ID: 1185397701

View in Genome Browser
Species Human (GRCh38)
Location 22:50601085-50601107
Sequence CCCGGGGGTCACTGAGGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 1, 2: 1, 3: 20, 4: 316}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185397701_1185397717 10 Left 1185397701 22:50601085-50601107 CCCCAGCCTCAGTGACCCCCGGG 0: 1
1: 1
2: 1
3: 20
4: 316
Right 1185397717 22:50601118-50601140 ATTCTGAGCCGCGCCCGGCCTGG 0: 1
1: 0
2: 2
3: 4
4: 63
1185397701_1185397723 28 Left 1185397701 22:50601085-50601107 CCCCAGCCTCAGTGACCCCCGGG 0: 1
1: 1
2: 1
3: 20
4: 316
Right 1185397723 22:50601136-50601158 CCTGGACGGCTGACCTGTCAAGG 0: 1
1: 0
2: 2
3: 7
4: 85
1185397701_1185397724 29 Left 1185397701 22:50601085-50601107 CCCCAGCCTCAGTGACCCCCGGG 0: 1
1: 1
2: 1
3: 20
4: 316
Right 1185397724 22:50601137-50601159 CTGGACGGCTGACCTGTCAAGGG 0: 1
1: 0
2: 0
3: 1
4: 58
1185397701_1185397718 14 Left 1185397701 22:50601085-50601107 CCCCAGCCTCAGTGACCCCCGGG 0: 1
1: 1
2: 1
3: 20
4: 316
Right 1185397718 22:50601122-50601144 TGAGCCGCGCCCGGCCTGGACGG No data
1185397701_1185397716 5 Left 1185397701 22:50601085-50601107 CCCCAGCCTCAGTGACCCCCGGG 0: 1
1: 1
2: 1
3: 20
4: 316
Right 1185397716 22:50601113-50601135 CCGGGATTCTGAGCCGCGCCCGG 0: 1
1: 0
2: 0
3: 6
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185397701 Original CRISPR CCCGGGGGTCACTGAGGCTG GGG (reversed) Intronic
900098542 1:951111-951133 CCTGGAGGTGAGTGAGGCTGTGG - Exonic
900298542 1:1965061-1965083 CCTGGGGGTCACAGAGACAGAGG + Exonic
900366767 1:2314808-2314830 CGGGGGGGAAACTGAGGCTGCGG - Intergenic
900366870 1:2315062-2315084 TGCGGGGGTCTCAGAGGCTGCGG + Intergenic
900409656 1:2506918-2506940 GGCTGGGGTCACAGAGGCTGGGG + Intergenic
900429968 1:2596786-2596808 CCCGGGGCACCCTGAGGCTGAGG - Intronic
901185951 1:7373367-7373389 CTCGGGGCTCCCTGGGGCTGGGG - Intronic
901318521 1:8324716-8324738 GCCGGGGCTCACCGAGGATGGGG - Exonic
901629915 1:10643010-10643032 CACGGGGGTCCCTGAGGAAGTGG + Intronic
901633094 1:10657340-10657362 GCCGGCCGTCACCGAGGCTGTGG - Intronic
901679724 1:10906098-10906120 CCAGGGGGTCCCTGAGGATCTGG + Intergenic
902337641 1:15763000-15763022 CCAGGGGCTCAAAGAGGCTGAGG + Intronic
902416705 1:16244040-16244062 CTCGGGGGTCACAGATGCTCAGG + Intergenic
902554772 1:17240463-17240485 TCCGGGGGAAACTGAGGCTCAGG - Intronic
902785834 1:18732019-18732041 CCCTGAGGTCCCTGGGGCTGAGG - Intronic
903184564 1:21622113-21622135 CCCGGGTGGCACTGTGGCTCTGG - Intronic
903227031 1:21899761-21899783 CCCGGGGCTCACTGGGGAAGGGG - Intronic
904255383 1:29251366-29251388 GTCAGGGGTCACTGTGGCTGGGG + Intronic
904381487 1:30114120-30114142 TCCAGGGGTCTCTGAGGCTTGGG - Intergenic
904531246 1:31171075-31171097 CCTCTGGGTGACTGAGGCTGAGG + Intergenic
904602889 1:31683502-31683524 CCTGAGGGTCAGAGAGGCTGGGG + Intronic
904697590 1:32338976-32338998 TCAGTGTGTCACTGAGGCTGTGG + Intergenic
906033686 1:42738354-42738376 CCCCGAGGCCACTGGGGCTGGGG + Intronic
907266401 1:53264194-53264216 CCCGGGGTTCACTGAGGTTACGG + Exonic
907313859 1:53555031-53555053 CCCGTGGGTCCCTGAGCCTAGGG - Intronic
907388690 1:54142206-54142228 CCAGTGGGGCACAGAGGCTGAGG + Intronic
910450146 1:87335541-87335563 CGCCGGGCTCACTGCGGCTGCGG - Intronic
910773251 1:90851092-90851114 CCCGGGGGTCGCTAGGGCAGCGG - Intergenic
915065362 1:153220134-153220156 ACTGAGGGTCACTGAGTCTGTGG + Intergenic
920850800 1:209626830-209626852 CCTGGGGGACGCTGAGGCTCTGG - Intronic
922193814 1:223342102-223342124 CCCTGGTTTCACTGTGGCTGTGG - Intronic
922531704 1:226350004-226350026 CTTGGGGTTCACTGAGGGTGTGG + Intergenic
924436851 1:244049385-244049407 CCCGGGCGCCACTGCAGCTGCGG - Intronic
1062854904 10:775203-775225 TGAGTGGGTCACTGAGGCTGTGG - Intergenic
1064271588 10:13870761-13870783 CCTGGGTCTCAGTGAGGCTGAGG + Intronic
1064769546 10:18710305-18710327 CCCGGGGTTAACAGCGGCTGAGG - Intergenic
1065144488 10:22754548-22754570 CCCTGGGGTCCCTCAGGCTCTGG + Intergenic
1067419564 10:46134284-46134306 CACGGGGCACAGTGAGGCTGTGG - Intergenic
1067426455 10:46215127-46215149 CACGGGGCACAGTGAGGCTGTGG + Intergenic
1067504915 10:46840881-46840903 CACGGGGCACAGTGAGGCTGTGG - Intergenic
1067558212 10:47286885-47286907 CCTGGGATTCACTGTGGCTGGGG + Intergenic
1067753780 10:48988680-48988702 CCTGAGGGGCTCTGAGGCTGAGG - Intergenic
1068538568 10:58267684-58267706 CCCGAGGGTCGCTCAGGCTCGGG + Exonic
1071573767 10:86711643-86711665 CCCGGGGGGAGCTGCGGCTGCGG - Intronic
1072618913 10:97067249-97067271 CCTGGCAGTCACTGAGGCTGAGG - Intronic
1072783834 10:98267570-98267592 CCCCGGGGTTACTGACTCTGTGG + Intronic
1074290557 10:112135346-112135368 CCGTGGGGACACTGAGGCTCAGG - Intergenic
1075238616 10:120756829-120756851 ACCGGGGCTCTCTGAGGGTGAGG - Intergenic
1075402838 10:122173342-122173364 GCTCTGGGTCACTGAGGCTGGGG - Intronic
1075443117 10:122494825-122494847 GACGGGGGTCACTGCGGGTGAGG + Intronic
1076309644 10:129495978-129496000 CCTGGAGGTCCCTGCGGCTGGGG + Intronic
1076628188 10:131834534-131834556 CCCGGTGGTCTCTGAGGCAAGGG - Intergenic
1076817008 10:132919997-132920019 CCCGGGGGTCGCTCAGCCCGAGG - Intronic
1076887425 10:133269110-133269132 CCCGGCGGCCACTGAGCATGTGG - Intronic
1077104917 11:837983-838005 CCTGAGGGTCATTGGGGCTGTGG + Exonic
1077170294 11:1163069-1163091 CCCAGGGGACACTGAGGAAGGGG - Intronic
1077186434 11:1237397-1237419 TCTGGGTGTGACTGAGGCTGTGG - Intronic
1077213500 11:1384268-1384290 CAAGTGGGTCATTGAGGCTGGGG - Intergenic
1077216545 11:1397524-1397546 CCCGGGGCCCACGGAGGCCGTGG + Intronic
1077254634 11:1574675-1574697 CTCGGGGGTCTCTGGGGCTCGGG + Intergenic
1077478533 11:2802378-2802400 CAAGGGGGCCACTGAGGCAGCGG + Intronic
1077860671 11:6175979-6176001 CCCTGGGATCATTGAGCCTGGGG + Intergenic
1078776991 11:14402915-14402937 CTCAGGGGTCACTGTGGCAGAGG + Intergenic
1080842548 11:35998133-35998155 CCCTGGGATTACTGAGGCTGAGG + Intronic
1083704980 11:64508038-64508060 CCCTGGGGTGACTTAGGCCGGGG - Intergenic
1084029554 11:66473351-66473373 GCCGGCGGTCACAGAGGATGCGG - Exonic
1084096131 11:66912811-66912833 CCCAGGGTGAACTGAGGCTGGGG - Intronic
1084173364 11:67410965-67410987 TCCGGGGGAAACTGAGGCTCAGG + Intronic
1084617707 11:70247448-70247470 CACGGTGTCCACTGAGGCTGGGG - Intergenic
1085022516 11:73218335-73218357 CACGTGGGTCTCTGCGGCTGCGG + Exonic
1085454384 11:76657404-76657426 CCCTGGGGACACTGAGACTCTGG - Intergenic
1086948414 11:92866983-92867005 CCCGCGTGTCAGTCAGGCTGCGG - Exonic
1088342893 11:108788965-108788987 CCCGGGGCTCTCTCAGGCAGGGG + Intronic
1090603457 11:128396252-128396274 CCAGGGTGGCAATGAGGCTGGGG - Intergenic
1090668622 11:128930875-128930897 CCAGGGGGTTAGGGAGGCTGGGG + Intergenic
1091405835 12:209009-209031 CACAGGGATCACTCAGGCTGAGG - Intronic
1095440845 12:42237928-42237950 CCCGGGTGTCAGAGCGGCTGTGG - Intronic
1096526719 12:52214463-52214485 GCAGGGGGTCACTGTGTCTGGGG - Intergenic
1096842708 12:54389332-54389354 CCTGGGGGTCCCTGGGGGTGGGG + Intronic
1101579740 12:106032045-106032067 CCCTGGGGGCAGTGAGGCAGAGG - Intergenic
1103718755 12:122962182-122962204 CCCGGGTGTCCCTGCGGCTCTGG - Intronic
1104391767 12:128397108-128397130 CCCTGGGGCCAGTGAGGCTGTGG - Intronic
1104858506 12:131912918-131912940 CCCAGGGGTCTCTGGGGCTGAGG + Intronic
1104945042 12:132412021-132412043 GCCGGGGGTCACAGGGTCTGGGG + Intergenic
1105405179 13:20127632-20127654 CCCGGGTGTCCATGGGGCTGGGG + Intergenic
1105690895 13:22838314-22838336 CCCGAGGGTCGCTCAGGCTCGGG + Intergenic
1108185481 13:47884584-47884606 CCCAGAGGTCACTGAGAATGAGG - Intergenic
1110785922 13:79525800-79525822 CCTTGGGGTCACTGAAACTGTGG + Intronic
1113423996 13:110192838-110192860 CCCGGGGGTCCCTGTGGCCCGGG + Exonic
1113585693 13:111462773-111462795 CCTGGGAGCTACTGAGGCTGAGG + Intergenic
1113764375 13:112871828-112871850 GCAGGGGTTCACTGTGGCTGGGG - Intronic
1113955276 13:114097053-114097075 CACAGTTGTCACTGAGGCTGTGG + Intronic
1118259350 14:64233129-64233151 GCCAGGCGTCACTGAGACTGTGG + Exonic
1119379863 14:74221697-74221719 CCTGGGAGTGACTGAAGCTGAGG - Intergenic
1119545536 14:75469000-75469022 CAAGGTGGTCACTGAAGCTGGGG + Intronic
1121368070 14:93332788-93332810 CCTTGGTGTCTCTGAGGCTGTGG - Intronic
1122688309 14:103520393-103520415 CCCCGGGGGGACTGATGCTGGGG + Intronic
1122715549 14:103694789-103694811 CCCGTGGGGCACGAAGGCTGGGG + Intergenic
1122804769 14:104250705-104250727 CCCGGGGGGCAGTGAGGGTTAGG + Intergenic
1122806569 14:104262948-104262970 CCCAGGGCTCACTAAGGCTTTGG + Intergenic
1122858750 14:104572630-104572652 CTTGGGTGTCACTGTGGCTGAGG - Intronic
1122969853 14:105148082-105148104 CCCGGCGGTCGCAGAGGCAGCGG + Intronic
1122985284 14:105208959-105208981 CAGGGGCTTCACTGAGGCTGGGG - Intergenic
1123110462 14:105864746-105864768 CCCGGGGGTCTGTGTGGCTGGGG - Intergenic
1124162207 15:27282887-27282909 ACCTGGGGCCAGTGAGGCTGGGG - Intronic
1125622216 15:41073601-41073623 CCCTGGGTTCACGGAGGGTGGGG + Intronic
1127380116 15:58423791-58423813 CCCAGGGGAAACTGAGGCTCAGG - Intronic
1128078831 15:64844238-64844260 AGAGGAGGTCACTGAGGCTGAGG - Intronic
1129265638 15:74391836-74391858 CTCAGGAGCCACTGAGGCTGTGG + Intergenic
1131522585 15:93127444-93127466 CCAGGGGGTCACTGAGGACTGGG + Intergenic
1132110638 15:99099854-99099876 CCCTGGCCTCACTCAGGCTGGGG + Intronic
1132543204 16:521055-521077 CCCGGGGTCCACAGAGGATGAGG + Exonic
1132628966 16:907472-907494 TCCGGCGGGCACAGAGGCTGTGG + Intronic
1132839536 16:1972329-1972351 CCGCGGGGTCGCGGAGGCTGCGG + Intronic
1132887472 16:2188982-2189004 CCCTGGGGACCCTAAGGCTGAGG + Intronic
1134052881 16:11149212-11149234 CCATGGGGTCACTGAGGCCCTGG + Intronic
1134135531 16:11674270-11674292 ACCCGGGGTCAGTGAGGATGAGG - Intronic
1134747663 16:16600565-16600587 CCAGGGGACCAGTGAGGCTGGGG - Intergenic
1136050863 16:27648935-27648957 ACCAGGGGTCGGTGAGGCTGGGG + Intronic
1136114806 16:28087814-28087836 ACCAGGTGTCACAGAGGCTGGGG + Intergenic
1136136770 16:28260927-28260949 CCCAGGGGTGAGAGAGGCTGAGG + Intergenic
1139896138 16:70289330-70289352 CCTGGGGCCCACTGCGGCTGCGG + Intronic
1140266798 16:73428211-73428233 CCCTGGGGTCACTGGGGAAGGGG - Intergenic
1141513440 16:84527136-84527158 CCCGGGGCTCTCCGAGGCTGTGG - Intronic
1142429648 16:90019278-90019300 CGCGGGGGTCTCGGGGGCTGGGG + Intronic
1142669411 17:1480846-1480868 CCAGGAGGTAACTGAGGATGTGG + Exonic
1142962163 17:3557744-3557766 CCCGGGTGGGACTGTGGCTGAGG + Exonic
1143319533 17:6059264-6059286 CCCTGGGGGGACTGGGGCTGCGG + Intronic
1143725693 17:8843876-8843898 CCCTGGAGGCACTGAGTCTGAGG + Intronic
1143780247 17:9225490-9225512 CACGGGTTTCTCTGAGGCTGAGG + Intronic
1145066021 17:19761962-19761984 GCCCGGGCTCACTGAGGCCGAGG - Intergenic
1146884010 17:36459002-36459024 AGCTGGGGACACTGAGGCTGAGG + Intergenic
1147139693 17:38454095-38454117 CGCGGCGGTCGCTGTGGCTGAGG - Intronic
1147393068 17:40122077-40122099 CCCGGGGGTCTCCGCGGCTCGGG - Intergenic
1148152659 17:45405505-45405527 CCCTGGGGTCCCTGGGTCTGTGG + Intronic
1149650678 17:58274472-58274494 CCCAGGGGTAAATGAGGCTAAGG + Intronic
1151405253 17:73882046-73882068 CCCCGAGGTCTCAGAGGCTGCGG + Intergenic
1151406405 17:73889970-73889992 CCCTGGGGGCAGTGAAGCTGTGG - Intergenic
1151802343 17:76385598-76385620 CCAGGGGGTCCCTGGCGCTGTGG - Exonic
1152615236 17:81334760-81334782 GCCAGGGGTCAGGGAGGCTGGGG + Intergenic
1152646513 17:81471360-81471382 CTCTGGTCTCACTGAGGCTGGGG + Intergenic
1152647681 17:81477271-81477293 CCCTGTGGTCTCTGAGGTTGAGG + Intergenic
1152684258 17:81686399-81686421 CCTGGGGGCCACTGAGGCACGGG - Intronic
1152696786 17:81801609-81801631 CCTGGGGGTGGCGGAGGCTGAGG + Intergenic
1152696820 17:81801765-81801787 CCTGGGGGTGGCGGAGGCTGAGG + Intergenic
1152753319 17:82076612-82076634 CCGGGGGGAAAATGAGGCTGAGG - Intergenic
1159770475 18:72542125-72542147 GCCGGGGGCCACTCGGGCTGCGG - Exonic
1160245430 18:77155255-77155277 GCCGGGAGACACTGAGGCCGGGG + Intergenic
1160514027 18:79468845-79468867 CCTGGGGGTCACAGAGCGTGAGG - Intronic
1160514041 18:79468881-79468903 CCCGGGGGTCCCAGAGCATGAGG - Intronic
1160514053 18:79468918-79468940 CCCGGGGGTCCCAGAGCATGAGG - Intronic
1160514078 18:79468992-79469014 CCCGGGGGTCCCAGAGCGTGAGG - Intronic
1160514090 18:79469029-79469051 CCCGGGGGTCCCAGAGCGTGAGG - Intronic
1160717309 19:582187-582209 CCTGGGGGTCACTGAGGGCAGGG + Intronic
1160736570 19:665356-665378 CAAGGGGGCCAGTGAGGCTGGGG - Intergenic
1161038364 19:2097532-2097554 CCCGTGGGTCTCCGAGGCTCTGG - Intronic
1161696438 19:5771213-5771235 CCTGGGGGCCAGTGGGGCTGGGG - Intronic
1161736427 19:5994882-5994904 CCAGGGGCTCACCCAGGCTGCGG + Exonic
1162545011 19:11324015-11324037 CCGGGGAGTCTCTGAAGCTGGGG - Exonic
1162834562 19:13307891-13307913 CCCGGGGTGCTCTGAGGGTGTGG + Intronic
1163219992 19:15911899-15911921 CCCAGGGGTCGCTCAGGCTCGGG + Intergenic
1163234899 19:16024503-16024525 CCCGCTGCTCTCTGAGGCTGTGG - Intergenic
1163633636 19:18428895-18428917 CCCGGGGGTGTCTGGAGCTGTGG + Intronic
1163669824 19:18620862-18620884 CGGGGGGGGCGCTGAGGCTGAGG + Exonic
1165068001 19:33240250-33240272 CCCGATGGGCACTGGGGCTGAGG + Intergenic
1165445142 19:35852636-35852658 CCCTGGGGTCACGGAGGCTGGGG - Intronic
1166308076 19:41946544-41946566 CCTAGGGGTCGCTGTGGCTGGGG - Intergenic
1166385511 19:42378392-42378414 CATGGGGGCCACTGAGGTTGGGG + Intronic
1166682623 19:44778139-44778161 CCCGGGGGTCCCGGCGGCTCTGG + Exonic
1166968859 19:46548614-46548636 CCCAGGGAAGACTGAGGCTGAGG - Intronic
1166975148 19:46601448-46601470 CTGGGGGGTCGCCGAGGCTGCGG + Intronic
1167253285 19:48412901-48412923 CAGGTGGATCACTGAGGCTGAGG + Intronic
1167253333 19:48413245-48413267 CAGGTGGATCACTGAGGCTGAGG + Intronic
1167461056 19:49624987-49625009 CCAGGTGGGCACTGGGGCTGGGG + Exonic
1168306496 19:55438780-55438802 CATGGGGGAAACTGAGGCTGGGG + Intronic
1168508977 19:56959449-56959471 CCCGGGGGAGGCTGAGGATGAGG + Intergenic
925314236 2:2908986-2909008 CCCCGGCATCACTGAGGTTGCGG + Intergenic
927780580 2:25936283-25936305 ACTTGGGGACACTGAGGCTGGGG - Intronic
927882877 2:26701067-26701089 CCCAAGGGACACTGATGCTGTGG + Intronic
928606108 2:32946758-32946780 CCCGTGGGTCGCCGAGGCGGAGG - Intergenic
933173956 2:79156265-79156287 GCCTGGGGTCACAGAGCCTGGGG + Intergenic
934056014 2:88252500-88252522 CCCAGGGGTCCCTCTGGCTGAGG + Intergenic
936242596 2:110800789-110800811 CCCGGGGGTGACCGAGGCCCTGG + Intronic
937221197 2:120344206-120344228 CCCGGAGGCCACTGAGCCTCAGG - Intergenic
937259634 2:120577164-120577186 CCCGGGGGTCCCTGGGGTCGCGG - Intergenic
940883188 2:158967980-158968002 CCCGGGCGTCCCTGGGGCCGCGG - Intergenic
945029057 2:205646791-205646813 CACGGGCCTCACTGAGTCTGTGG + Intergenic
946246890 2:218392976-218392998 CCCAGGGCTTCCTGAGGCTGCGG + Exonic
948753148 2:240144002-240144024 CGCGGATGTCACTGAGCCTGGGG + Intronic
948834455 2:240619496-240619518 CCCAGGAGCCACTGAGGCAGAGG - Intronic
948864309 2:240767671-240767693 CCTGGGGCCCTCTGAGGCTGGGG + Intronic
948900807 2:240956085-240956107 CCTGGGGGAAACTGAGGCTCAGG - Intronic
948959161 2:241318232-241318254 CACAGGGTTCAGTGAGGCTGAGG + Exonic
949031692 2:241800135-241800157 TCCGTGGGGCCCTGAGGCTGGGG + Intronic
1169021399 20:2333872-2333894 CTCGGAGGTCACTGACGGTGAGG + Intronic
1169042823 20:2509623-2509645 CCCGAGGGAGGCTGAGGCTGAGG + Intronic
1170612381 20:17925319-17925341 CCTGTGGGACATTGAGGCTGAGG + Intergenic
1171570908 20:26251134-26251156 CCAGGCAATCACTGAGGCTGCGG + Intergenic
1175266089 20:57704321-57704343 CCAGGGGCTCCCCGAGGCTGGGG - Intronic
1175852394 20:62100509-62100531 CCCGGGGGACCCTAAGACTGAGG - Intergenic
1175887186 20:62298864-62298886 CCCAGTGGTCAGTGTGGCTGGGG + Intergenic
1175889965 20:62311692-62311714 CTCGGGGGCCCCTCAGGCTGCGG + Exonic
1175949758 20:62577056-62577078 CCCAGGGCTCACTGAGGGTCTGG - Intergenic
1176195027 20:63832771-63832793 CCCGAAGGTCGGTGAGGCTGGGG - Intergenic
1176197121 20:63842497-63842519 CCCGGGGTGCACAGGGGCTGGGG + Intergenic
1176220441 20:63967066-63967088 CCGGGGGGGCTCTGAGTCTGGGG - Intronic
1176269387 20:64227788-64227810 CCCTGGGGTCACAGAGCTTGAGG + Intronic
1176273114 20:64246757-64246779 CCTGGGGGTGTCTGAGGCAGGGG + Intergenic
1177348310 21:19901036-19901058 CACGGGGTTCACTAAGGCAGAGG - Intergenic
1179104586 21:38387369-38387391 CCCGAGGCTCAGTGAGGCTCAGG + Intronic
1180573074 22:16748147-16748169 CCAGGCAATCACTGAGGCTGCGG + Intergenic
1181038162 22:20179730-20179752 CTGGAGGGTCACTGGGGCTGGGG - Intergenic
1181065516 22:20303958-20303980 CTCAGGAGTCCCTGAGGCTGGGG + Intergenic
1181363737 22:22357989-22358011 CCCGGGGGTCCCAGACGCTGAGG - Intergenic
1181366551 22:22381074-22381096 CCCGGGGGTCCCAGACGCTGAGG - Intergenic
1181415429 22:22755575-22755597 TCCTGGGGCCACTGACGCTGAGG - Intronic
1181855702 22:25780114-25780136 ACCGGGTGGCACTGCGGCTGTGG - Exonic
1183271664 22:36866125-36866147 CCCTGGGGGCACGGAGGCTCAGG - Intronic
1183354491 22:37350965-37350987 CCCGCGGCCCACTGAGGCAGGGG - Intergenic
1183372037 22:37438308-37438330 TCAGGTGGTCACTGAGGCCGGGG - Intergenic
1183380113 22:37486401-37486423 CCAGGCGGTCCCGGAGGCTGCGG - Exonic
1183485643 22:38086406-38086428 CCAGGAGGTCATCGAGGCTGTGG + Exonic
1183508356 22:38221513-38221535 CGCGGGCGCCACTGAGGCTGTGG + Exonic
1183588101 22:38764683-38764705 GCAGAGGGTCACTGAGGCTGAGG - Intronic
1184092631 22:42300501-42300523 CCCAGGGGGCACTGAGGCCCAGG + Intronic
1184340949 22:43885509-43885531 CCAGGAGGTCCCTGTGGCTGCGG - Intronic
1184734082 22:46387969-46387991 CCTGGGGTGCACAGAGGCTGAGG - Intronic
1184870629 22:47235735-47235757 CCTGGGGGTCACTGAGTTTCAGG + Intergenic
1185274577 22:49944779-49944801 CCCGGCTGTCACTGTGACTGCGG - Intergenic
1185315753 22:50178455-50178477 CCCGTGGGCCGCTGTGGCTGTGG - Intronic
1185397701 22:50601085-50601107 CCCGGGGGTCACTGAGGCTGGGG - Intronic
1185414829 22:50704266-50704288 CCCGGGGGTCAGGCAGGCAGGGG + Intergenic
950115729 3:10449414-10449436 GCTGCGGGGCACTGAGGCTGTGG - Exonic
954121806 3:48504145-48504167 CGCGCGGATCACTGAGGCTGTGG - Exonic
954155187 3:48681491-48681513 CCCTGGGTACACTGAGCCTGGGG - Exonic
954627064 3:52028406-52028428 CCGGGGTGGCACTGAGGTTGTGG + Intergenic
957767723 3:84648022-84648044 CCCTGGGTTCACTGAAGCTTGGG - Intergenic
961013427 3:123449879-123449901 CCCGCGGGGCGCCGAGGCTGGGG - Intergenic
961455574 3:127022347-127022369 CCTGGGGGGCACTGGGGTTGGGG + Intronic
961591076 3:127982406-127982428 CCCTGGGATGACTGAGGCAGAGG - Intronic
963870696 3:150410428-150410450 CCGGGCGGTATCTGAGGCTGAGG - Exonic
964380951 3:156098649-156098671 CACAGGAGTCCCTGAGGCTGGGG - Intronic
965825221 3:172723002-172723024 CCTGGGGCTCTCTGAGGGTGAGG - Intergenic
966297002 3:178435688-178435710 CCCTGGGGTGACTGCGGCTATGG - Intronic
966926151 3:184645856-184645878 CCAGGAGGCCCCTGAGGCTGAGG + Intronic
968144603 3:196287821-196287843 CCCGGGGGCCTCTGAGGAGGCGG - Intronic
968480042 4:829219-829241 CCCTGGCCTCACTGGGGCTGGGG - Intergenic
968509009 4:987252-987274 CCAGGGGGTCCCGGAGGCCGCGG - Intronic
968572270 4:1347968-1347990 CCGGGAGGACCCTGAGGCTGGGG - Intronic
968713764 4:2139285-2139307 CCCTGGGGTCAGCAAGGCTGTGG + Intronic
969554029 4:7893942-7893964 TCCAGGGCTCGCTGAGGCTGTGG - Intronic
969600054 4:8170891-8170913 CCCATGGGTCACTGTGCCTGTGG - Intergenic
969610796 4:8226879-8226901 CGCCGGGGACACAGAGGCTGGGG + Intronic
970593289 4:17577611-17577633 CCCGTGGGCTACTGGGGCTGCGG + Intronic
971272160 4:25160212-25160234 CCCCGGGGTCGCGGCGGCTGGGG + Intronic
974022225 4:56701880-56701902 CCCTGGGGACACTGAGGTGGGGG + Intergenic
974839410 4:67283307-67283329 CCCAGTGGGCGCTGAGGCTGAGG + Intergenic
974887109 4:67833313-67833335 CCTTGGAGGCACTGAGGCTGAGG - Exonic
975961545 4:79913780-79913802 CTCAGAGGTCACTGTGGCTGGGG + Intronic
983593192 4:169437600-169437622 CCCGGGGCTCACAGATGCTAAGG - Intronic
985003320 4:185506625-185506647 CTCGGGGGGCACCGAGGCTGTGG + Exonic
985517344 5:353871-353893 CCCGGAGGTAACTGACACTGAGG - Exonic
985525460 5:399174-399196 CCCCAGGGTCTCTGAGGCCGGGG + Intronic
985772944 5:1824502-1824524 CCCGGGGGTCACTGAGGCAGGGG + Intergenic
986325307 5:6668718-6668740 CTCGGAGGCCACAGAGGCTGGGG + Exonic
988032043 5:25775112-25775134 ACCAGGGGTAACTGAGACTGTGG + Intergenic
995743398 5:115378132-115378154 CACAGGGTCCACTGAGGCTGTGG + Intergenic
996117441 5:119633986-119634008 GCCAGGGGTGATTGAGGCTGGGG - Exonic
996379037 5:122845509-122845531 CCCGCGGGGCCCCGAGGCTGCGG - Exonic
999241365 5:150129728-150129750 GTCAGGGGCCACTGAGGCTGGGG + Intronic
1000288193 5:159846186-159846208 CCTTGGGGACCCTGAGGCTGGGG - Intergenic
1001114922 5:168931466-168931488 CCCTGGTGTCACTGAGCCTAAGG + Intronic
1001280100 5:170380603-170380625 CCAGGGAGTAGCTGAGGCTGGGG + Intronic
1001529270 5:172451073-172451095 CCTGCGGGTGACTGAGGCTGGGG + Intronic
1002061722 5:176629564-176629586 GCAGGGGGTCACCGAGGCGGCGG - Exonic
1002645558 5:180651433-180651455 CCCGGGGGGTGCTGAGGCTGCGG - Intergenic
1002921408 6:1575766-1575788 CCCACGGGCCACAGAGGCTGTGG + Intergenic
1003124192 6:3342529-3342551 CCCGGGGGACTCTGATGCTGTGG - Intronic
1003200928 6:3959680-3959702 CCTGGGCATCACTGGGGCTGAGG + Intergenic
1003318867 6:5035347-5035369 CCTGGGCATCACTGGGGCTGAGG - Intergenic
1004064361 6:12228470-12228492 CCTGGGGGTCAGAGAGGCTTTGG + Intergenic
1006097382 6:31664562-31664584 CCAGCAGGTCTCTGAGGCTGTGG - Exonic
1006634548 6:35452560-35452582 CGCGGGGCTCCCTGGGGCTGAGG + Exonic
1006943136 6:37765990-37766012 CCCTGGGGGCAGTGAGGATGTGG + Intergenic
1007548532 6:42711535-42711557 ACCGGGGCTCCCTGAGGATGGGG - Intronic
1007626841 6:43251550-43251572 CCCGGGGGTCCTGGAGGGTGAGG - Intronic
1007840491 6:44712258-44712280 CTGGAGGCTCACTGAGGCTGAGG + Intergenic
1008952211 6:57172905-57172927 CCTGGGGCACAGTGAGGCTGCGG + Intronic
1014724842 6:124962211-124962233 CCTGGGGCTCGCTGGGGCTGCGG + Intergenic
1016493074 6:144628763-144628785 CAGGGGGCTCCCTGAGGCTGAGG + Intronic
1019091593 6:169539787-169539809 CCCAGGGCTTACTGTGGCTGAGG - Intronic
1019312346 7:369017-369039 CCGGGGGCTCCCTGAGGCGGGGG - Intergenic
1019559252 7:1647813-1647835 CCAGGGGCTCCCTGAGGCTCTGG + Intergenic
1019739300 7:2664882-2664904 ACAGGGGGACACTGAGGGTGGGG + Intergenic
1019967153 7:4508946-4508968 CTCCAGGGACACTGAGGCTGGGG + Intergenic
1022043911 7:26608034-26608056 ACCGGGTGTGACTGAGGCAGTGG - Intergenic
1022713172 7:32872320-32872342 CTCTGGGGAAACTGAGGCTGGGG - Intronic
1023873558 7:44275235-44275257 CCCAGGGGTCATGGAGGCTCAGG + Intronic
1024035887 7:45506916-45506938 CCAGGGGTTCACAGAGGGTGTGG + Intergenic
1025285228 7:57655179-57655201 CCAGGCAATCACTGAGGCTGCGG + Intergenic
1026564255 7:71476779-71476801 CCCAGGTGTCACTAATGCTGAGG + Intronic
1029098362 7:98107069-98107091 CGCGGGTGCCACTGAGGCAGCGG + Exonic
1029135327 7:98366421-98366443 CCCAGGGGCCCCAGAGGCTGAGG - Intronic
1029940834 7:104479056-104479078 GCTGGGGTTGACTGAGGCTGGGG + Intronic
1033445775 7:141420689-141420711 CCTGGGAGTCACTGTGCCTGAGG - Intronic
1033537895 7:142328852-142328874 CCAGGGCATCACTGAGTCTGGGG - Intergenic
1034245288 7:149639193-149639215 CCCGGGGGCTACTGATGATGTGG + Intergenic
1034421485 7:150993320-150993342 CCCTGTGGTCACTGAGAGTGTGG + Intronic
1035670367 8:1412324-1412346 CCCGGGAGACAGGGAGGCTGAGG - Intergenic
1035922641 8:3694337-3694359 GACAGGGGTCACTCAGGCTGAGG + Intronic
1036632522 8:10525542-10525564 CCCGGGGGTGACAGAGGCCAGGG - Exonic
1037517310 8:19645669-19645691 CTCCTGGGTCACTGATGCTGTGG + Intronic
1037778189 8:21849386-21849408 CTCAGGGCTCACTGTGGCTGTGG - Intergenic
1037879377 8:22565630-22565652 GGCGGGGGTCCCCGAGGCTGGGG - Intronic
1040388577 8:46931380-46931402 TCCAGGGCTCAGTGAGGCTGTGG + Intergenic
1040538351 8:48329151-48329173 CCCTCGGGACACCGAGGCTGGGG + Intergenic
1042376259 8:68056219-68056241 CCCGGGGGAAAGTGAGGTTGGGG + Intronic
1044420599 8:91991657-91991679 CCCTGAGGTCCCTGTGGCTGGGG + Exonic
1048981518 8:139705303-139705325 CCCAGGGGTCTCTGAGGCTTGGG - Intergenic
1049260867 8:141638479-141638501 CCAGGAGGTGACTTAGGCTGTGG + Intergenic
1049296553 8:141843590-141843612 CCCAGGGGTCACTGGAGCGGAGG - Intergenic
1049466115 8:142752032-142752054 CCAGGGAGGCTCTGAGGCTGGGG - Intronic
1049554337 8:143274682-143274704 CCTGGGGGTCAGGGAGGCTGGGG - Exonic
1049741647 8:144243770-144243792 CCCGCCTGTCACTTAGGCTGGGG + Intronic
1049778699 8:144417814-144417836 CCCCGGGGGCAGGGAGGCTGTGG + Intergenic
1055496659 9:76861546-76861568 ACCGGGGGGAACTGAGGCTTTGG - Intronic
1055647290 9:78373087-78373109 TCAGGGGGTCACTTAAGCTGGGG + Intergenic
1057020955 9:91697407-91697429 CCTGGAGGGCACTGTGGCTGGGG + Intronic
1060541863 9:124436402-124436424 GTCAGGAGTCACTGAGGCTGGGG - Intergenic
1060933399 9:127502936-127502958 CCCGGGGCTCACAGTGGCCGAGG - Exonic
1061405478 9:130391192-130391214 CCGGGGGGCCACTGAGGCAGGGG - Intronic
1061481474 9:130899508-130899530 CCTGTGGGTCCCTGTGGCTGGGG - Intergenic
1061968668 9:134031334-134031356 GCCGGGGGTGCCTGGGGCTGGGG - Exonic
1062283383 9:135761923-135761945 CCTGGGGGTGGCTGGGGCTGGGG - Intronic
1062524598 9:136973143-136973165 CCGTGGGGTGACAGAGGCTGCGG + Intergenic
1062530299 9:136996711-136996733 CCCCGGGGTGTCTGAGCCTGAGG + Exonic
1192589643 X:72349277-72349299 CCTGGAGGTCAGTCAGGCTGGGG - Intronic
1200134407 X:153867900-153867922 CCCAGGGCTCCCTGAGGGTGGGG + Exonic
1201901466 Y:19048734-19048756 GCAAGGGGTCACTGTGGCTGGGG - Intergenic