ID: 1185399310

View in Genome Browser
Species Human (GRCh38)
Location 22:50607761-50607783
Sequence CCATGGGTCTGGAGTTTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185399310 Original CRISPR CCATGGGTCTGGAGTTTAGG AGG Intronic
902231660 1:15031319-15031341 CCTTGTGTCTGGAGTTGTGGAGG - Intronic
902736382 1:18404036-18404058 CCATGTGACTGGAGTCTAGAGGG - Intergenic
902740124 1:18432073-18432095 CTATGGGGCTGGAGTTTATCAGG + Intergenic
902888860 1:19426759-19426781 CTGTGGGTCAGGAGTTCAGGAGG - Intronic
903471466 1:23590626-23590648 CCATGTGGCTGGAGTGTGGGAGG - Intronic
907430705 1:54409623-54409645 CCAGGTGTCTGTAGTTTAGGAGG - Intronic
908558351 1:65280678-65280700 CCATTGGCCTGGAAGTTAGGAGG + Intronic
908731035 1:67226583-67226605 CCTGGGGTCTGGAGTTTATGAGG + Intronic
910687500 1:89932395-89932417 CTAAGGGTCTAGCGTTTAGGAGG - Intronic
912437934 1:109674996-109675018 GCATGGGACAGGGGTTTAGGGGG - Exonic
912440445 1:109693455-109693477 GCATGGGACAGGGGTTTAGGGGG - Exonic
912468241 1:109888755-109888777 CCATGGATCTGAAGATCAGGAGG + Intergenic
912714315 1:111971630-111971652 AGATGGGTCTGGAGCTTAGCAGG - Intronic
915917644 1:159950647-159950669 CCATGGGGCAGGGGGTTAGGGGG - Intergenic
918068054 1:181114866-181114888 CCGTGGGCCTGGAGTATGGGAGG - Intergenic
918883915 1:190166127-190166149 CCATGGGTATAGAGTTTATACGG + Intronic
921364142 1:214357924-214357946 AAATGAGTCTGGAGTTTTGGAGG + Exonic
924275461 1:242381777-242381799 CCGTGGGTTTGGAGTTAAGTGGG - Intronic
924317785 1:242816458-242816480 CAATGGATATGCAGTTTAGGAGG + Intergenic
1062911475 10:1215127-1215149 CCAAGGGGCTGGAGGTCAGGGGG - Intronic
1070321172 10:75355776-75355798 CTATGGGTCTGGAATTCAGATGG + Intergenic
1071461724 10:85903120-85903142 CTATGAGTCTGGAGTTCAGAGGG - Intronic
1071467052 10:85950935-85950957 CCCTGGGCCTGGAGTATATGTGG + Intronic
1075795294 10:125115921-125115943 GCAGGGGTGTGGAGTATAGGGGG - Intronic
1077038170 11:505293-505315 CCACAGGTTTGGAGATTAGGAGG - Intronic
1078541141 11:12213949-12213971 CCATGGGCCTAGAGGATAGGAGG + Intronic
1078774642 11:14383060-14383082 ACATAGGACTGGAGGTTAGGAGG - Intergenic
1079244371 11:18742258-18742280 CCATGGGTCTGCAGGAGAGGTGG - Exonic
1081788799 11:45768115-45768137 TCATGGGTCTGCAGGTTAGTTGG + Intergenic
1082005004 11:47414532-47414554 GCATGGGTGTGGAGCTCAGGAGG + Intronic
1082128266 11:48456948-48456970 CCATGGGGTTGGAGGTTTGGGGG - Intergenic
1082561816 11:54627873-54627895 CCATGGGGTTGGAGGTTTGGGGG - Intergenic
1083847670 11:65345434-65345456 CCATGGGGTTGGAGTTCAGGAGG + Intronic
1084610862 11:70202281-70202303 CCGTGGGTCTGGAGGTGAGGAGG - Intergenic
1085274144 11:75287460-75287482 GGATGGGTCTGGAGTTTCAGAGG - Intronic
1088824064 11:113478824-113478846 CCAAGGTTGTGGAGTTTAGATGG - Intergenic
1089021414 11:115219159-115219181 CCAAGGGGCTGTTGTTTAGGTGG - Intronic
1089892895 11:121898924-121898946 TCATGGTTCTGGAGTTTAATGGG - Intergenic
1090288381 11:125520020-125520042 TCATGAGTCAGGAGTCTAGGTGG - Intergenic
1090640686 11:128726554-128726576 CCATTGGTATGGAGCTTAGGCGG - Intronic
1093259460 12:16917658-16917680 CCATGGGCCTGGGGTTGGGGAGG - Intergenic
1094781385 12:33795814-33795836 TCATGGCTCTGTGGTTTAGGAGG - Intergenic
1096106626 12:48999794-48999816 CCATGGGGCTGGGGTGCAGGAGG + Intergenic
1097264863 12:57738848-57738870 CCACGGGTCTGGGGTCTGGGAGG + Intronic
1097677319 12:62616642-62616664 TCATGGGTCTGGAGTTTGGCTGG - Intergenic
1097718883 12:62999156-62999178 AGATGAGTCTGGAGTTTAAGGGG + Intergenic
1098749158 12:74273311-74273333 CTAAGGGTATGGAGTTTGGGGGG - Intergenic
1101924111 12:108956991-108957013 TCATGGGTCTGGAAATTAAGGGG + Intronic
1104299890 12:127555079-127555101 CCATGTGCATGGAGTTTAGCTGG + Intergenic
1104352369 12:128055958-128055980 TCATCAGTTTGGAGTTTAGGAGG + Intergenic
1104596516 12:130124081-130124103 CCATGGGTCTGGAATTCAGCAGG + Intergenic
1104638929 12:130455013-130455035 CCAGGAGTCTGGAGCTTCGGTGG + Intronic
1106456899 13:29935594-29935616 TCAAGGGTCTGGAGTTAAGAGGG + Intergenic
1107402604 13:40084065-40084087 CCATGGTTCTGGGTTTTATGGGG + Intergenic
1109367937 13:61381977-61381999 ATATAGGTCTGGAGTTTAAGAGG - Intergenic
1113908526 13:113831221-113831243 CCATGGGGCTGGGGTCCAGGTGG + Intronic
1115854643 14:37617822-37617844 ACATTGGCCTGAAGTTTAGGAGG + Intronic
1120685335 14:87530924-87530946 CCTGGGGTCTGGAGTTTATATGG - Intergenic
1121798092 14:96752308-96752330 CCCTGGGACTGGAGGTCAGGAGG + Intergenic
1123034274 14:105465518-105465540 CTGAGGGTCTGGGGTTTAGGTGG + Intronic
1124805538 15:32878226-32878248 CCGTGTGGCTGGAGTTTAGTGGG + Intronic
1125310324 15:38372098-38372120 CTGTGGGTCTGGAATTCAGGAGG - Intergenic
1125616330 15:41016949-41016971 CCATGGCTCAGCACTTTAGGAGG - Intronic
1129081897 15:73048580-73048602 ACTTGGATCTGGAGTTTAGCAGG - Intergenic
1129953849 15:79615364-79615386 GCATGGGTCTGCAGTTGAGAGGG - Intergenic
1130053420 15:80502789-80502811 CCAGGGGGTTGGAGATTAGGAGG + Intronic
1131231129 15:90660411-90660433 TAATGGGTCAGGAGTTTGGGTGG - Intergenic
1132761072 16:1508950-1508972 CCAAGGGTCTGGTGTCTGGGGGG - Intronic
1133279914 16:4659429-4659451 CCATGGGTTTGCAGGTGAGGTGG + Intronic
1133381124 16:5331412-5331434 TCATGTGTCTGGAGGTCAGGTGG + Intergenic
1133409634 16:5557754-5557776 CCATGGGTCTTCAGGTTTGGGGG - Intergenic
1133931718 16:10238274-10238296 CTATGGCTCTGGACTTTGGGAGG + Intergenic
1134416830 16:14050859-14050881 CCCTGGGTCTGGAATGTGGGTGG - Intergenic
1135621815 16:23962351-23962373 CAATGGGGCTGGAAATTAGGTGG - Intronic
1138207284 16:55134185-55134207 CCATGGGTCAGGAATCTTGGGGG - Intergenic
1139431601 16:66913732-66913754 CCCTGGGCCTGGAGTCCAGGTGG + Intronic
1139614157 16:68079013-68079035 CCATGGGCCTGGTGCTAAGGTGG + Exonic
1140339140 16:74139975-74139997 CCTGGGGTCTGGGGTTTATGTGG + Intergenic
1142714010 17:1738184-1738206 GCTTGGGTCTGGGGTTTAAGTGG + Exonic
1144781306 17:17809868-17809890 GCCTGGGTCTGGGGCTTAGGCGG + Intronic
1145959135 17:28876248-28876270 TCAGGAGTCTGGATTTTAGGAGG + Intergenic
1151758313 17:76087218-76087240 CCCTGGGACTGGAGCTCAGGGGG - Intronic
1153329848 18:3862663-3862685 ACATGGGCCTGGGGTTTTGGTGG - Intronic
1155335359 18:24758441-24758463 CCAGGGGTCAGGAGTCGAGGAGG - Intergenic
1157273262 18:46292889-46292911 TCATGGGTCTGCAGTTTACTGGG - Intergenic
1157728780 18:49986131-49986153 CCATGAGTCTGGAGGGTATGTGG - Intronic
1158603010 18:58870937-58870959 CTGTGAGTCTGGAATTTAGGAGG + Intronic
1160675026 19:385733-385755 CCGTTGGACTGGAATTTAGGTGG - Intergenic
1161803642 19:6429934-6429956 ACAAGGGCCTGGAGTTTTGGGGG + Intronic
1161959711 19:7516625-7516647 CCTGGGGTCTGGAGTTCAGGAGG + Intronic
1163843733 19:19627450-19627472 CCATGGGGCTGGGGTGGAGGTGG + Exonic
1165063555 19:33216492-33216514 CCATGAGTCTGGACTTTGGCCGG - Intronic
1166580328 19:43893045-43893067 CCATGGACCTGGAGTTTAGCTGG + Intronic
926401217 2:12499035-12499057 ACATGGGTATGGATTTCAGGAGG + Intergenic
929584771 2:43106744-43106766 TCATGGGTCTGGAGTGTGGCTGG - Intergenic
933089684 2:78105250-78105272 CCATGGGATTGGAGATTGGGGGG + Intergenic
935944149 2:108270663-108270685 CCATCAGTTTGGAGCTTAGGCGG - Intergenic
936611082 2:114002630-114002652 CAATAGGTCTGGAGTGTAGTTGG + Intergenic
937098588 2:119251326-119251348 CCCTGAGTCTGCAGATTAGGAGG + Intronic
938768362 2:134479119-134479141 TCATGGTTCTGGAGGTTGGGAGG - Intronic
939672846 2:145034848-145034870 CCATTGGTATGGAGTTTTGGTGG - Intergenic
940320409 2:152370857-152370879 CTATGGGTCAGGAATTTGGGTGG + Intronic
941155583 2:161973750-161973772 CCATAGGTCTGGAGTAGAGTGGG - Intronic
941820584 2:169840541-169840563 CTATGGTTCTGGGGTTTTGGGGG + Intronic
944458483 2:199919556-199919578 TCATGATTCTGGAGGTTAGGAGG + Intronic
947856747 2:233329239-233329261 CCAGGGGTCAGGAGGTTATGGGG - Intronic
1169914144 20:10671148-10671170 ACGTGTGTTTGGAGTTTAGGGGG - Intronic
1173490552 20:43476613-43476635 CCATGGATGTGCACTTTAGGTGG - Intergenic
1175062664 20:56257909-56257931 CCTTGGGGCTGGTGTTGAGGTGG - Intergenic
1175504223 20:59470479-59470501 TCATGGTTCTGGGGATTAGGGGG + Intergenic
1175793526 20:61757252-61757274 CCAGGGGGCTCGAGTTTCGGGGG + Intronic
1180927610 22:19567055-19567077 CCAGGGGTCCGGGGTTGAGGGGG - Intergenic
1183340925 22:37280972-37280994 CTATGGGTCAGCAGTTTGGGTGG + Intergenic
1183430425 22:37762522-37762544 ACCTGTGTCTGGAGTTCAGGCGG + Intronic
1184509903 22:44927282-44927304 CCGTTGGTTTGGAGTTTTGGGGG - Intronic
1185109230 22:48891603-48891625 CCTTGGGGCTGGAGTGTTGGTGG + Intergenic
1185399310 22:50607761-50607783 CCATGGGTCTGGAGTTTAGGAGG + Intronic
949917207 3:8974423-8974445 CCATGTGGCTGGAGCTGAGGGGG - Intergenic
952132764 3:30384178-30384200 CCATGGGTCTGTGGTTGTGGTGG - Intergenic
952885806 3:38010323-38010345 CCTTGGGTCGGGAGTCTGGGTGG - Intronic
953324535 3:42001798-42001820 ACATGAGTCTGGAGTTCAGAGGG + Intergenic
956295634 3:67710213-67710235 CCAGGGGTCAGGAGGTTGGGTGG + Intergenic
957252713 3:77794233-77794255 CTGTGGGTCAGGAATTTAGGGGG - Intergenic
957925490 3:86805397-86805419 CCATGGGCCTGCAGTGCAGGTGG + Intergenic
959828995 3:110837486-110837508 CTAAGGGACTGGAGGTTAGGGGG - Intergenic
962566561 3:136666339-136666361 CCATAGGTCTGAAGTTCAGAGGG - Intronic
968667881 4:1831134-1831156 CCATGGGTGTGGAGGTTTTGTGG + Intronic
970800885 4:19972331-19972353 GTATAGGTCTGGAGTTTAGAAGG - Intergenic
971642867 4:29157996-29158018 CCATGAGTCAGGAGTCCAGGTGG + Intergenic
976871312 4:89797072-89797094 CCATGGGGCTGGGGTGGAGGTGG - Intronic
987046390 5:14113157-14113179 CCATGGTTCTGGAGGTTGGCTGG + Intergenic
987504860 5:18754554-18754576 CCAGGGGTCTGGGGTTTATACGG + Intergenic
988542381 5:32122290-32122312 CCATGGACCTGGGGTTTGGGGGG - Intergenic
992099845 5:73396460-73396482 TCATGGGTCTGGAACTTAAGGGG + Intergenic
992217875 5:74543531-74543553 CCCTGGGTCTGGAGTGTGAGGGG - Intergenic
995637125 5:114206320-114206342 AGATGGGGCTGGAGATTAGGAGG - Intergenic
997211704 5:132080738-132080760 CCAAGGCTCTGGAGTGTATGAGG + Intergenic
1003708472 6:8562107-8562129 CCATGTGGCTGGAGTAGAGGAGG - Intergenic
1004444524 6:15685825-15685847 GCATGGGTCTGAAGTTCAGGTGG - Intergenic
1007077775 6:39078809-39078831 CCATGGGACTGGTTTTTGGGTGG + Intronic
1007487858 6:42194800-42194822 GCATGGGGCAGGAGTTTAGCTGG - Exonic
1007528130 6:42514756-42514778 ATAGGGGTCTGGAGTTTAGGGGG + Intergenic
1007826521 6:44605109-44605131 CCCTGGGTCTTGAGTTTGGAAGG + Intergenic
1012307606 6:97677706-97677728 TCATTGGTCTGGGGTTTAGAAGG + Intergenic
1016155296 6:140799152-140799174 CCATGTGTCTGTAGTTTCTGAGG + Intergenic
1016574586 6:145554585-145554607 TCATGGTTCTGGAGGCTAGGAGG + Intronic
1019079815 6:169422662-169422684 CCATGCGTTTGGAGATGAGGAGG + Intergenic
1020417450 7:7962167-7962189 GAATGGGTCTGGAGTTGGGGTGG + Intronic
1020475850 7:8593503-8593525 CCATGGTTCAGGAGACTAGGGGG - Intronic
1026651078 7:72216453-72216475 TCATAGGTCTGGGGATTAGGAGG + Intronic
1028039568 7:86033011-86033033 CCAGGGTGCTGGATTTTAGGTGG - Intergenic
1029844580 7:103399713-103399735 CCATGGGTCAGGGGCTGAGGAGG - Intronic
1030249885 7:107430812-107430834 CCATGGGTCTTGAGATGGGGAGG + Intronic
1030295661 7:107923627-107923649 TCAAGGGTGTGGAGTTTTGGAGG + Intronic
1030978567 7:116157865-116157887 CCAGGGGACTGGTGTTTAGTGGG - Intronic
1032671141 7:134083450-134083472 CCATGGGTCAGGAATTTGAGGGG + Intergenic
1037449806 8:19005459-19005481 TCATGGGTCTGGAATTTTTGGGG + Intronic
1037664234 8:20954365-20954387 CCAGGGCTCTTGAGTTAAGGAGG + Intergenic
1038416575 8:27400796-27400818 GCGTGGGTCTGGAGCTCAGGAGG + Intronic
1039083865 8:33760408-33760430 CTATAGGTCTGGAGTCTTGGCGG + Intergenic
1040766114 8:50913277-50913299 CCTTGTGTCTGGTGGTTAGGTGG - Intergenic
1042354309 8:67809480-67809502 CCATGGATGTGAAGTTTTGGTGG + Intergenic
1042514145 8:69642254-69642276 CCATAGCTCTGGAGGTTAGAGGG - Intronic
1045548003 8:103145284-103145306 ACATGGGTCTGGAGTTCACCGGG - Intronic
1049174762 8:141185025-141185047 ACATGGGCCTGGCGCTTAGGAGG + Intronic
1049367411 8:142247160-142247182 CTATAGGTCTGGAGTCTCGGCGG - Intronic
1050771745 9:9209937-9209959 CCATGGGATCTGAGTTTAGGAGG - Intronic
1050844859 9:10202932-10202954 TCATAGTTCTGGAGGTTAGGTGG - Intronic
1052119413 9:24692338-24692360 CCCTGGGTCTGGAGCTTCTGAGG - Intergenic
1052823093 9:33154940-33154962 CCCTGGGTCTTAAGTTTAGGTGG + Intronic
1056985191 9:91357499-91357521 CCATGGAACTAGAGTCTAGGAGG + Intronic
1061747308 9:132749878-132749900 CCATGGGGCTGGTGTTGGGGTGG + Intronic
1061995282 9:134180083-134180105 CGATGGGTGTGGGGTTAAGGTGG - Intergenic
1186695387 X:12025300-12025322 TCATGAGTCTGGAGCTTAGAGGG - Intergenic
1187125825 X:16453571-16453593 CCATGGCTCTGGGTTTTTGGAGG - Intergenic
1188660391 X:32751732-32751754 TCACATGTCTGGAGTTTAGGAGG + Intronic
1189875641 X:45433536-45433558 CCATGGGTCTGGGGTGGTGGTGG - Intergenic
1193169102 X:78315628-78315650 CCATGGGTCTATAGTTATGGTGG + Intronic
1194375314 X:93125422-93125444 TCATGATTCTGGAGGTTAGGAGG - Intergenic
1198577158 X:138023149-138023171 CCATAGCTCTGGAGTTTGGTTGG + Intergenic
1200926009 Y:8655436-8655458 CCATGGGCCTAGTGTTCAGGTGG + Intergenic
1201221260 Y:11772971-11772993 CAATGGATATGCAGTTTAGGAGG + Intergenic
1202342955 Y:23888696-23888718 CCAGGGGTCTGGAGCATAGGAGG - Intergenic
1202527813 Y:25781389-25781411 CCAGGGGTCTGGAGCATAGGAGG + Intergenic