ID: 1185401887

View in Genome Browser
Species Human (GRCh38)
Location 22:50623242-50623264
Sequence TGTTGGCCTCCTCTGCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 6, 3: 18, 4: 206}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185401887_1185401893 4 Left 1185401887 22:50623242-50623264 CCTCCCTGCAGAGGAGGCCAACA 0: 1
1: 0
2: 6
3: 18
4: 206
Right 1185401893 22:50623269-50623291 AGGCAGAGCGTTGCCGTTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 74
1185401887_1185401894 5 Left 1185401887 22:50623242-50623264 CCTCCCTGCAGAGGAGGCCAACA 0: 1
1: 0
2: 6
3: 18
4: 206
Right 1185401894 22:50623270-50623292 GGCAGAGCGTTGCCGTTGAAGGG 0: 1
1: 0
2: 0
3: 2
4: 41
1185401887_1185401895 15 Left 1185401887 22:50623242-50623264 CCTCCCTGCAGAGGAGGCCAACA 0: 1
1: 0
2: 6
3: 18
4: 206
Right 1185401895 22:50623280-50623302 TGCCGTTGAAGGGAACAGCCAGG 0: 1
1: 0
2: 0
3: 7
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185401887 Original CRISPR TGTTGGCCTCCTCTGCAGGG AGG (reversed) Intronic
900514504 1:3074849-3074871 TGTTGGTCTGAGCTGCAGGGTGG + Intronic
901142048 1:7041256-7041278 TCTCGGCTTCCTCTGCAGAGGGG + Intronic
902727880 1:18349408-18349430 TGATGCCCTCCTCTGGAGGAAGG - Intronic
903182142 1:21610116-21610138 TGATGGCCCCCTCTACAAGGTGG - Exonic
903321998 1:22548779-22548801 TCTAGGCCTCCTCTGCAAAGCGG + Intergenic
903767642 1:25744894-25744916 TGTTTTCAGCCTCTGCAGGGAGG + Intronic
904825467 1:33271277-33271299 TGTTGGGCTCCTCGCCTGGGGGG + Intronic
905356956 1:37391444-37391466 TGTTGCACTCCTGTGCAGAGGGG + Intergenic
905372639 1:37492403-37492425 TGTTGGTCTCCTTTGCTGGGAGG - Intergenic
911205525 1:95088458-95088480 TCTTATCCTCCTCTGCAGTGAGG + Intergenic
912800872 1:112719093-112719115 GGTTGGCATCATCCGCAGGGCGG - Intergenic
913518857 1:119626949-119626971 TGTTGGCCTTTTCTGTAGAGGGG - Intronic
916070859 1:161168975-161168997 TCTTTGCTTCCTCTGCAGGGCGG + Exonic
917842738 1:178995293-178995315 TGTTGGGCTTCTCTACAGAGTGG + Intergenic
917969786 1:180199165-180199187 GGTGGGCCTCCTCAGCAGCGTGG + Exonic
919824610 1:201494458-201494480 TTCTGGCCTCCTTTGCAGGCTGG + Intronic
920374064 1:205497574-205497596 TGTTTGCTTTCTCTCCAGGGAGG + Intergenic
920908028 1:210189638-210189660 TGTGGGCCTCCACTGGAGGTTGG + Intergenic
921525747 1:216215556-216215578 TTTTGACCTCCTCTGAAGGCAGG + Intronic
922180661 1:223230574-223230596 GGGTGGCCTGCTCTGCAGGGAGG - Intronic
922800085 1:228361163-228361185 TCCTGGCCTTTTCTGCAGGGTGG + Intronic
923804406 1:237243024-237243046 TGTTGGCTTCGTATGCAGGCAGG + Intronic
1064149126 10:12848507-12848529 TGATCCCCTCCACTGCAGGGGGG + Intergenic
1067783484 10:49226141-49226163 TGTTGACTTCCTTTGCAGAGTGG - Intergenic
1070843249 10:79502698-79502720 GGTTTGCCTCCTCTGTGGGGTGG - Intergenic
1070930422 10:80256938-80256960 GGTTTGCCTCCTCTGTGGGGTGG + Intergenic
1076116724 10:127906602-127906624 TGGTGGCCTCCTCTGGAAAGAGG - Intergenic
1076408630 10:130230611-130230633 AGCTGGCCTCCACTGAAGGGAGG + Intergenic
1076862571 10:133146369-133146391 TGTTGGCCTCTTTAGCAAGGTGG - Intergenic
1081677103 11:44976699-44976721 TGCTGTCCTCTCCTGCAGGGTGG - Intergenic
1081842295 11:46211446-46211468 TTTGGGCCTCTGCTGCAGGGTGG + Intergenic
1083615773 11:64025513-64025535 TAGTGGACACCTCTGCAGGGAGG - Intronic
1083656030 11:64230219-64230241 TGTTGCTCCCCTCTGCAGCGAGG - Intronic
1084318006 11:68356562-68356584 TGTCAGCATCCTGTGCAGGGTGG + Intronic
1084603345 11:70159343-70159365 TGGCCACCTCCTCTGCAGGGAGG + Intronic
1085129787 11:74028440-74028462 TGCTGGCCTCCACTGCAAGAGGG - Intronic
1085259397 11:75195695-75195717 CTTTGGCCTCCTCTGCAGCCTGG + Intronic
1085337899 11:75711343-75711365 TGTTTGCCTCCACTGCTGAGGGG + Intergenic
1086339661 11:85835808-85835830 TGCTGCCCTCCCCTGCAGGCAGG - Intergenic
1087820758 11:102709442-102709464 TGATGACCTTCACTGCAGGGAGG + Intergenic
1088413834 11:109567518-109567540 TGCTGGCCTTCTCTGCAGGGAGG - Intergenic
1092175969 12:6407184-6407206 TGATAGCCTCCTCTGAAGAGTGG + Intergenic
1092551403 12:9505513-9505535 TGTTGAACTGCTTTGCAGGGGGG + Intergenic
1093737266 12:22635348-22635370 TGTTGGCATCAGCTGCTGGGAGG + Intronic
1102056123 12:109897900-109897922 TGTTGGTCTCCTTTGTTGGGTGG + Intergenic
1103440750 12:120961150-120961172 TGTGGGCCTCCCCTGAAGGCTGG + Intergenic
1105426655 13:20300396-20300418 TGGTGGCCACCTCAGCAGGGCGG - Intergenic
1106891843 13:34254384-34254406 TGTTGGTGTCCCCTGCAGAGGGG - Intergenic
1107242760 13:38257017-38257039 TGTGGGCCTAGTCTGCAGGATGG - Intergenic
1107569795 13:41644628-41644650 GGATGGCCTCCTGTGCAAGGTGG + Intronic
1110181747 13:72625854-72625876 TGCTTGCCTTCTCAGCAGGGAGG + Intergenic
1110734063 13:78913772-78913794 TGTTGGCCTTCTCCACAGAGAGG - Intergenic
1110760265 13:79223398-79223420 TGCTGGCATCCTCTACAGTGAGG + Intergenic
1114387172 14:22267456-22267478 AGTTGGCATCCTTTGCAGTGGGG - Intergenic
1114410557 14:22496588-22496610 TGTTGACCTCCTGTGCTGGGTGG + Intergenic
1114817558 14:25978889-25978911 TGTTGCTCTCGTCTGCAGGCTGG - Intergenic
1121048558 14:90805056-90805078 TGTTGGTGTCATCTCCAGGGTGG - Intronic
1122151108 14:99726716-99726738 TGGAGGCCCCCTCAGCAGGGGGG - Exonic
1122371651 14:101232303-101232325 TGTTTGCCAGCTCCGCAGGGAGG - Intergenic
1122387911 14:101361549-101361571 TGTTTTCCTCCTCTGTAGGGTGG + Intergenic
1122586042 14:102807274-102807296 TGATGGCCTCCTGGGCAGGCAGG - Intronic
1122744097 14:103887865-103887887 TGATGGCCTAGTCAGCAGGGCGG - Intergenic
1122918254 14:104868647-104868669 TGGCGGCCTCCTCGCCAGGGTGG - Intronic
1123704040 15:22938103-22938125 TCTTCTCCACCTCTGCAGGGTGG - Intronic
1129823401 15:78619553-78619575 TGGTGGCCACCCCTACAGGGTGG - Intronic
1130685289 15:86031853-86031875 TGTCAGCCTCCTCAGGAGGGAGG + Intergenic
1132232819 15:100197082-100197104 TGCAGACCTCCGCTGCAGGGAGG + Intronic
1132698569 16:1212604-1212626 TGCTGGGGTCCTCCGCAGGGTGG + Intronic
1132997065 16:2828964-2828986 TGGGGGCCTCCCCTCCAGGGAGG + Intergenic
1134305991 16:13033001-13033023 TGTTGGCCTCATTTTCAGGCAGG + Intronic
1136140190 16:28283428-28283450 TGTTGGCCTCCTCCTCTGAGGGG + Intergenic
1136235511 16:28911243-28911265 CGTGGCCCACCTCTGCAGGGAGG + Intronic
1136316860 16:29459607-29459629 TGTTGGCCTGCCCTGCAGGGTGG + Intergenic
1136318807 16:29469226-29469248 TGTTGGCCTGCCCTGCAGGGTGG + Intergenic
1136431435 16:30198949-30198971 TGTTGGCCTGCCCTGCAGGGTGG + Intronic
1136433379 16:30208570-30208592 TGTTGGCCTGCCCTGCAGGGTGG + Intronic
1138715862 16:59021499-59021521 TGTGGACCTCCCCAGCAGGGAGG + Intergenic
1139440640 16:66964949-66964971 TGTTGGCCCTTTCTCCAGGGTGG + Intronic
1140277469 16:73523433-73523455 TGCTGTCTTCCTGTGCAGGGTGG + Intergenic
1142200448 16:88758611-88758633 GCTTGGCCTGCTCTGCAGGTGGG - Intronic
1142815300 17:2420343-2420365 TGTGGGCCTGCTCTGCGGGAAGG - Exonic
1144825370 17:18102794-18102816 TCCTGCCCTCCTTTGCAGGGTGG + Intronic
1144853816 17:18257489-18257511 TGCTGGCCTGCCCTGCAGGGTGG - Intronic
1145979300 17:29002431-29002453 TCCTGGCCTCCTCAGCAGGGTGG - Intronic
1146555143 17:33816731-33816753 GGTTCGCCTCTTCTGCAGGAGGG - Intronic
1147979014 17:44263291-44263313 TGCTGGTCTCTTCTTCAGGGGGG + Intronic
1148610945 17:48964238-48964260 CGGTGGCCTCCTCTGAAGGTAGG + Intronic
1148644283 17:49210443-49210465 CCTTGGCTTCCTCTGCTGGGTGG + Exonic
1151254429 17:72864712-72864734 TGTTGGGCTCTTAGGCAGGGAGG - Intronic
1151524294 17:74653361-74653383 TCTCAGCCTCCTTTGCAGGGAGG - Intergenic
1152032747 17:77854142-77854164 GGTGGGCACCCTCTGCAGGGGGG + Intergenic
1152306069 17:79520734-79520756 TGTTGGACTCCCCTCCAGGGCGG + Intergenic
1152363910 17:79844467-79844489 GCTTGGCCTGCACTGCAGGGCGG + Intergenic
1152579701 17:81160466-81160488 TGCCGGCTTCCTCTGCGGGGGGG + Intronic
1152738189 17:82007678-82007700 GGTTGGCATCCTCTGCAGCCTGG - Intronic
1153665710 18:7366422-7366444 TGTTGACTTCCTTTGCAGGAAGG + Intergenic
1156072083 18:33224185-33224207 TCTTGTCCTTCCCTGCAGGGAGG - Intronic
1160507829 18:79437161-79437183 GGTGCGCCCCCTCTGCAGGGTGG + Intronic
1161224192 19:3135445-3135467 AGCTGCCCACCTCTGCAGGGTGG + Intergenic
1161441199 19:4292626-4292648 TTTTGGCCTCGGCTGCTGGGTGG + Exonic
1162471129 19:10872315-10872337 GCGTGGCCGCCTCTGCAGGGAGG + Intronic
1162986348 19:14272631-14272653 TGTTTGCTGCCTCTGCAGTGGGG + Intergenic
1163637945 19:18446075-18446097 TGTCAGCCTCCTTTGCAGTGGGG - Intronic
1163722683 19:18905754-18905776 GGGTGTCCTCCTCTGCTGGGCGG - Intronic
1164160892 19:22624770-22624792 TATTGGCCTCCTCAACAGGCTGG + Intergenic
1164605020 19:29591691-29591713 TGTTGGACACCTCGGCAGAGTGG - Intergenic
1167117562 19:47497104-47497126 TGCTGCTCTCCTCTGCAGCGTGG - Intronic
1167169883 19:47824021-47824043 TGGTTGCCTCCTCTGCAAAGTGG + Intronic
926240372 2:11080678-11080700 CGTAGGCCTCATCTGCAGGAAGG - Intergenic
926686025 2:15698303-15698325 TGTTTGCATTCTCGGCAGGGAGG - Intronic
930774768 2:55160973-55160995 TATTTGCCTCATCTGCAGGCAGG - Intergenic
934123026 2:88858157-88858179 TCAGGGCCTGCTCTGCAGGGAGG - Intergenic
936711574 2:115137458-115137480 TGTCGCTATCCTCTGCAGGGTGG - Intronic
937060965 2:118980208-118980230 CGTTGGCCCCTTCTCCAGGGTGG + Intronic
937885121 2:126894376-126894398 TGATGGCCACCTCTTCAGAGAGG + Intergenic
938483646 2:131682095-131682117 TCTGGGCCCCCTCTGCAGAGGGG + Intergenic
939273672 2:139971552-139971574 TTATGCCCTCCTCTCCAGGGTGG - Intergenic
940077831 2:149763536-149763558 TGTTGGCGTCCTCTAAAGGAAGG + Intergenic
944827267 2:203497195-203497217 TGCTGGCTTCCTCCACAGGGAGG - Intronic
948562369 2:238863164-238863186 AGTTGCCCTTCTCTGGAGGGAGG - Intronic
1171272934 20:23830451-23830473 TGCTGGCATGCACTGCAGGGAGG + Intergenic
1173255936 20:41394374-41394396 GGTCTGCCTCTTCTGCAGGGAGG + Intergenic
1173725473 20:45294004-45294026 TGATGCCCTCCTCTGCAAGCCGG + Exonic
1173798269 20:45877956-45877978 GCTTGGTCTCTTCTGCAGGGAGG - Exonic
1174040607 20:47697082-47697104 TGTTGGGTGGCTCTGCAGGGAGG - Intronic
1178581330 21:33840979-33841001 TGCAGGCCTGCTCTGCAGTGTGG - Intronic
1179493376 21:41756076-41756098 TGTGGGGGTCCTCTGCAGTGGGG - Intronic
1179879392 21:44287138-44287160 GGCTGGCTTCCCCTGCAGGGAGG - Intronic
1179887743 21:44321656-44321678 TGCTGACCTCCTGTGCAGGTTGG + Intronic
1179960987 21:44766878-44766900 TGTTTCCTGCCTCTGCAGGGAGG + Intergenic
1180071016 21:45435815-45435837 TGTCGGCCTCCTCTGCATTCAGG + Intronic
1180157940 21:45987018-45987040 TGATGGCCTCCTCTGCGTCGCGG - Exonic
1180195690 21:46192219-46192241 GCTTGGCGTCCTCTTCAGGGGGG - Intronic
1181055774 22:20259960-20259982 TGTGGGCCTCCCCTGCATCGGGG + Intronic
1181781303 22:25195546-25195568 AGTTGGCCTCCCTTCCAGGGAGG - Exonic
1181963065 22:26637010-26637032 TGATGGCCTCTTCTGGAGGCTGG - Intergenic
1184452771 22:44592681-44592703 TGCTGACCTGCTCTGCTGGGCGG - Intergenic
1184738737 22:46414639-46414661 TGCTGGCCTCAACTGCAGAGTGG - Intronic
1185401887 22:50623242-50623264 TGTTGGCCTCCTCTGCAGGGAGG - Intronic
950238198 3:11341935-11341957 TGTTGGAGTCCTCTGCAACGAGG - Intronic
950716031 3:14848321-14848343 AGCTGACCCCCTCTGCAGGGAGG + Intronic
954293196 3:49660542-49660564 GGTGAGCCTCCTCTGGAGGGGGG - Exonic
955388368 3:58498622-58498644 GTTTGGCCTCCTCTGTTGGGTGG + Exonic
958572931 3:95911511-95911533 GGTTGCCCTTCTCTGCAGGCAGG + Intergenic
961118461 3:124351944-124351966 TGTTGGATTCCTCTCTAGGGAGG - Intronic
961217896 3:125175722-125175744 TGCGGGCCATCTCTGCAGGGTGG + Intronic
961714322 3:128848276-128848298 GGCTGGCTTCCTCTGCAGGCCGG + Intergenic
962237284 3:133717454-133717476 TGTTCTTCTCCCCTGCAGGGTGG + Intergenic
963517555 3:146327006-146327028 TATTGGAGTCCTCTGCAAGGCGG + Intergenic
963531085 3:146474264-146474286 TGTTGTCCTCTTCTGCATGGAGG + Intronic
963804940 3:149713944-149713966 TGCTGGCCACCACTGCGGGGAGG + Intronic
964817759 3:160735221-160735243 TGTTGGCTTCTTCTTCAGGTTGG + Intergenic
968465620 4:748787-748809 TGTTGGTCTCGTCTGCGCGGAGG + Intronic
969423537 4:7110837-7110859 TGCTGACCTCCTCTGCAGAGTGG + Intergenic
969722508 4:8900337-8900359 TGAAGGCCGTCTCTGCAGGGAGG - Intergenic
971160977 4:24133769-24133791 TATTTGCCTTCTCTGTAGGGTGG + Intergenic
972917207 4:43896035-43896057 TGTTGGCCTCCCTTGCTAGGTGG + Intergenic
975741062 4:77429451-77429473 TGTGGGCCTCCTCTAGAGGAAGG + Intronic
977929678 4:102737310-102737332 TGTTTGCTTTCTCAGCAGGGAGG + Intronic
980084919 4:128380790-128380812 GGTTGACCTCTTCTGCAGGCTGG + Intergenic
981496667 4:145401396-145401418 TGTTGGCCTACCTTGCAGGTTGG + Intergenic
983484744 4:168320141-168320163 TTTTGGCCTCTTTTGGAGGGAGG - Intergenic
983774341 4:171587456-171587478 TGTTGGCCACTTCTGCTTGGTGG + Intergenic
986317446 5:6599979-6600001 TGTTGGCCTCTTCTGCATCTGGG + Exonic
986699854 5:10395785-10395807 TGTTGGCCTTCTCCTCAGGCTGG + Intronic
991147662 5:63325434-63325456 TGTTGGCTTCATCTTCAGGCTGG - Intergenic
995206635 5:109487976-109487998 CGGTGCCCTGCTCTGCAGGGAGG + Intergenic
997241210 5:132309461-132309483 TCTTGGGCCCCTCTTCAGGGAGG + Intronic
998046733 5:138993078-138993100 TCTCGGCCTCCTTTGCAGGGAGG + Intronic
1000579234 5:163014712-163014734 TGTTGGCATCATCTTCAGGCAGG + Intergenic
1001911030 5:175517887-175517909 GGTGTGCCTCCTCTGCAAGGAGG + Intronic
1002535434 5:179873145-179873167 AGATGTCCACCTCTGCAGGGGGG + Exonic
1002549706 5:179978134-179978156 TGTATGCCTCCTTTTCAGGGTGG - Intronic
1002635958 5:180608907-180608929 TGTTGCCCTCCCCTGGAGGAGGG - Intronic
1003084198 6:3048427-3048449 CGATGGCCTCCTCTTCAGGCAGG + Intergenic
1003516433 6:6822544-6822566 TGTTGAGCTCCTGTTCAGGGCGG - Intergenic
1004203481 6:13571282-13571304 TGTTTGCATGCTCTGCAGTGAGG - Intergenic
1005569302 6:27129406-27129428 TGATAGCCTCCTCTGAAGAGTGG + Intronic
1007423305 6:41732815-41732837 GGTTGGCCTCCTCTGATCGGAGG - Intronic
1009963502 6:70553155-70553177 GGCTGGTCTCCTCTGCTGGGGGG - Intronic
1010193654 6:73218870-73218892 TGTTGGCTTCCTCTTCAGGTTGG - Intronic
1010195346 6:73234145-73234167 TGTTGGCTTCCTCTTCGGGTTGG - Intronic
1010197055 6:73250478-73250500 TGTTGGCTTCCTCTTCAGGTTGG - Intronic
1011869459 6:91874371-91874393 TGTTGTACTCTTCTGCAGGGTGG - Intergenic
1012889714 6:104884529-104884551 TCCTGGCCTCCTATGCAGGTAGG - Intergenic
1015928732 6:138335249-138335271 TGTATGCCTGCTCTGCAAGGGGG - Intronic
1018889051 6:167968289-167968311 GGATGGCGCCCTCTGCAGGGTGG + Intronic
1022413865 7:30161421-30161443 TGTTGGTCTCCTTGGCTGGGGGG - Exonic
1025056676 7:55770927-55770949 TCTTGGCCTCCCAGGCAGGGCGG + Intergenic
1032148622 7:129407467-129407489 TCTTGCCATCCTCAGCAGGGTGG + Intronic
1032546769 7:132750496-132750518 TGCAGGTCTCCTGTGCAGGGCGG - Intergenic
1035677895 8:1467872-1467894 TGGTGGCCTCCTGACCAGGGGGG - Intergenic
1035682499 8:1498211-1498233 TGGAGGCTTCCTCTGCACGGTGG - Intergenic
1035822983 8:2614992-2615014 TGTTGGTCTCCGCAGCAGGATGG - Intergenic
1036034366 8:5003274-5003296 CCTTGGCCTACGCTGCAGGGTGG - Intergenic
1036197587 8:6733879-6733901 TGTTGGCATCCTATGCACAGTGG + Intronic
1036216453 8:6883714-6883736 TGGGGGCTTCCTCTTCAGGGAGG + Intergenic
1036739327 8:11347204-11347226 TCTTGGCCTCCCCAGCTGGGAGG - Intergenic
1038628429 8:29217171-29217193 TGCAGGCCTCCTCTACAGGGTGG - Intronic
1038980163 8:32750933-32750955 TATTGGCCTATCCTGCAGGGAGG + Intronic
1039643898 8:39257959-39257981 TGTAGACATCCTCTACAGGGAGG - Intronic
1042343346 8:67703349-67703371 TGCTGGCCTCCTGTCCAGGAGGG - Intronic
1049003421 8:139840217-139840239 CCCTGGCCTCCCCTGCAGGGAGG + Intronic
1049351994 8:142169578-142169600 TGCTGGTCCCCTCTCCAGGGAGG - Intergenic
1049423206 8:142525901-142525923 TCCTGGCCTCCTCTGCTGGGGGG - Intronic
1049549134 8:143248544-143248566 TGTTTGCCTCATGGGCAGGGCGG - Intronic
1049550126 8:143253503-143253525 TGTTGCCCTACACAGCAGGGTGG - Intronic
1051351998 9:16205711-16205733 TCTTGGCCTCCTCTGCACTTTGG - Intronic
1053090710 9:35273804-35273826 TGTTGGCCGCCTCTCAATGGAGG + Intronic
1054914922 9:70486798-70486820 TGTTGGCTTCATCTTCAGGCAGG - Intergenic
1055513002 9:77013662-77013684 TGTTGGACTTCTCTCCAAGGAGG + Intergenic
1056581514 9:87890297-87890319 TGTGGGGCTCCTCTGCTGGCGGG - Intergenic
1057877448 9:98768590-98768612 TGCTGGCCGGCTCTGCAGAGGGG - Intronic
1057927644 9:99167383-99167405 TGTTGCCTTCCTCTGCAGGGAGG - Intergenic
1059167430 9:112091997-112092019 CGCTGGCCTCCTCTGCTGGAAGG - Intronic
1059334555 9:113560644-113560666 TCTTGGCCGACTCTGCAGTGGGG + Intronic
1061388013 9:130301756-130301778 TGCTGGGCTCCTCTGCTGGCGGG + Intronic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1062481646 9:136755156-136755178 TGCTGGCCTATCCTGCAGGGCGG - Exonic
1189295957 X:39917911-39917933 TTTTAGCCTCCTTTGCAGGCTGG - Intergenic
1189315355 X:40052148-40052170 TGCTGGGCTCCTCTGTAGAGTGG - Exonic
1190626725 X:52344217-52344239 TGCTGTTCTCCTCTACAGGGTGG - Intergenic
1190701283 X:52991612-52991634 TGCTGTTCTCCTCTACAGGGTGG + Intronic
1192358681 X:70425239-70425261 TGTTGGGCTGCTCTGCTCGGGGG - Intronic
1193036014 X:76951954-76951976 TGTTGGCCTGCCTTGCAGGTTGG - Intergenic
1194877775 X:99210237-99210259 TGCTGGCATCTTCTGCAGAGCGG + Intergenic
1195142946 X:101981665-101981687 TATTTGCCACCTCTGTAGGGTGG + Intergenic
1196806286 X:119589789-119589811 TGTAAGCCTCCTCTGCTGAGCGG + Exonic
1198151855 X:133918980-133919002 TGCTGGCCTCTTCTGCAGCAGGG - Intronic
1201018264 Y:9625961-9625983 TGTTGGCATCCTCTGTAAGGAGG + Intergenic
1201729973 Y:17192647-17192669 AGCTGGCTCCCTCTGCAGGGAGG - Intergenic