ID: 1185401004

View in Genome Browser
Species Human (GRCh38)
Location 22:50616851-50616873
Sequence CCAGGCGTGGCCAGGCTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185400997_1185401004 27 Left 1185400997 22:50616801-50616823 CCTGGCCAACATGATGAAGCTCC 0: 5
1: 397
2: 10578
3: 88943
4: 171349
Right 1185401004 22:50616851-50616873 CCAGGCGTGGCCAGGCTCAGTGG No data
1185400998_1185401004 22 Left 1185400998 22:50616806-50616828 CCAACATGATGAAGCTCCATCTG No data
Right 1185401004 22:50616851-50616873 CCAGGCGTGGCCAGGCTCAGTGG No data
1185400999_1185401004 6 Left 1185400999 22:50616822-50616844 CCATCTGTACTAAAAATATAAAA 0: 193
1: 13338
2: 218293
3: 142027
4: 67466
Right 1185401004 22:50616851-50616873 CCAGGCGTGGCCAGGCTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185401004 Original CRISPR CCAGGCGTGGCCAGGCTCAG TGG Intergenic
No off target data available for this crispr