ID: 1185398444

View in Genome Browser
Species Human (GRCh38)
Location 22:50604198-50604220
Sequence CGGCTCCGAGGCGGGCGACG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185398444_1185398459 23 Left 1185398444 22:50604198-50604220 CCTCGTCGCCCGCCTCGGAGCCG 0: 1
1: 0
2: 1
3: 13
4: 113
Right 1185398459 22:50604244-50604266 CCGCCCCGCCTTCCTGCCCGTGG 0: 1
1: 0
2: 5
3: 43
4: 301
1185398444_1185398460 24 Left 1185398444 22:50604198-50604220 CCTCGTCGCCCGCCTCGGAGCCG 0: 1
1: 0
2: 1
3: 13
4: 113
Right 1185398460 22:50604245-50604267 CGCCCCGCCTTCCTGCCCGTGGG 0: 1
1: 0
2: 1
3: 11
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185398444 Original CRISPR CGGCTCCGAGGCGGGCGACG AGG (reversed) Exonic
900786764 1:4654643-4654665 CGGCTCTGCGGCGGGCGCGGTGG + Intergenic
901064005 1:6486144-6486166 AGGCTCCGAGGCGGGGGTGGGGG - Intronic
902586219 1:17439876-17439898 CGGAGCCGAGGCGGGCGGCGAGG - Intergenic
903077886 1:20786583-20786605 CGTCGCCGGGGCGGGCGCCGCGG - Intronic
903897772 1:26620375-26620397 GGGCTCCGAGAGGGGCGTCGGGG - Intergenic
907223893 1:52927361-52927383 CGGGACCGGGGCGGGCGCCGCGG - Exonic
911601193 1:99849998-99850020 CGGCTCCGGGCCGGGGGACCTGG - Intergenic
915246466 1:154559052-154559074 CGGCTCGGGGGCGGGGGAAGCGG - Intergenic
918388837 1:184037361-184037383 CCGGGCCGAGGCGGGCGGCGGGG + Exonic
921024043 1:211260540-211260562 CGGCGCCGGGGCGAGCGAGGTGG - Intronic
923372632 1:233328241-233328263 CGCCGCCGTGTCGGGCGACGAGG + Exonic
924385774 1:243496950-243496972 CAGCTCAGAGGGGGGCGACAGGG - Intronic
1064208801 10:13347311-13347333 CGCCTCCGACGCGGGCGTCCTGG - Intronic
1065844754 10:29735649-29735671 CTGCTCCGGGGCGGGAGGCGCGG - Intronic
1067171484 10:43910469-43910491 CGGCTCCGAGGCTGGCTGGGAGG + Intergenic
1075504273 10:123008655-123008677 CGGCTCGGACGGCGGCGACGCGG - Intronic
1078316050 11:10294100-10294122 CGGCGGCGAGGGCGGCGACGGGG - Exonic
1080802136 11:35618775-35618797 CCGCTCCGGGCCGGGCGCCGTGG - Exonic
1083952073 11:65962080-65962102 CGGCTACGAGGCCGGTGAGGAGG + Exonic
1084112528 11:67023309-67023331 CGCCTCCGAGGAGCGCGGCGCGG - Intronic
1084941366 11:72615078-72615100 TGGCTCGGAGGCTGGAGACGCGG - Intronic
1088913945 11:114212805-114212827 CTGCTCCGAGGCAGGCGATGGGG - Intronic
1089208923 11:116787919-116787941 CGGGGCCGGGGCGGGCGACGGGG + Exonic
1091225938 11:133956534-133956556 GGGCTCCGACGCGGGCCAGGCGG - Intronic
1096503553 12:52079785-52079807 CGGCTCTCAGGCGGGCGCCGCGG + Intergenic
1097246313 12:57609592-57609614 CGGCTCCATGGCGGGTGACGGGG - Exonic
1098022338 12:66169575-66169597 CGGCTCCCCAGCGGGCGCCGCGG - Intronic
1102678603 12:114674758-114674780 TGGCCCCGAGGCCTGCGACGCGG - Exonic
1102853956 12:116277502-116277524 CGGCTCCGAGGCGGCGGCGGCGG - Intergenic
1103570270 12:121840043-121840065 CAGCTCCTAGGCGGGAGACAGGG + Exonic
1110558464 13:76886062-76886084 TGGCTCCGCGGAGGACGACGAGG + Exonic
1112507857 13:99985577-99985599 CGGCGGCGGGGCGGGCGGCGGGG + Exonic
1113956746 13:114103424-114103446 CGGCTCCCAGACGGGGGACGGGG + Intronic
1121473433 14:94174204-94174226 CGGGGCCGAGGCGGGCAAGGTGG + Intronic
1122688806 14:103522133-103522155 GGGCTGCGTGGCGGGCGACGAGG - Exonic
1123490493 15:20776024-20776046 CCGCTTGGAGGAGGGCGACGAGG - Intergenic
1123546994 15:21345111-21345133 CCGCTTGGAGGAGGGCGACGAGG - Intergenic
1127893762 15:63277418-63277440 GGGCTCGGAGGCGGGGTACGTGG - Intronic
1129221621 15:74134734-74134756 AGGCGGCGAGGCGGGCGGCGAGG + Exonic
1130040687 15:80403859-80403881 CGGCTCCCAGGCCGGGGACACGG - Intergenic
1132055654 15:98648893-98648915 CGGCGCAGAGCCGGGCGGCGCGG + Intergenic
1132251991 15:100341383-100341405 CGGCGACGCGGCGGCCGACGTGG - Exonic
1132527757 16:426026-426048 CGGCTCCGAGCCCGGGGGCGAGG - Exonic
1132583170 16:694496-694518 CGGGTCCGAGGCGGAGGAGGAGG - Intronic
1134143558 16:11742570-11742592 CGGCTCCGTCGCGGGCTGCGTGG - Exonic
1136399795 16:30011068-30011090 CGGCGCGGCGGCGGGGGACGGGG + Exonic
1136413894 16:30092033-30092055 GGGCTGCGAGGCCGGCGGCGCGG + Intergenic
1136540017 16:30923864-30923886 CGGCTGCGAGGCGAGCGGAGGGG - Intronic
1136556471 16:31010448-31010470 CGGCACAGAGGCGGGAGACCCGG - Exonic
1138619104 16:58197781-58197803 CGGCGGCGCGGCGGGGGACGCGG + Exonic
1142335865 16:89489775-89489797 GGGCTCCGGGGCGGGCCTCGGGG - Intronic
1143161810 17:4876798-4876820 CGGCTCTGAGGCAGGCGTGGTGG + Intronic
1144586846 17:16492250-16492272 CGGCGCGGAGGCGGGGGGCGGGG - Intergenic
1145765709 17:27456968-27456990 AGCCTCCAAGGGGGGCGACGCGG - Intronic
1147629012 17:41918331-41918353 CGCCTCCGGGGCGGGCCACGCGG - Intronic
1148852258 17:50560975-50560997 CGGCTCCGCGCCAGGCGGCGGGG - Intergenic
1152544067 17:80992027-80992049 CGGGGCCGGGGCGGGCGGCGGGG + Intronic
1157473731 18:48008422-48008444 CAGCTGCGAGGCGGGGGCCGGGG - Intergenic
1158729927 18:60011245-60011267 CGGCCGAGCGGCGGGCGACGGGG - Intergenic
1160726012 19:618099-618121 CAGCTCCGAGGGCGGCTACGAGG + Intronic
1160930697 19:1568296-1568318 CGGCTCCTCGGCGGCCGAGGCGG + Intergenic
1162481384 19:10928861-10928883 CCGCGCAGAGGCGGGCGACGCGG + Exonic
1163243303 19:16077031-16077053 CGACTCCGGGGCTGGCGCCGGGG + Intronic
1163426862 19:17245079-17245101 CGACGCCGAGCCGGGCGACGAGG - Exonic
1163469134 19:17486764-17486786 GGGCTTCGCGCCGGGCGACGTGG + Exonic
1163508040 19:17719727-17719749 GGGCTCCGGGGCGGGGGTCGCGG + Intronic
1165453846 19:35899877-35899899 CTGCTCCGAGGCGGGGCGCGCGG + Intronic
1165461103 19:35944919-35944941 GGGCTCCGGGGCGGGCGGGGCGG - Exonic
1166754002 19:45179475-45179497 CGGCTCCGAGTCGGTCTCCGCGG - Exonic
1166882946 19:45940222-45940244 CGGGGCCGGGGCGGGCGGCGGGG - Exonic
1167259982 19:48452845-48452867 GGACCCTGAGGCGGGCGACGTGG + Exonic
1167463853 19:49640040-49640062 CGGCCCCGGGGCGGGGGACCTGG - Exonic
1167596799 19:50432323-50432345 CGCCTCCGGGGAGGGCGCCGCGG - Intergenic
931719511 2:65056786-65056808 CGGGGCCGAGGCGGGCGGCTGGG + Intronic
933655178 2:84881051-84881073 CGGCTCCGAGGCCCGGAACGCGG + Exonic
944515786 2:200510223-200510245 CGACTCCGAGGCGGCCCACTGGG - Intronic
945225913 2:207530586-207530608 CGGGGGCGAGGCGGGCGGCGGGG - Intronic
948140839 2:235670698-235670720 CTTCTCCGAGGCGGGCTGCGTGG - Intronic
1169889112 20:10433874-10433896 CGGCACGGATGCGGGCGGCGAGG - Intronic
1170204698 20:13785310-13785332 GGGCGGCGGGGCGGGCGACGCGG + Intronic
1172026395 20:31951760-31951782 CGGCTCCGAGGCGACAGACCTGG - Intronic
1172367910 20:34363731-34363753 CGGGGCCGGCGCGGGCGACGTGG + Intronic
1175847258 20:62065433-62065455 CAGCTTCGCGGCGGGCGGCGCGG + Exonic
1177010997 21:15730145-15730167 CGGCGCTGAGGCGGGCCGCGTGG + Exonic
1178610431 21:34074147-34074169 CGGCGGCGGGGCCGGCGACGAGG - Intronic
1180960658 22:19760959-19760981 CGGGTCGGCGCCGGGCGACGCGG - Exonic
1184136716 22:42554135-42554157 CGACACCCAGGAGGGCGACGCGG - Intronic
1184164572 22:42720152-42720174 CGGATCCGAGGCGAGCGCGGAGG + Intronic
1185055360 22:48576110-48576132 CGGCTCCGGGGGCGGCGGCGGGG + Intronic
1185398421 22:50604055-50604077 CGGCTCCGACTCGGAGGACGCGG + Exonic
1185398444 22:50604198-50604220 CGGCTCCGAGGCGGGCGACGAGG - Exonic
949559373 3:5187960-5187982 GGGCCCCGAGGTGGGCGACGCGG - Exonic
950131755 3:10552145-10552167 CGGCACCGAGGCGGCGGCCGTGG - Intronic
962230541 3:133661861-133661883 CGGCGCCGAGTCGGGGGAGGGGG - Exonic
963253258 3:143120698-143120720 CGACTCCGAGGCGGGCGCGGCGG - Exonic
968372783 4:11132-11154 CGGCGCCGGGGCGGGGGTCGGGG + Intergenic
968372796 4:11181-11203 CGGCGCCGGGGCGGGGGTCGCGG + Intergenic
976398518 4:84582955-84582977 CGGCTCCGAGTCCGGCTCCGGGG + Intergenic
976671826 4:87662396-87662418 CGGCTCCGAGTTGGACGATGAGG + Exonic
979525453 4:121711691-121711713 CGGCTGCGAGGCGGCCGGCAAGG + Intergenic
980035782 4:127881256-127881278 CGGCTGCGGGGCGGGCACCGAGG + Intronic
983398497 4:167233922-167233944 CTGCTCCGAGGCGGGGGCCGCGG - Intronic
984832382 4:183987638-183987660 CCGCTGCGAGGAGGGCGGCGTGG - Intronic
984888680 4:184473328-184473350 CGGCTACGGAGCGGGCGAGGTGG - Intronic
985462611 4:190121434-190121456 CGGCGCCGGGGCGGGGGTCGGGG - Intergenic
987379912 5:17275549-17275571 CGGCCCCGCTGCGGGCGGCGAGG + Exonic
991054397 5:62306175-62306197 CGGCTCCCCGGCGGGCGGTGCGG + Intronic
992732851 5:79689949-79689971 CGGCTCCGACGGGGACGAGGAGG + Exonic
997609591 5:135206221-135206243 CGGCTCAGAGGCTGGCCAGGTGG - Intronic
1002199048 5:177516778-177516800 CCGCTCCGAGGCGGAAGATGAGG - Exonic
1006472715 6:34237478-34237500 CGGCGCGGGGGCGGGCGGCGGGG + Intronic
1006770301 6:36547422-36547444 CGTCTCCGCGGCGGGGGACCGGG - Exonic
1007614454 6:43171899-43171921 CGACTCGGAGTCGGGCGAGGAGG + Exonic
1014725083 6:124963065-124963087 CTGCTCCGAGGCGGGGGCCTCGG - Exonic
1016590162 6:145735348-145735370 CGGCACCGCGGCGGGCGACGGGG - Exonic
1029238760 7:99143870-99143892 CGGCTCCGGGCTGGGCGCCGGGG + Exonic
1032077960 7:128845002-128845024 CTGCTCAGAGGCAGGCGAGGCGG + Exonic
1033328524 7:140398603-140398625 CGGCGCGGAGGAGGGCGAGGAGG + Intronic
1035169650 7:157010375-157010397 GGGCCCGGTGGCGGGCGACGCGG + Exonic
1038017773 8:23529467-23529489 CGGCGCTGAGGCGGGGGAGGCGG + Intronic
1044336004 8:90985294-90985316 CGGCTCCGAGGGGCACGAGGCGG + Intergenic
1045335929 8:101205013-101205035 GGTCTCCGAGGCGGGAGAGGCGG - Exonic
1049788531 8:144462627-144462649 CGGCGCCGAGGAGGCCGGCGGGG - Intronic
1051291894 9:15553320-15553342 GGGCTTCGAGGCGGACGACTTGG + Intronic
1055934662 9:81593198-81593220 CGGGTCCGATGAGGGCGTCGGGG + Exonic
1061605897 9:131710599-131710621 AGGCTCTGAGCCGGGCGAGGTGG + Intronic
1062408689 9:136410503-136410525 CGGCCGAGCGGCGGGCGACGGGG - Exonic
1198399001 X:136251492-136251514 CAGGTCCGAGGCGGGCGCGGTGG - Exonic