ID: 1185397736

View in Genome Browser
Species Human (GRCh38)
Location 22:50601170-50601192
Sequence GGGCCGACCCTCTGCGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 113}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185397719_1185397736 21 Left 1185397719 22:50601126-50601148 CCGCGCCCGGCCTGGACGGCTGA 0: 1
1: 0
2: 5
3: 36
4: 390
Right 1185397736 22:50601170-50601192 GGGCCGACCCTCTGCGGGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 113
1185397722_1185397736 11 Left 1185397722 22:50601136-50601158 CCTGGACGGCTGACCTGTCAAGG 0: 1
1: 0
2: 1
3: 6
4: 61
Right 1185397736 22:50601170-50601192 GGGCCGACCCTCTGCGGGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 113
1185397727_1185397736 -2 Left 1185397727 22:50601149-50601171 CCTGTCAAGGGTGGAGGCCCTGG 0: 1
1: 0
2: 2
3: 20
4: 230
Right 1185397736 22:50601170-50601192 GGGCCGACCCTCTGCGGGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 113
1185397720_1185397736 16 Left 1185397720 22:50601131-50601153 CCCGGCCTGGACGGCTGACCTGT 0: 1
1: 0
2: 1
3: 15
4: 184
Right 1185397736 22:50601170-50601192 GGGCCGACCCTCTGCGGGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 113
1185397721_1185397736 15 Left 1185397721 22:50601132-50601154 CCGGCCTGGACGGCTGACCTGTC 0: 1
1: 0
2: 1
3: 19
4: 295
Right 1185397736 22:50601170-50601192 GGGCCGACCCTCTGCGGGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185397736 Original CRISPR GGGCCGACCCTCTGCGGGGG AGG Intronic
900997424 1:6130060-6130082 GGGCCGAGACTCCACGGGGGAGG + Intronic
904236720 1:29121700-29121722 CGCCCGAGCCTCTGCGGGTGCGG - Exonic
908355606 1:63323056-63323078 GGGATGACCCTCTCCGGCGGCGG + Exonic
910646835 1:89524182-89524204 GGGCCCAGCCTCTGTGAGGGAGG - Intergenic
912764506 1:112396382-112396404 GGGCCCATCCCCTGAGGGGGCGG + Intronic
914845588 1:151282159-151282181 GGGCCAACCCAGTGCGGGGCTGG + Intronic
1067111885 10:43407282-43407304 GGGCCGGCCATCTGCGTGGCGGG - Intronic
1068866642 10:61902147-61902169 GAGCCGACCCACTGCAGGGGGGG - Exonic
1072916570 10:99540656-99540678 GGGCCGCGCCTCTGCCAGGGTGG + Intergenic
1075361364 10:121838224-121838246 GTGCCAACCCACTGCTGGGGTGG - Intronic
1075654619 10:124152861-124152883 GGGCCGGCCCTCCGCGGGGCTGG - Intergenic
1075920638 10:126210142-126210164 GGGCTGACCCTCTATGGGGAAGG + Intronic
1076000118 10:126906683-126906705 TGCCCGACCCTCTGCTGGTGTGG + Intronic
1076708937 10:132320524-132320546 TGCCCCAGCCTCTGCGGGGGTGG - Intronic
1076895291 10:133308605-133308627 GGCCCGACACTCAGCCGGGGCGG - Exonic
1077962442 11:7089574-7089596 GGGCCGACCCTGCGCGGCGGCGG - Exonic
1079329400 11:19521244-19521266 GGGCAGACCCTCTGAGAGGAGGG + Intronic
1081672554 11:44950075-44950097 GGCCCGACCTTCTGGGGTGGGGG - Exonic
1083432601 11:62622035-62622057 GGGCGGAGCCGCTGCAGGGGCGG - Exonic
1084118543 11:67055949-67055971 AGCCTCACCCTCTGCGGGGGCGG + Intergenic
1089195599 11:116692525-116692547 TGGGCGACACTCTGAGGGGGTGG - Intergenic
1094841483 12:34344334-34344356 GGGCCCAGCCACTCCGGGGGTGG + Intergenic
1098331692 12:69360034-69360056 GGACCGCCCCTCTTCCGGGGTGG + Intronic
1101371855 12:104137949-104137971 GGCCCGGCCCGCTGCGGGAGCGG + Intronic
1104978095 12:132561051-132561073 GGGCCGGCCCTCTGGGGGCCTGG - Intronic
1113728362 13:112622544-112622566 TGCCAGACCCTCTGCTGGGGTGG + Intergenic
1113741632 13:112715620-112715642 GGGGCAACCCTCTGGGGAGGAGG - Intronic
1113799444 13:113078689-113078711 GGGCCGCGGCTCAGCGGGGGAGG + Exonic
1113884522 13:113651694-113651716 GGGCCGAGCCGTTGCTGGGGAGG + Exonic
1114483207 14:23047946-23047968 GGCCCGGCCCACCGCGGGGGGGG - Exonic
1120730143 14:87992800-87992822 GGGCGGGCCCGCTGCGGGGCTGG - Intronic
1122689658 14:103526196-103526218 GGGCCGGCGCTCTGGGAGGGTGG - Intergenic
1122984275 14:105205157-105205179 GGGCCGGCCCTTTGTGGGGATGG - Intergenic
1123998348 15:25734183-25734205 GTGACGGCCCTCTGCTGGGGTGG - Intronic
1129597267 15:76974680-76974702 GGGCTGACCCTCTGATGGGGTGG + Intergenic
1131781912 15:95869062-95869084 GGGCCTGCCCTCTCCGGGTGTGG + Intergenic
1132580776 16:683771-683793 GCCCGGAACCTCTGCGGGGGCGG + Exonic
1132830339 16:1924882-1924904 GGGCCACCCCTCTGCAGGAGAGG - Intergenic
1132968642 16:2673668-2673690 GGGGCGGGGCTCTGCGGGGGTGG + Intergenic
1133048984 16:3106245-3106267 AGGCCGACCCTCGGCCGGGGAGG + Intergenic
1133130960 16:3675893-3675915 GGGCCGAGCCGCTGCGGGACTGG - Intronic
1133222335 16:4324123-4324145 GGGCAGACCCCCTCCCGGGGTGG - Intronic
1137752804 16:50879449-50879471 GGGCCGACACTCAGAGGAGGCGG + Intergenic
1138552751 16:57756431-57756453 GGCCCCACCCTCTGTGGGTGTGG + Exonic
1139433227 16:66922343-66922365 GGCCCGGCCCTCTGTGTGGGTGG + Exonic
1147285790 17:39401774-39401796 GGGCCGGCCCCGTGTGGGGGAGG - Intronic
1149865755 17:60150153-60150175 GGGGGGATCCTCTGCAGGGGCGG - Intronic
1151926789 17:77203558-77203580 GGGCCGCCCATCTGCAGAGGAGG - Exonic
1152905368 17:82967530-82967552 GGGCTGTCACACTGCGGGGGTGG + Intronic
1154324471 18:13380039-13380061 GAGCAGAACCTCTACGGGGGTGG + Intronic
1157700737 18:49760288-49760310 TGGGAGTCCCTCTGCGGGGGCGG + Intergenic
1161513203 19:4683063-4683085 GACCCGGCCCTCTGCGGCGGCGG - Intronic
1162384620 19:10353646-10353668 GGGCCGCCCCTCTCCGCGGCAGG - Exonic
1162797489 19:13094419-13094441 GGGCAGAGTCTCTGAGGGGGCGG + Intronic
1163305038 19:16472340-16472362 GTCCCGACCCTCCGCGGGGTGGG - Intergenic
1166541286 19:43607733-43607755 GGGCCGACCAGCTGGGCGGGAGG - Exonic
1167149222 19:47699291-47699313 GGGCTCACCCTCTGGGGTGGGGG - Exonic
927475931 2:23414260-23414282 GGGCCGGCCCCCTGCAGGGAAGG + Intronic
928595751 2:32857430-32857452 GTGCTCACCCTCTGGGGGGGTGG - Intergenic
935013184 2:99154931-99154953 GGGCCGGCCCTCAGGGGGCGGGG + Intronic
935112220 2:100104487-100104509 GGCCCGAGCCTCGGCGGCGGCGG - Exonic
936252352 2:110876444-110876466 GGCCCGTCCCTCTGGGAGGGAGG + Intronic
936286827 2:111187561-111187583 AGGCCGGCCCTCTGAGGGGAGGG + Intergenic
936502078 2:113074481-113074503 CTGCTGACCCTCTGCTGGGGAGG - Intronic
948750650 2:240130577-240130599 GGGCCGCCCCTCTGCTGTGTGGG - Intronic
1172166456 20:32902715-32902737 GGGCATATCCTCTGCGGGTGGGG + Intronic
1173251606 20:41366703-41366725 GGGCCGACCAGCGGCGGGGGCGG - Exonic
1175847312 20:62065562-62065584 GGGCGCGCCCTCGGCGGGGGCGG + Exonic
1175852299 20:62100118-62100140 GGGACCACCCTCTGCCGGGCGGG - Intergenic
1178707720 21:34889081-34889103 GGGCCGGGCCTCTCCGGGTGCGG - Intronic
1181006737 22:20017026-20017048 TGCCCGAACCTCTGCGGCGGCGG + Intronic
1181106398 22:20578384-20578406 GGGAGGGCCCTCTGCGGGGAAGG - Intronic
1181148719 22:20867318-20867340 GGGCCGTGGCTCTGCGGAGGGGG + Intronic
1181178614 22:21052152-21052174 GTGCCGAGCCTCTGCTGGGCAGG - Intronic
1181672487 22:24432254-24432276 GGGCTTACCCTCTGCGGCAGTGG + Exonic
1182295803 22:29310835-29310857 GTGCAGACCCTCGGCTGGGGTGG - Exonic
1182899380 22:33885302-33885324 TAGCTGACCCTCTGCGGAGGGGG + Intronic
1185397736 22:50601170-50601192 GGGCCGACCCTCTGCGGGGGAGG + Intronic
961780174 3:129316437-129316459 GGGGCGCCCCGCTGCGGGCGCGG - Intergenic
968479253 4:826366-826388 GGGCGGACCCGGGGCGGGGGCGG + Intergenic
968734121 4:2286337-2286359 AGGCCTGCCCTTTGCGGGGGTGG + Intronic
975994263 4:80296215-80296237 AGACCTACCCTCTGCGAGGGTGG - Intronic
978429649 4:108620400-108620422 GTGCCGCCCCTCTGTGGGCGGGG - Intergenic
986559994 5:9050849-9050871 GGGCCCTCCCTCTGCCGGGAAGG - Intronic
990856127 5:60268442-60268464 GGGAGGACCCTCTTCGGGTGTGG + Intronic
995841434 5:116446803-116446825 GAGTCCACCCTCTGCGGGGCGGG + Exonic
997521250 5:134525804-134525826 GGGCCGACCGTCCCCGGCGGGGG + Intronic
1005224976 6:23632188-23632210 TGGCTGTCCCTCTGTGGGGGTGG + Intergenic
1005836177 6:29711164-29711186 GGGCAAACCCACTGCTGGGGTGG + Intergenic
1006335482 6:33418354-33418376 GGGCCGGTCCTCTTCGGCGGCGG + Intergenic
1006474142 6:34244335-34244357 GGGCTGACCCTAGGCCGGGGTGG - Intronic
1007160431 6:39787494-39787516 GGCCTGTCTCTCTGCGGGGGTGG + Intergenic
1007787346 6:44288473-44288495 GGACCGGCCCTCTGAGGGTGAGG + Intronic
1010392921 6:75357361-75357383 AGGCCTACCCTCTGCCTGGGCGG - Intronic
1019153162 6:170022587-170022609 TGGCCGTCCCTCTGGCGGGGTGG + Intergenic
1019435893 7:1021947-1021969 GGTTCGATCCTCCGCGGGGGTGG + Intronic
1019543162 7:1560464-1560486 GGGCCCAGCCTCTGAGGTGGCGG + Intronic
1021668632 7:23013532-23013554 CGGCCGCCCCTCTGCCGGGTGGG - Intronic
1023805452 7:43869600-43869622 GGGCAGGGCCTCTGCGGGGCGGG + Intronic
1026944082 7:74305335-74305357 GGGACCAGCCTTTGCGGGGGAGG - Intronic
1026952445 7:74356586-74356608 GGGCCGACCCCCCACGGAGGAGG - Exonic
1027185846 7:75970119-75970141 GGGCCGGGCCACTGCGGGAGGGG + Intronic
1030077480 7:105748931-105748953 GGGAAGGCCCTCTGCTGGGGAGG + Intronic
1030093359 7:105876766-105876788 GGGCCGCCCGCCTGCCGGGGAGG + Intergenic
1034223092 7:149460462-149460484 GCGCCGCCCCTCTGCGGCCGCGG + Intronic
1035747837 8:1974333-1974355 GGCGGGACCCTCGGCGGGGGCGG - Intronic
1038319709 8:26514936-26514958 GGGCTGATCCCCTGCTGGGGCGG + Intronic
1038429859 8:27491326-27491348 GCCCCGACCCACTGCGGCGGCGG - Intronic
1040807366 8:51408989-51409011 CGGCCGTCCCTCTGCGACGGTGG - Exonic
1044698827 8:94948954-94948976 GGACCGACCCACTGGGTGGGCGG + Intronic
1045510196 8:102807340-102807362 ATGCCGACCCTCTCCGGGGGAGG + Intergenic
1049765661 8:144354184-144354206 GGGCCGGCCCTCAGGGGAGGAGG + Intronic
1052721293 9:32174019-32174041 TGGCAGTCCCTGTGCGGGGGAGG - Intergenic
1053489429 9:38487969-38487991 GTGCGGACCCTCGACGGGGGCGG + Intergenic
1057669776 9:97077289-97077311 GTGCGGACCCTCGACGGGGGCGG + Intergenic
1060166627 9:121422641-121422663 GGGCCTTCCCTGTGCTGGGGAGG - Intergenic
1060748109 9:126151030-126151052 GTGCCCACCCTCTCCTGGGGAGG + Intergenic
1060831981 9:126722786-126722808 GGGCCACCCCTCGGCCGGGGAGG + Intergenic
1062034535 9:134377059-134377081 GGGCCGACCCTGTGAGGGGCTGG + Intronic
1062146500 9:134992405-134992427 CGGGAGACCCTCTGCCGGGGCGG - Intergenic
1062700608 9:137899879-137899901 GCGCAGACCCTCTGAGGGGCTGG + Intronic
1200268163 X:154657727-154657749 GGACCGGCCCTCTGGAGGGGAGG - Intergenic