ID: 1185398427

View in Genome Browser
Species Human (GRCh38)
Location 22:50604072-50604094
Sequence ACGCGGGCGGCGCGCGCCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 163}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185398415_1185398427 12 Left 1185398415 22:50604037-50604059 CCAGGAGCTGTCCTCGCCCGGCT 0: 1
1: 0
2: 1
3: 11
4: 159
Right 1185398427 22:50604072-50604094 ACGCGGGCGGCGCGCGCCTGGGG 0: 1
1: 0
2: 0
3: 7
4: 163
1185398417_1185398427 1 Left 1185398417 22:50604048-50604070 CCTCGCCCGGCTCCGACTCGGAG 0: 1
1: 0
2: 1
3: 5
4: 137
Right 1185398427 22:50604072-50604094 ACGCGGGCGGCGCGCGCCTGGGG 0: 1
1: 0
2: 0
3: 7
4: 163
1185398420_1185398427 -5 Left 1185398420 22:50604054-50604076 CCGGCTCCGACTCGGAGGACGCG 0: 1
1: 0
2: 0
3: 4
4: 28
Right 1185398427 22:50604072-50604094 ACGCGGGCGGCGCGCGCCTGGGG 0: 1
1: 0
2: 0
3: 7
4: 163
1185398419_1185398427 -4 Left 1185398419 22:50604053-50604075 CCCGGCTCCGACTCGGAGGACGC 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1185398427 22:50604072-50604094 ACGCGGGCGGCGCGCGCCTGGGG 0: 1
1: 0
2: 0
3: 7
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185398427 Original CRISPR ACGCGGGCGGCGCGCGCCTG GGG Exonic