ID: 1185401026

View in Genome Browser
Species Human (GRCh38)
Location 22:50616995-50617017
Sequence CCAGGCGTGGCCAGGCTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185401019_1185401026 27 Left 1185401019 22:50616945-50616967 CCTGGCCAACATGATGAAGCTCC 0: 5
1: 397
2: 10578
3: 88943
4: 171349
Right 1185401026 22:50616995-50617017 CCAGGCGTGGCCAGGCTCAGTGG No data
1185401021_1185401026 6 Left 1185401021 22:50616966-50616988 CCATCTGTACTAAAAATATAAAA 0: 193
1: 13338
2: 218293
3: 142027
4: 67466
Right 1185401026 22:50616995-50617017 CCAGGCGTGGCCAGGCTCAGTGG No data
1185401020_1185401026 22 Left 1185401020 22:50616950-50616972 CCAACATGATGAAGCTCCATCTG No data
Right 1185401026 22:50616995-50617017 CCAGGCGTGGCCAGGCTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185401026 Original CRISPR CCAGGCGTGGCCAGGCTCAG TGG Intergenic
No off target data available for this crispr