCCAGGCGG + Intronic
1004650282 6:17600993-17601015 CAGGCCCGCGACTGGAGCAGGGG - Exonic
1004690289 6:17987533-17987555 GGGGCGCGCGGCTGCAGCGGCGG - Exonic
1004691152 6:17993102-17993124 GAGGCCCTGGACTGGGGCTGAGG + Intergenic
1005135982 6:22570115-22570137 GAGGGCGGCGGCGGCGGCGGCGG + Exonic
1006472658 6:34237331-34237353 GGGGCCCGCGGCGGCGGCGGCGG + Intronic
1006614896 6:35319512-35319534 GAGGCCCGGGCCTGTGGAGGGGG - Exonic
1006919704 6:37619379-37619401 GTGGGCAGCGACTGTGGCGGGGG - Intergenic
1010141883 6:72622141-72622163 GCCGCCAGCGCCTGCGGCGGGGG - Exonic
1010198507 6:73263213-73263235 GAAGCGCGCGGCTGCGGCGCGGG + Intronic
1013273406 6:108561608-108561630 GCCGCCCCCGGCTGCGGCGGTGG - Exonic
1019269218 7:137167-137189 GAGGCCTGGGACTGGGGCGTTGG + Intergenic
1019474250 7:1236436-1236458 CAGCCCCGCGGCGGCGGCGGCGG - Exonic
1019786460 7:2980462-2980484 GAGGCCCGCGGGTGCAGCGCTGG - Intronic
1021450292 7:20778101-20778123 GAGGCCCGGGACTGGCGGGGCGG + Intergenic
1022106254 7:27199834-27199856 GGCGGCCGCGGCTGCGGCGGCGG - Exonic
1022112969 7:27242859-27242881 CTGGACCGCGACCGCGGCGGTGG - Exonic
1023405800 7:39833211-39833233 GAGGGCGGCGGCGGCGGCGGCGG + Intergenic
1023789025 7:43737414-43737436 GAGGCCCACGTCTGCAGCCGTGG - Intergenic
1026360534 7:69598380-69598402 GAGGCGGGCGGCGGCGGCGGCGG + Intergenic
1029168763 7:98616772-98616794 AAGGCCCACGCCTGCCGCGGGGG + Intergenic
1032525706 7:132577096-132577118 GAGGCGCGGGGCTGCGGCGGTGG + Exonic
1033006093 7:137564905-137564927 GCCGGCCGCGACTGTGGCGGTGG - Intronic
1034781490 7:153886530-153886552 GAGGGACGCGGCTGGGGCGGAGG + Intergenic
1034977984 7:155458921-155458943 AAGGCCCGCGGCTTGGGCGGCGG + Exonic
1039454297 8:37697299-37697321 CAGGGCCGCGGCTGCGGAGGCGG - Exonic
1040391569 8:46954910-46954932 GGGGCCAGCGACTGCGGTGCAGG + Intergenic
1041059482 8:54022228-54022250 TAGGCCCGGGCCTGCGGTGGTGG - Exonic
1041059498 8:54022270-54022292 GAAGCCCGCGGCGGCGGCGGCGG + Exonic
1041355304 8:56993646-56993668 GAGCGCGGCGGCTGCGGCGGCGG - Exonic
1043388243 8:79768281-79768303 GCGGCCGGCGACGGCGACGGCGG + Intergenic
1045111121 8:98940322-98940344 GAGGCCCTCGGCTGCCGCAGCGG - Intronic
1047292282 8:123541104-123541126 GGGGCCCGCGACGGGGGCGGCGG + Exonic
1049109850 8:140635783-140635805 GGGGTCCGCGGCGGCGGCGGCGG + Intergenic
1053114751 9:35490593-35490615 CAGGCCGGCGACTGCAGCGGGGG + Intronic
1053893987 9:42725396-42725418 GAGGCCCGGGAAGGCGCCGGTGG - Intergenic
1057489133 9:95508315-95508337 GAGCCCCAGGACCGCGGCGGCGG - Exonic
1060968474 9:127724624-127724646 GAGGACGGAGACTGCGGCGGGGG + Intronic
1203468895 Un_GL000220v1:107903-107925 ACCGGCCGCGACTGCGGCGGCGG + Intergenic
1203471020 Un_GL000220v1:115496-115518 GAGGGCGGCGGCGGCGGCGGCGG + Intergenic
1203476716 Un_GL000220v1:151875-151897 ACCGGCCGCGACTGCGGCGGCGG + Intergenic
1203478841 Un_GL000220v1:159468-159490 GAGGGCGGCGGCGGCGGCGGCGG + Intergenic
1187518156 X:19990956-19990978 GGGGCCGGCGGCGGCGGCGGCGG - Intergenic
1187547309 X:20266711-20266733 GAGCCCCACGGCAGCGGCGGCGG + Exonic
1189324671 X:40105341-40105363 GGTCCCCGTGACTGCGGCGGCGG - Intronic
1190330843 X:49234325-49234347 GGGGCTCTCGACCGCGGCGGGGG + Intergenic
1191006763 X:55717936-55717958 GAGGACCGCGAAGGCGGAGGTGG - Exonic
1192216947 X:69165489-69165511 GCGGGCGGCGACTGCGGCGGCGG + Exonic
1192361751 X:70445109-70445131 GAGCCCGGCGGCGGCGGCGGCGG + Exonic
1197335035 X:125203124-125203146 GGGGCCCTCGACGGCGGCGTAGG + Intergenic
1199736864 X:150693536-150693558 CAGGCCGGCGGCGGCGGCGGCGG + Exonic
1200100677 X:153688069-153688091 CTGGCCCGCGACTCCGGTGGCGG - Intronic